Diabetes
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harmon, J. S.
Right arrow Articles by Robertson, R. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harmon, J. S.
Right arrow Articles by Robertson, R. P.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
Diabetes 50:2481-2486, 2001
© 2001 by the American Diabetes Association, Inc.

Antecedent Hyperglycemia, Not Hyperlipidemia, Is Associated With Increased Islet Triacylglycerol Content and Decreased Insulin Gene mRNA Level in Zucker Diabetic Fatty Rats

Jamie S. Harmon, Catherine E. Gleason, Yoshito Tanaka, Vincent Poitout, and R. Paul Robertson

Pacific Northwest Research Institute and the Departments of Medicine and Pharmacology, University of Washington, Seattle, Washington


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Type 2 diabetes is caused by a combination of ß-cell dysfunction and insulin resistance. Over time, hyperglycemia worsens, a phenomenon that has been attributed to deleterious effects of chronic hyperglycemia (glucotoxicity) or chronic hyperlipidemia (lipotoxicity) on ß-cell function and is often accompanied by increased islet triacylglycerol (TAG) content and decreased insulin gene expression. To examine these two potentially pathogenic forces, we studied Zucker rats (leptin receptor wild type, +/+; heterozygous, +/-; and mutant, -/-). First, +/+ and +/- Zucker rats were compared metabolically. At 6 weeks of age, the +/- rats had a lower level of islet insulin mRNA compared with +/+. At 12 weeks of age, differences were found in body weight and islet TAG content; however, levels of insulin mRNA were equivalent. Second, we examined whether worsening of the diabetic state in the homozygous mutant (-/-) Zucker diabetic fatty (ZDF) rat is related more to chronic hyperglycemia or to hyperlipidemia. The ZDF rats were treated for 6 weeks with either bezafibrate, a lipid-lowering drug that does not affect plasma glucose levels, or phlorizin, a drug that reduces plasma glucose without lowering lipid levels. Bezafibrate treatment lessened the rise in plasma TAG observed in nontreated rats (239 ± 16 vs. 388 ± 36 mg/dl, treated versus nontreated; P < 0.0001) but did not prevent the rise in fasting plasma glucose. Despite lowering plasma TAG, bezafibrate was not effective in preventing an increased islet TAG content and did not prevent the associated decrease in insulin mRNA levels. Phlorizin treatment prevented hyperglycemia (61 ± 2 vs. 145 ± 7 mg/dl, treated versus nontreated; P < 0.0001) and lowered islet TAG content (32.7 ± 0.7 vs. 47.8 ± 2.7 ng/islet, treated versus nontreated; P < 0.0001) and preserved insulin mRNA levels without preventing hypertriglyceridemia. Plasma free fatty acid level did not correlate with changes in islet TAG or insulin mRNA levels. We conclude that antecedent elevated plasma glucose levels, not plasma lipid levels, are associated with elevated islet TAG content and decreased insulin mRNA levels in ZDF animals.



