Diabetes
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Appendix
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lindgren, C. M.
Right arrow Articles by Groop, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lindgren, C. M.
Right arrow Articles by Groop, L. C.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
Diabetes 50:2402-2405, 2001
© 2001 by the American Diabetes Association, Inc.

Characterization of the Annexin I Gene and Evaluation of Its Role in Type 2 Diabetes

Cecilia M. Lindgren, Anita Nilsson, Marju Orho-Melander, Peter Almgren, and Leif C. Groop

Department of Endocrinology, Wallenberg Laboratory, Malmö University Hospital, Malmö, Sweden


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 REFERENCES
 
In a previous study, we identified suggestive linkage between type 2 diabetes and a locus on chromosome 9p13-q21. This region contains the gene annexin I (ANXA1), encoding a protein suggested to be involved in both insulin secretion and insulin action. In this study, we sequenced the exon/intron boundaries of the human ANXA1 gene and performed mutation screening in 41 individuals from the initial linkage study. We identified five single nucleotide polymorphisms A58G, A401G, intronic variance sequence (IVS)8-28A/G, IVS11 +31A/G, and IVS12-11T/G, which were further tested for association to diabetes in 197 parent/offspring trios using the transmission disequilibrium test. No significant association with type 2 diabetes was observed, although the common A allele of the +58A/G variant gave a 22:12 transmission distortion (P = 0.12). This variant was further genotyped in 481 case and control subjects, but no difference in allele, genotype, or haplotype frequencies were observed between the groups. Further, a novel polymorphic (CA)15–25 repeat in intron 11 was genotyped in the subjects included in the initial linkage study. No improvement of the original finding was observed. We therefore concluded that the ANXA1 gene is unlikely to harbor variants that contribute to risk of type 2 diabetes.



    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 REFERENCES
 
Type 2 diabetes is a multifactorial, polygenic disorder characterized by chronic hyperglycemia resulting from pancreatic ß-cell dysfunction and insulin resistance. Several monogenic forms of diabetes have been described (1), but the identification of predisposing genetic factors to the common form of type 2 diabetes has been difficult due to the heterogeneous nature of the disease. To identify susceptibility genes predisposing to type 2 diabetes, we performed a genome wide scan in 58 Finnish families comprising 440 individuals (229 with type 2 diabetes) and identified suggestive linkage using nonparametric linkage (NPL) analysis (NPL score 3.9, P < 0.0002) to chromosome 9p13-q21 (C.M.L., M.M. Mahtani, E. Widén, M.I. McCarthy, M.J. Daly, A. Kirby, M.P. Reeve, L. Krugylak, M. Lehto, T. Kanninen, P.A., T. Tuomi, L.C.G., and E.S. Lander, unpublished observations). Furthermore, this region has also been implicated in other genome wide scans for type 2 diabetes and/or related traits (2,3) and contains a number of putative candidate genes for type 2 diabetes, including annexin 1 (ANXA1) (4,5).

Human ANXA1 (also called calpactin II, lipocortin 1, or p35) belongs to the annexin superfamily, which consists of at least 11 different, abundant, and ubiquitously expressed proteins (6). In vitro studies have suggested that ANXA1 may play an important role in the regulation of both insulin secretion (6,7,8,9,10,11,12), including stimulation of insulin secretion by the arachidonic acid–phospholipase A2 (cPLA2) pathway (13,14) or in the signal cascades initiated from the insulin receptor (7,8). Given these considerations, ANXA1 is a good candidate gene for impaired insulin secretion, insulin resistance, and type 2 diabetes.

The schematic human and rat ANXA1 gene structures have been described (5,15) (GenBank accession nos. U25414 and X05908), but to enable mutation screening, we characterized the ANXA1 gene by sequencing all exons and flanking intron segments as well as the 5'- and 3'-untranslated regions (UTRs) (Fig. 1A). These sequences have recently been independently confirmed (16).



View larger version (50K):
[in this window]
[in a new window]
 
FIG. 1. A: ANXA1 exon/intron boundaries. Lowercase letters designate the intronic sequences; uppercase letters designate the exonic sequences. The intron length varied from >6.5 kb of intron 1 to 93 bp of intron 2. The translation start (ATG) and the polyadenylation site (AATAAA) are marked with bold text. B: The schematic structure of human ANXA1. The transcription start (22) is indicated with an arrow (+1). The white areas represent the UTRs and the black areas represent translated regions. The five identified SNPs are viewed above the corresponding location. The figure is not drawn to scale.