    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
After the onset of type 2 diabetes in experimental animals, chronic hyperglycemia is associated with defects in insulin gene expression (1,2,3,4,5). The mechanism of the decrease in insulin gene expression in Zucker diabetic fatty (ZDF) (2,4) and 90% pancreatectomized (4) rats, two animal models of type 2 diabetes, has been shown to be due in part to diminished DNA binding of the transcription factor pancreatic/duodenal homeobox-1 (PDX-1). We have reported that prevention of hyperglycemia and hyperlipidemia by troglitazone treatment in the ZDF rat preserves insulin and PDX-1 mRNAs and PDX-1 binding to DNA (2). Because increased triacylglycerol (TAG) content has been observed in the islets of ZDF rats (6,7), it has been posited to play a role in diabetes in this model (8,9). In support of this notion, islets cultured in high free fatty acid (FFA) media have increased TAG content (7,10,11), decreased glucose-stimulated insulin secretion and biosynthesis (12), and decreased insulin gene expression (13). Moreover, in addition to preventing hyperglycemia and hyperlipidemia, troglitazone treatment prevented increased islet TAG content in ZDF rats (14) and in islets cultured in high FFA and high glucose concentrations (15). Lee et al. (6) reported that plasma FFA levels precede the rise in plasma glucose levels in ZDF animals by 2 weeks and that correlations exist among plasma FFA, plasma glucose, and islet TAG. However, neither this nor other studies attempted to differentiate prospectively hyperglycemia versus hyperlipidemia in vivo as secondary metabolic forces that lead to further islet TAG accumulation and decreased insulin gene expression. To address this issue, we first genotyped and metabolically compared heterozygote (+/-) animals with the wild-type (+/+) animals. We next treated ZDF (-/-) rats with a drug that selectively decreases plasma lipids without affecting blood glucose levels (bezafibrate) or one that decreases plasma glucose without affecting plasma lipids (phlorizin). The mechanism of action of bezafibrate involves activation of peroxisome proliferator–activated receptor-{alpha}; induction of lipoprotein lipase (LPL) activity, which increases hydrolysis of plasma TAG; stimulation of cellular fatty acid uptake; increased peroxisomal and mitochondrial ß-oxidation; and decreased synthesis of fatty acids, TAG, and VLDL (reviewed in Schoonjans et al. [16]). Phlorizin inhibits glucose reabsorption by the renal tubular cells. Our results indicate that wild-type and heterozygous Zucker rats are metabolically similar and that defective insulin mRNA level, which occurs only in the homozygous mutant ZDF animal, is associated with antecedent chronic hyperglycemia but not chronic hyperlipidemia.


    RESEARCH DESIGN AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals.
Male Zucker lean control (ZLC/Gmi +/- and +/+) rats and Zucker diabetic fatty (ZDF/Gmi -/-) rats were purchased from Genetic Models (Indianapolis, IN) at 5 weeks of age. Animals were maintained on an ad libitum diet of Purina 5008 chow (7.5% fat) as recommended by Genetic Models.

Genotyping.
A method by Phillips et al. (17), modified by Dr. Elizabeth Rutledge at the Molecular Genetics Core of the University of Washington Diabetes Center, was used to genotype the Zucker rats. DNA was isolated from 3-mm tail snips. The tissue was placed in 0.5 ml of extraction buffer (100 mmol/l Tris-HCl [pH 8.5], 5 mmol/l EDTA, 0.2% SDS, 200 mmol/l NaCl, and 200 µg/ml proteinase K) and incubated overnight at 55°C in a shaking water bath. After a 15-min centrifugation at 15,500g, the supernatant was added to 0.5 ml of ice-cold isopropanol and the tubes were shaken to form a precipitant. The tubes were centrifuged at 15,500g for 3 min, and the supernatant was discarded. The pellets were washed two times with cold 70% ethanol and air-dried. The DNA was dissolved in 500 µl of H2O at 55°C for 1 h, and the concentration was determined spectrophotometrically. Polymerase chain reactions (PCRs) were performed using the Promega PCR Core System I, 100 ng of DNA, 14 pmol of each primer, and 30 units of Taq enzyme with the following cycling conditions: 92°C for 2 min, 49 cycles of 92°C for 30 s, 65°C for 30 s, 68°C for 3 min, then 5 min at 68°C. The amplified product of 1.8 kb was digested with MspI (New England Biolabs, Beverly, MA), generating a 1.1-kb band for the wild type (+/+), a 1.0-kb band for the mutant (-/-), and 1.1- and 1.0-kb bands for the heterozygote (+/-).

Treatments.
Starting at 6 weeks of age, the rats were nontreated, were treated orally with an admixture of 0.3% bezafibrate (Sigma) for 6 weeks, or received an injection of 0.4 g/kg phlorizin (Sigma) (in 40% propylene glycol) every 12 h for 6 weeks. Starting at 7 weeks of age, another subset of rats received Linplant, a subcutaneous insulin implant that releases 2 units/24 h of insulin (Linshin Canada, Ontario, Canada); additional insulin pellets were implanted as needed over the course of the study in an attempt to obtain glucose levels similar to those seen in lean animals. Control ZDF rats received the same number of mock implants. Each animal received between three and six implants total over the course of 5 weeks. Animals were anesthetized, and blood samples were collected from the tail vein after an overnight fast (~16 h), except for those that were treated with insulin, which were not fasted to avoid severe hypoglycemia. Plasma glucose concentration was determined using a Glucose Analyzer 2 (Beckman Instruments, Fullerton, CA). Blood was also collected via cardiac puncture at the time that the rats were killed for plasma insulin, TAG, and FFA level determinations. The Sensitive Rat Insulin RIA KIT (Linco Research, St. Louis, MO) was used to measure plasma insulin levels. Plasma TAG levels were measured by the GPO-Trinder (#339) method (Sigma Diagnostics, St. Louis, MO). Plasma FFA levels were measured immediately using the Half-micro test (Boehringer-Mannheim).

Islet isolation.
Islets were isolated essentially as described previously (2). After removal of the pancreas, collagenase digestion occurred at 37°C for 17 min. After 15 s of vigorous shaking, the undigested tissue was removed by a 500-µm screen. Isolated islets were handpicked twice. Because of the small numbers of islets that could be isolated from each ZDF rat, islets (~100–200) were pooled from two to three animals to obtain sufficient sample material for the various assays.

TAG content.
Islet TAG content was measured after chloroform:methanol extraction as described by Briaud et al. (11).

Insulin content.
Islet insulin content was measured in 10 islets after acid extraction as described by Zhou and Grill (12).

Analysis of insulin mRNA.
Isolated islets (100–200) were cultured overnight at 37°C in RPMI 1640 containing 11.1 mmol/l glucose with 10% fetal bovine serum. Islets were cultured with high-glucose media overnight to mimic the high-glucose environment of the ZDF animal. To be consistent and to provide equal stimulation of insulin gene expression, we also used high-glucose concentration for the ZLC islets. Islets were washed with phosphate-buffered saline, and total RNA was extracted according to the method of Chomczynski and Sacchi (18). One-step reverse transcriptase–PCR was carried out using an ABI Prism 7700 sequence detector equipped with a thermocycler (Taqman Technology) as described by Tanaka et al. (19). Insulin mRNA levels are expressed relative to ß-actin mRNA levels. Primer and probe sequences are as follows: probe, rat insulin 6FAM-AGCTTCCACCAAGTGAGAACCACAAAGGT-TAMRA; forward primer, rat insulin GCCCAGGCTTTTGTCAAACA; reverse primer, rat insulin CTCCCCACACACCAGGTAGAG; probe, rat ß-actin 6FAM-AGGCATCCTGACCCTGAAGTACCCCA-TAMRA; Forward primer, rat ß-actin ACGAGGCCCAGAGCAAGA; reverse primer, rat ß-actin TTGGTTACAATGCCGTGTTCA.

Statistics.
Data are presented as means ± SE and analyzed by one-way analysis of variance.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
ZLC rats.
To ascertain whether rats heterozygous for the mutation of one allele for the leptin receptor (ZLC, +/-) have a moderate or intermediate phenotype of type 2 diabetes, we compared their characteristics with the wild-type rats (ZLC, +/+; Table 1). At 6 weeks of age, the only observed difference between the two groups was a lower level of insulin mRNA in the ZLC (+/-) compared with ZLC (+/+) rats (P < 0.02). However, at 12 weeks of age, the level of insulin message was similar in the two groups. In the older animals, a significant increase in islet TAG content was observed between ZLC (+/+) and (+/-) (P < 0.0001), which was accompanied by a decreased body weight.