 
Subsequently, the minimal promoter (180 bp), all exons including 25 bp of the flanking introns, and the 341bp 3' UTR were screened in 41 individuals with type 2 diabetes from our first study. Five single nucleotide polymorphisms (SNPs) were detected (Fig. 1B), including a silent A->G transition (Leu109Leu) in exon 5 and four SNPs in the noncoding parts of the gene. Three A->G transitions were found: one in the untranslated exon 1 (A58G), a second in intron 7, located 28 bp from the 5'end of exon 8 [intronic variance sequence (IVS)8–28A/G], and a third in intron 11, located 31 bp from the 3' end of exon 11 (IVS11+31A/G). In addition, we found a T->G transition located 11 bp from the 5' end of exon 12 (IVS12-11T/G).

Two of the SNPs, A58G and Leu401Leu, have been recently reported (17). An additional SNP, located in the 3' UTR (C1197T), was reported in two chromosomes (17) but could not be detected in our sequencing of eight chromosomes.

All five SNPs were tested for association in a sample of 197 Scandinavian unrelated parent-offspring trios (Table 1) with type 2 diabetes or abnormal glucose tolerance using the transmission disequilibrium test (TDT) (18). To increase the number of trios and the power in our study, we also included offspring with impaired fasting glucose (IFG) and impaired glucose tolerance (IGT) (19). We only used one trio per family to test for association; linkage to this region has already been suggested in the same population (Lindgren et al., unpublished observations). The TDT analysis did not reveal any significant association with type 2 diabetes (Table 2). The IVS12-11T/G variant was too rare to allow further evaluation. The A58G variant showed a 22:12 transmission distortion of the common A allele to the offspring (P = 0.12). We also analyzed this variant in a sample of 481 pairs of case and control subjects matched for age, sex, and geographical origin (Table 1). No difference in either allele or genotype frequency was detected between the two groups (P = 0.30 and P = 0.84, respectively) (Table 3). The (CA)15–25 repeat was genotyped in the 440 subjects of the initial linkage study, but no improvement of the original NPL score was observed in this analysis (data not shown).


View this table:
[in this window]
[in a new window]
 
TABLE 1 Clinical characteristics of subjects included in the TDT and case-control study

 

View this table:
[in this window]
[in a new window]
 
TABLE 2 TDT test of the five identified variants in the ANXA1 gene to 197 offspring

 

View this table:
[in this window]
[in a new window]
 
TABLE 3 Allele and genotype frequencies of the A58G variant in the ANXA1 gene in the 481 matched case-control pairs

 
ANXA1 is a good candidate gene for type 2 diabetes, considering its putative physiological role and location in a region on chromosome 9q21 to which we have detected suggestive linkage to type 2 diabetes. To facilitate a molecular screening, we characterized the ANXA1 gene. Our screening method, single-strand conformation polymorphism (SSCP), had only an ~96% sensitivity to detect variants, and, as only Caucasians were screened, it is possible that we may have missed some ANXA1 gene variants. However, genotyping of the identified SNPs in both family trios (TDT) and case-control populations did not provide consistent evidence for association between ANXA1 and type 2 diabetes. Although we most likely identified most of the common SNPs in the screened parts of ANXA1, we cannot exclude the presence of additional SNPs in nearby regions. We therefore conclude that it is unlikely that the ANXA1 gene harbors variants that increase the risk of type 2 diabetes.


    RESEARCH DESIGN AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 REFERENCES
 
Subjects.
To ascertain families for genetic studies in type 2 diabetes, we worked with government-established health care centers in Finland and Sweden. All subjects underwent extensive phenotyping as previously described (20) and gave their consent to the study, which was also approved by the local ethics committee. Glucose tolerance status was assessed in accordance with the 1998 guidelines of the World Health Organization (1). Patients with known maturity-onset diabetes of the young 1–5 mutations, age at diabetes onset <18 years, GAD antibodies >5 reference index units, and/or fasting C-peptide levels <0.2 nmol/l were excluded (19).

Determination of the exon/intron boundaries of the ANXA1 gene.
DNA from two healthy unrelated subjects was used for the determination of the exon/intron boundaries of the ANXA1 gene and to confirm the published cDNA sequence. Human genomic DNA extracted from lymphocytes was amplified using polymerase chain reaction (PCR) as previously described (21) (GeneAmp PCR system 9600; Perkin Elmer, Foster City, CA). The exon/intron boundary between intron 1 and exon 2 was determined with a Human Genome Walker Kit (Clontech, La Jolla, CA). This was performed in two steps: after the first PCR with an adapted primer 1 and one gene-specific primer (ANXA1-I2R), the product was amplified in a second "nested" PCR using adapter primer 2 and a second gene specific primer (ANXA1-I1R). The PCR product was then sequenced as described below.