View this table:
[in this window]
[in a new window]
 
TABLE 1 Characteristics of ZLC rats

 
ZDF rats.
The body weight of ZDF rats at 12 weeks of age remained unchanged with bezafibrate and phlorizin treatments and increased with insulin treatment (Table 2). The fasting plasma glucose level of ZDF rats was significantly elevated at 12 weeks of age compared with the level observed at 6 weeks of age (Fig. 1). The glucose level continued to rise in the ZDF animals that were treated with bezafibrate for 6 weeks, whereas phlorizin treatment was effective not only in preventing an increased glucose level but also in lowering it below that observed in control animals. Insulin treatment significantly reduced the fed glucose level compared with nontreatment (227 ± 22 vs. 559 ± 12 mg/dl, respectively; P < 0.0001). However, this level was not reduced to that observed in fed lean animals (143 ± 6 mg/dl, n = 13) and thus was not as effective as phlorizin in preventing hyperglycemia. As expected, the plasma TAG level of the 12-week-old nontreated ZDF rats was higher than at 6 weeks of age (388 ± 36 vs. 180 ± 9 mg/dl, respectively; P < 0.0001; Fig. 2). Treatment with bezafibrate was effective in preventing the rise in plasma TAG (240 ± 16 mg/dl; P < 0.0001 vs. nontreatment), whereas phlorizin treatment was not (559 ± 51 mg/dl). Insulin treatment had no significant effect on the fed level of plasma TAG. In the nontreated ZDF group, the FFA level declined at 12 weeks of age compared with 6 weeks of age (0.51 ± 0.05 vs. 0.96 ± 0.05 mmol/l, respectively; P < 0.0001; Fig. 3). This is consistent with recently reported data (2) but in contrast to the levels reported by Lee et al. (6), which likely is due to a difference in the source of rat colony. In ZDF rats, treatment with bezafibrate and phlorizin were associated with a significant elevation of the FFA level (0.73 ± 0.72 mmol/l [P < 0.005] and 0.96 ± 0.05 mmol/l [P < 0.0001], respectively) compared with 12-week-old nontreated rats, whereas insulin treatment was not. Plasma insulin levels were closely associated with plasma glucose; the highest insulin levels occurred in the animals with the highest glucose (Table 2). The insulin content of the islets was inversely proportional to the plasma insulin level. The TAG content (Fig. 4) of ZDF islets was similar at 6 and 12 weeks of age. Insulin treatment had no effect on islet TAG content (48.2 ± 2.7 ng/islet; NS), whereas it was significantly reduced in the phlorizin-treated group (32.7 ± 0.7 ng/islet; P < 0.001) compared with nontreated animals (47.8 ± 2.7 ng/islet). There was no decrease in islet TAG content in the bezafibrate-treated group. Islet insulin mRNA was significantly reduced in ZDF rats at 12 weeks of age compared with 6 weeks of age (0.23 ± 0.1 vs. 1.0 ± 0.1, arbitrary units, respectively; P < 0.05; Fig. 5). Phlorizin treatment prevented this fall in insulin mRNA, whereas treatments with bezafibrate or insulin did not.


View this table:
[in this window]
[in a new window]
 
TABLE 2 Characteristics of ZDF rats

 


View larger version (44K):
[in this window]
[in a new window]
 
FIG. 1. Levels of plasma glucose at 6 and 12 weeks of age in fasted ZDF rats that were either nontreated or treated for 6 weeks with bezafibrate or phlorizin (A) and in fed ZDF rats that were treated for 5 weeks with mock (nontreated) or insulin implants (B; n = 9–20). *P < 0.0001 versus 6-week-old; #P < 0.0001 versus 12-week-old nontreated. Animals in the insulin treatment group were not fasted to avoid hypoglycemia; note difference in scale in A and B.

 


View larger version (38K):
[in this window]
[in a new window]
 
FIG. 2. Levels of plasma TAG at 6 and 12 weeks of age in fasted ZDF rats that were either nontreated or treated for 6 weeks with bezafibrate or phlorizin (A) and in fed ZDF rats that were treated for 5 weeks with mock (nontreated) or insulin implants (B; n = 9–20). *P < 0.0001 versus 6-week-old; #P < 0.0001 versus 12-week-old nontreated. Animals in the insulin treatment group were not fasted to avoid hypoglycemia; note difference in scale in A and B.

 


View larger version (35K):
[in this window]
[in a new window]
 
FIG. 3. Levels of plasma FFA at 6 and 12 weeks of age in fasted ZDF rats that were either nontreated or treated for 6 weeks with bezafibrate or phlorizin (A) and in fed ZDF rats that were treated for 5 weeks with mock (nontreated) or insulin implants (B; n = 9–20). *P < 0.0001 versus 6-week-old; #P < 0.005 for bezafibrate treated and P < 0.0001 for phlorizin-treated versus 12-week-old nontreated. Animals in the insulin treatment group were not fasted to avoid hypoglycemia.

 


View larger version (41K):
[in this window]
[in a new window]
 
FIG. 4. Levels of islet TAG content at 6 and 12 weeks of age in fasted ZDF rats that were either nontreated or treated for 6 weeks with bezafibrate or phlorizin (A) and in fed ZDF rats that were treated for 5 weeks with mock (nontreated) or insulin implants (B; n = 4–5 [each n contains islets pooled from two to three rats]). #P < 0.001 for phlorizin-treated versus 12-week-old nontreated.

 


View larger version (27K):
[in this window]
[in a new window]
 
FIG. 5. Levels of islet insulin mRNA at 6 and 12 weeks of age in fasted ZDF rats that were either nontreated or treated for 6 weeks with bezafibrate or phlorizin (A) and in fed ZDF rats that were treated for 5 weeks with mock (nontreated) or insulin implants (B). Insulin mRNA levels are expressed relative to the level of ß-actin (n = 3–9 [each n contains islets pooled from two to three rats]), *P < 0.05 versus 6-week-old; #P < 0.04 treated versus 12-week-old nontreated.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The concept of glucose toxicity of the ß-cell was considered as early as 15 years ago (20,21) and has received support from many investigators (22,23,24,25,26,27,28). Its potential mechanisms of action include chronic oxidative stress (19,29) and participation with fatty acids in the formation of islet lipids. The latter mechanism has led to the concept of lipotoxicity (30), which has received support from many investigators as well (6,7,8,9,10,13,31). The possibility that toxic effects of lipids may take place only in the setting of high-glucose concentrations has been advanced by in vitro studies (11,13,32). However, this possibility has not been examined previously in vivo. For example, two reports (2,14) describing the beneficial effects of troglitazone in ZDF rats established that treatment with this drug is associated with lower TAG content and prevention of islet apoptosis (14) as well as preservation of PDX-1 and insulin gene expression and glucose-stimulated insulin secretion (2), yet troglitazone treatment lowers plasma levels of both glucose and TAG in ZDF rats (2). This prompted us to conduct the studies described herein to examine the consequences of preventing either hyperglycemia or hyperlipidemia as independent variables. Although apoptosis of ß-cells is clearly an important concern, it likely is not a variable in this study as Pick et al. (33) reported an increase in ß-cell mass and Ohneda et al. (34) demonstrated an increase in ß-cell volume, both in 12-week-old ZDF rats.

Phlorizin treatment for 6 weeks in ZDF animals prevented hyperglycemia but not hypertriglyceridemia and also prevented the increase in islet TAG content and the decrease in insulin mRNA observed in nontreated animals. Similar observations have been made in partially pancreatectomized animals (35) in which phlorizin treatment reversed hyperglycemia and normalized islet gene expression of several mRNAs without changes in plasma fatty acids, whereas treatment with vehicle alone had no effect. Rossetti et al. (36) were able to normalize insulin sensitivity with phlorizin treatment in diabetic animals and, in a later study (21), found that the associated improvements in ß-cell function could not be attributed to an increased ß-cell mass or insulin content. However, TAG levels in the plasma and islets were not reported in these previous studies. In contrast to our results with phlorizin, which completely prevented hyperglycemia, incomplete prevention of hyperglycemia in the insulin-treated group had no beneficial effects on elevated islet TAG or decreased insulin mRNA. Bezafibrate successfully prevented hypertriglyceridemia but not hyperglycemia and failed to preserve insulin mRNA. Our observation that insulin mRNA levels are dramatically decreased in the bezafibrate group at 12 weeks is consistent with the onset of defective insulin gene expression. Despite these low levels of insulin mRNA, improvement in insulin content was observed. We have no explanation for this, but it seems possible that bezafibrate may have independent effects on translation or processing of preproinsulin. Regardless, the animals remained hyperglycemic, suggesting that their insulin secretory reserve was insufficient to match the insulin resistance associated with obesity. Plasma FFA levels did not correlate with changes in islet TAG content or insulin mRNA in any treatment group. This lack of correlation agrees with our previous report (2) but not with others (6). This difference could be due to differences in ZDF colonies and/or differences in sample handling. The latter is an important consideration because delay in assay can lead to artifactual increases in FFA concentration (37). Thus, our data indicate that progressive islet dysfunction in this type 2 diabetic animal is more related to chronic hyperglycemia than chronic elevations in plasma TAG or FFA. In contrast to our findings with bezafibrate treatment of ZDF animals, treatment with this drug in Otsuka Long Evans Tokushima fatty rats, another model of type 2 diabetes, preserved glucose-induced insulin secretion compared with the nontreated control group (38). However, this treatment also significantly lowered the blood glucose level in this animal, again making it difficult to distinguish between the effects of lowering glucose versus lipids.