The sequencing reactions were performed in both directions using the chain termination method with the Thermo Sequenase II Dye Terminator Cycle Sequencing Premix Kit (Amersham Pharmacia Biotech, Uppsala, Sweden). The sequencing products were separated on polyacrylamide gels using an ABI373A or ABI377 automated sequencer (Perkin Elmer). All results were analyzed using Sequencher 3.0 (Gene Codes, Ann Arbor, MI) by two independent readers.

Mutation screening of the ANXA1 gene by SSCP.
A total of 41 subjects with type 2 diabetes from 26 families who presented excess allele sharing at chromosome 9 in the initial linkage study were chosen for the mutation screening of ANXA1. In these subjects and in two nondiabetic control subjects without family history of diabetes, the minimal promoter (22), the exons, and flanking intronic sequences were screened for mutations using the SSCP technique (23). All gels were scored manually by two independent readers, and all samples with a band pattern deviating from the expected band pattern (given from the two control subjects) were sequenced to find the causative variant. In contrast to the published cDNA sequence, a G instead of T at nucleotide position 362 from the transcription start site (exon 5) was observed in all individuals sequenced. This nucleotide change does not change the amino acid sequence of the protein (Leu) (5). The TATA box and the CAAT box are the major regulatory elements needed for transcription of the gene (15,22); both are included in the screened promoter segment.

Genotyping of identified variants.
As linkage to the ANXA1 region has been suggested earlier, we only performed the test for association in the present study and therefore only one offspring per family was included. A total of 197 trios comprising 591 individuals were studied (Table 1). Of them, 101 offspring had type 2 diabetes, 65 had IGT, and 31 had IFG with normal 2-h blood glucose (1). We also selected an independent case-control replication sample from the same geographical area, including 481 patients with age at onset of type 2 diabetes >30 years or with severe IGT, i.e., a 2-h plasma glucose value >9.6 mmol/l during an oral glucose tolerance test. The control sample was made up of 481 age- and sex-matched nondiabetic subjects without family history of diabetes from the same geographical area (Table 1). Genotyping of the ANXA1 variants was performed using single base extension (SBE) with fluorescence polarization with modified protocols to allow high genotyping throughout (19). Genotypes were assigned by clustering data as previously described (19), and assignments were reviewed by at least two readers.

PCR and SBE primer sequences and PCR conditions used for this project are available on request or as an online appendix at http://diabetes.diabetesjournals.org.

Genotyping of the intron 11 (CA)n repeat of the ANXA1 gene.
A total of 440 individuals from the original linkage study (Lindgren et al. unpublished observations) were genotyped using the identified (CA)15–25 repeat in intron 11 of the ANXA1 gene. Genomic DNA (20 ng), prepared from peripheral blood lymphocytes, was amplified in 10-µl PCR, using a concentration of 2 µmol/l of primers (D9SANX1I11F:ATGGTGAGAGATGAGTTAGGA;D9SANX1I11R:GGGTAAGTGTCTCATATTCAG). The forward primer was end-labeled with fluorescent dye (DNA Technology, Aarhus, Denmark). Thirty cycles of PCR were performed (94°C for 30 s, 55°C for 30 s, and 72°C for 60 s), and 0.7 µl of each reaction was loaded onto a denaturing 6% polyacrylamide gel and electrophoresed for up to 4 h in 1 x Tris-borate-EDTA. The gels were run using ABI 377 Sequencers (Perkin Elmer) for fluorescent detection; two independent scorers read all gels, and discrepancies were subjected to a checking process, including repeating PCR for the entire family in question. Data were also checked for Mendelian segregation using the PEDMANAGER software (M.P. Reeve and M.J. Daly, personal communication).

Statistical analysis.
All phenotype data in Table 1 are expressed as means ± SD. Transmission distortion from heterozygous parents was calculated using the McNemar test (18). P values for differences in allelic frequencies between case and control subjects were determined using the {chi}2 distribution with one degree of freedom. Haplotype combinations of the five variants were tested for association with abnormal glucose tolerance using the {chi}2 distribution with one degree of freedom as implemented in the Genehunter (24) version 2.0 package.

The NPL score was also computed using the Genehunter (24) version 2.0 software, which performs complete multipoint analysis of the statistical significance of sharing alleles identical by descent among all affected family members at each location in the genome.