In the first study to document the capacity of ß-cells to store and use TAG (39), increasing the glucose concentration from 3.5 to 17 mmol/l resulted in twofold and fivefold increases in the rate of glucose incorporation into TAG and phospholipids, respectively, in cultured mice islets. Similarly, Briaud et al. (11) demonstrated that islets exposed to palmitate have a glucose-dependent increase in esterification of fatty acids into neutral lipids. This was associated with inhibition of insulin gene expression. Inhibitory effects on insulin secretion from human islets cultured for 48 h in 250 µmol/l palmitate were additive to the inhibitory effects of previous exposure to high glucose (40). Furthermore, in a study by Jacqueminet et al. (13) in which rat islets were cultured for up to 7 days with palmitate, insulin content and mRNA level were not affected by palmitate at basal glucose concentrations (2.8 mmol/l); however, both were significantly decreased in the presence of 16.7 mmol/l glucose. In agreement, Prentki and Corkey (32) proposed that only under conditions of both high glucose and high lipids will metabolic abnormalities become apparent. They suggested that the toxic effects of glucose and lipids are synergistic and the mechanism may be via elevated levels of cytosolic long-chain acyl CoA, resulting in altered insulin secretion.

Our study suggests that the increase in ZDF rat islet TAG content is related to antecedent increases in glucose but not lipid levels in plasma. In keeping with this concept, high-glucose concentrations have been shown to stimulate lipid esterification and TAG deposition in INS-1 cells by Roche et al. (41), who reported conversion of glucose into lipids along with an inhibition of fatty acid oxidation. However, it is not yet clear what adverse effects, if any, TAG itself has on ß-cells. It may be possible that TAG acts as a storage pool for fatty acids that can be used in ceramide formation (30,42), thus leading to an increase in ß-cell apoptosis (7,14). However, Listenberger et al. (29) observed recently that generation of oxygen species and palmitate-induced apoptosis occurred independent of ceramide synthesis. In any event, we conclude that increased ZDF rat islet TAG is a result of exposure to elevated glucose concentrations and that associated adverse consequences on insulin mRNA levels are likely to be consequences of chronic hyperglycemia rather than hyperlipidemia.


    ACKNOWLEDGMENTS
 
This work was supported by the National Institutes of Health Grant RO1-DK-38325 (R.P.R.) and DK-17047 (Åke Lernmark), the Juvenile Diabetes Foundation International (J.S.H), an American Diabetes Association Research Grant (V.P.), and an American Diabetes Association Mentor Based Post Doctoral Fellowship Program (R.P.R., Y.T.). We thank Elizabeth Oseid, Scott Holland, and Lisa Johnson for expert technical assistance. We gratefully acknowledge the laboratory of Åke Lernmark, University of Washington, for the development of the genotype assay.


    FOOTNOTES
 
Address correspondence and reprint requests to Jamie S. Harmon, Pacific Northwest Research Institute, 720 Broadway, Seattle, WA 98122. E-mail: jharmon{at}pnri.org.