    ACKNOWLEDGMENTS
 
This work was supported by grants from the Sigrid Juselius Foundation, the JDF Wallenberg Foundation, European Commission grant Genome Integrated Force by Type 2 Diabetes (GIFT), the Novo Nordisk Foundation, the Finnish Diabetes Research Foundation, the Royal Physiografic Society, the Medical Faculty of Lund University, Anna-Lisa and Sven Lundgrens Foundation, Director Albert Påhlssons Foundation, and the Swedish Medical Research Council. C.M.L. is supported by the Foundation for Strategic Research through National Network for Cardiovascular Disease (NNCR).

We are grateful to the patients and their families for their willingness to participate in the study and to the Botnia Research Team for the family collection and phenotyping. We are indebted to Anna Berglund and Charles R. Lane for skillful technical assistance. We also thank E.S. Lander for allowing us to use the excellent genotyping facilities at Whitehead Institute for Biomedical Research, Maine Institute of Technology, Cambridge, Massachusetts.


    FOOTNOTES
 
Address correspondence to Leif C. Groop, Department of Endocrinology, Wallenberg Laboratory, Malmö University Hospital, S-205 02 Malmö, Sweden. E-mail: leif.groop{at}endo.mas.lu.se.

Address reprint requests to Cecilia M. Lindren, Department of Endocrinology, Wallenberg Laboratory, Malmö University Hospital, S-205 02 Malmö, Sweden. E-mail: cecilia.lindgren{at}endo.mas.lu.sc.

Received for publication 24 January 2001 and accepted in revised form 8 July 2001.

ANXA1, annexin 1; IFG, impaired fasting glucose; IGT, impaired glucose tolerance; IVS, intronic variance sequence; NPL, nonparametric linkage; PCR, polymerase chain reaction; SBE, single base extension; SSCP, single-strand conformation polymorphism; TDT, transmission disequilibrium test; UTR, untranslated region.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 REFERENCES
 

  1. Alberti KG, Zimmet PZ: Definition, diagnosis and classification of diabetes mellitus and its complications. I. Diagnosis and classification of diabetes mellitus provisional report of a WHO consultation. Diabet Med 15:539–553, 1998[Medline]
  2. Luo T, Zhao Y, Li G, Yuan W, Zhao J, Chen J, Huang W, Luo M: A genome-wide search for type II diabetes susceptibility genes in Chinese Hans. Diabetologia 44:501–506, 2001[Medline]
  3. Hanis CL, Boerwinkle E, Chakraborty R, Ellsworth DL, Concannon P, Stirling B, Morrison VA, Wapelhorst B, Spielman RS, Gogolin-Ewens KJ, Shepard JM, Williams SR, Risch N, Hinds D, Iwasaki N, Ogata M, Omori Y, Petzold C, Rietzch H, Schroder HE, Schulze J, Cox NJ, Menzel S, Boriraj VV, Chen X, Lim LR, Lindner T, Mereu LE, Wang Y-Q, Xiang K, Yamagata K, Yang Y, Bell GI: A genome-wide search for human non-insulin-dependent (type 2) diabetes genes reveals a major susceptibility locus on chromosome 2. Nat Genet 13(2):161–166, 1996
  4. Huebner K, Cannizzaro LA, Frey AZ, Hecht BK, Hecht F, Croce CM, Wallner BP: Chromosomal localization of the human genes for lipocortin I and lipocortin II. Oncogene Res 2:299–310, 1988[Medline]
  5. Wallner BP, Mattaliano RJ, Hession C, Cate RL, Tizard R, Sinclair LK, Foeller C, Chow EP, Browing JL, Ramachandran KL, Blake Pepinsky R: Cloning and expression of human lipocortin, a phospholipase A2 inhibitor with potential anti-inflammatory activity. Nature 320:77–81, 1986[Medline]
  6. Antonicelli F, Omri B, Breton MF, Rothhut B, Russo-Marie F, Pavlovic-Hournac M, Haye B: Identification of four lipocortin proteins and phosphorylation of lipocortin I by protein kinase C in cytosols of porcine thyroid cell cultures. FEBS Lett 258:346–350, 1989[Medline]
  7. Karasik A, Pepinsky RB, Shoelson SE, Kahn CR: Lipocortins 1 and 2 as substrates for the insulin receptor kinase in rat liver. J Biol Chem 263:11862–11867, 1988
  8. Melki V, Hullin F, Mazarguil H, Fauvel J, Ragab-Thomas JM, Chap H: Annexin I as a potential inhibitor of insulin receptor protein tyrosine kinase. Biochem Biophys Res Commun 203:813–819, 1994[Medline]
  9. Ohnishi M, Tokuda M, Masaki T, Fujimura T, Tai Y, Itano T, Matsui H, Ishida T, Konishi R, Takahara J: Involvement of annexin-I in glucose-induced insulin secretion in rat pancreatic islets. Endocrinology 136:2421–2426, 1995[Abstract]
  10. Hall JL, Matter CM, Wang X, Gibbons GH: Hyperglycemia inhibits vascular smooth muscle cell apoptosis through a protein kinase C-dependent pathway. Circ Res 87:574–580, 2000[Abstract/Free Full Text]
  11. Meers P, Mealy T, Tauber AI: Annexin I interactions with human neutrophil specific granules: fusogenicity and coaggregation with plasma membrane vesicles. Biochim Biophys Acta 1147:177–184, 1993[Medline]
  12. Schlaepfer DD, Haigler HT: In vitro protein kinase C phosphorylation sites of placental lipocortin. Biochemistry 27:4253–4258, 1988[Medline]
  13. Jolly YC, Major C, Wolf BA: Transient activation of calcium-dependent phospholipase A2 by insulin secretagogues in isolated pancreatic islets. Biochemistry 32:12209–12217, 1993[Medline]
  14. Loweth AC, Scarpello JH, Morgan NG: A specific inhibitor of cytosolic phospholipase A2 activity, AACOCF3, inhibits glucose-induced insulin secretion from isolated rat islets. Biochem Biophys Res Commun 218:423–427, 1996[Medline]
  15. Morgan RO, Fernandez MP: A BC200-derived element and Z-DNA as structural markers in annexin I genes: relevance to Alu evolution and annexin tetrad formation. J Mol Evol 41:979–985, 1995[Medline]
  16. Available from http: //www.ncbi.nlm.nih.gov/AceView/hs.cgi?l=301
  17. Available from http: //www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?l=301
  18. Spielman RS, McGinnis RE, Ewens WJ: Transmission test for linkage disequilibrium: the insulin gene region and insulin-dependent diabetes mellitus (IDDM). Am J Hum Genet 52:506–516, 1993[Medline]
  19. Altshuler D, Hirschhorn JN, Klannemark M, Lindgren CM, Vohl MC, Nemesh J, Lane CR, Schaffner SF, Bolk S, Brewer C, Tuomi T, Gaudet D, Hudson TJ, Daly M, Groop L, Lander ES: The common PPARgamma Pro12Ala polymorphism is associated with decreased risk of type 2 diabetes. Nat Genet 26:76–80, 2000[Medline]
  20. Groop L, Forsblom C, Lehtovirta M, Tuomi T, Karanko S, Nissen M, Ehrnstrom BO, Forsen B, Isomaa B, Snickars B, Taskinen MR: Metabolic consequences of a family history of NIDDM (the Botnia study): evidence for sex-specific parental effects. Diabetes 45:1585–1593, 1996[Abstract]
  21. Widen E, Lehto M, Kanninen T, Walston J, Shuldiner AR, Groop LC: Association of a polymorphism in the beta 3-adrenergic-receptor gene with features of the insulin resistance syndrome in Finns. N Engl J Med 333:348–351, 1995[Abstract/Free Full Text]
  22. Donnelly SR, Moss SE: Functional analysis of the human annexin I and VI gene promoters. Biochem J 332:681–687, 1998
  23. Orita M, Suzuki Y, Sekiya T, Hayashi K: Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5:874–879, 1989[Medline]
  24. Kruglyak L, Daly MJ, Reeve-Daly MP, Lander ES: Parametric and nonparametric linkage analysis: a unified multipoint approach. Am J Hum Genet 58:1347–1363, 1996[Medline]

Add to CiteULike CiteULike   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J Mol EndocrinolHome page
Y. H. Suh, Y. Kim, J. H. Bang, K. S. Choi, J. W. Lee, W.-H. Kim, T. J. Oh, S. An, and M. H. Jung
Analysis of gene expression profiles in insulin-sensitive tissues from pre-diabetic and diabetic Zucker diabetic fatty rats
J. Mol. Endocrinol., April 1, 2005; 34(2): 299 - 315.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Appendix
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lindgren, C. M.
Right arrow Articles by Groop, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lindgren, C. M.
Right arrow Articles by Groop, L. C.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Diabetes Diabetes Care Clinical Diabetes Diabetes Spectrum