Received for publication 15 December 2000 and accepted in revised form 31 July 2001.

FFA, free fatty acid; LPL, lipoprotein lipase; PCR, polymerase chain reaction; PDX-1, pancreatic/duodenal homeobox-1; TAG, triacylglycerol.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Robertson RP, Olson LK, Zhang H-J: Differentiating glucose toxicity from glucose desensitization: a new message from the insulin gene. Diabetes 43:1085–1089, 1994[Abstract]
  2. Harmon JS, Gleason CE, Tanaka Y, Oseid EA, Hunter-Berger KK, Robertson RP: In vivo prevention of hyperglycemia also prevents glucotoxic effects on PDX-1 and insulin gene expression. Diabetes 48:1995–2000, 1999[Abstract]
  3. Kaneto H, Kajimoto Y, Miyagawa J-I, Matsuoka T-A, Fujitani Y, Umayahara Y, Hanafusa T, Matsuzawa Y, Yamasaki Y, Hori M: Beneficial effects of antioxidants in diabetes: possible protection of pancreatic ß-cells against glucose toxicity. Diabetes 48:2398–2406, 1999[Abstract]
  4. Seufert J, Weir GC, Habener JF: Differential expression of the insulin gene transcriptional repressor CCAAT/enhancer-binding protein ß and transactivator islet duodenum homeobox-1 in rat pancreatic ß cells during the development of diabetes mellitus. J Clin Invest 101:2528–2539, 1998[Medline]
  5. Tokuyama Y, Sturis J, DePaoli AM, Takeda J, Stoffel M, Tang J, Sun X, Polonsky KS, Bell GI: Evolution of ß-cell dysfunction in the male Zucker diabetic fatty rat. Diabetes 44:1447–1457, 1995[Abstract]
  6. Lee Y, Hirose H, Ohneda M, Johnson JH, McGarry JD, Unger RH: ß-cell lipotoxicity in the pathogenesis of non-insulin-dependent diabetes mellitus of obese rats: impairment in adipocyte-ß-cell relationships. Proc Natl Acad Sci U S A 91:10878–10882, 1994[Abstract/Free Full Text]
  7. Lee Y, Hirose H, Zhou Y-T, Esser V, McGarry JD, Unger RH: Increased lipogenic capacity of the islets of obese rats: a role in the pathogenesis of NIDDM. Diabetes 46:408–413, 1997[Abstract]
  8. Unger RH: Lipotoxicity in the pathogenesis of obesity-dependent NIDDM. Diabetes 44:863–870, 1995[Abstract]
  9. Unger RH: How obesity causes diabetes in Zucker diabetic fatty rats. Trends Endocrinol Metab 7:276–282, 1998
  10. Zhou Y-P, Ling Z-C, Grill VE: Inhibitory effects of fatty acids on glucose-regulated B-cell function: association with increased islet triglyceride stores and altered effect of fatty acid oxidation on glucose metabolism. Metabolism 45:981–986, 1996[Medline]
  11. Briaud I, Harmon JS, Kelpe CL, Segu VB, Poitout V: Lipotoxicity of the pancreatic ß-cell is associated with glucose-dependent esterification of fatty acids into neutral lipids. Diabetes 50:315–321, 2001[Abstract/Free Full Text]
  12. Zhou Y-P, Grill V: Long-term exposure of rat pancreatic islets to fatty acids inhibits glucose induced insulin secretion and biosynthesis through a glucose fatty acid cycle. J Clin Invest 93:870–876, 1994
  13. Jacqueminet S, Briaud I, Rouault C, Reach G, Poitout V: Inhibition of insulin gene expression by long-term exposure of pancreatic ß cells to palmitate is dependent on the presence of a stimulatory glucose concentration. Metabolism 49:532–536, 2000[Medline]
  14. Higa M, Zhou Y-T, Ravazzola M, Baetens D, Orci L, Unger RH: Troglitazone prevents mitochondrial alterations, ß cell destruction, and diabetes in obese prediabetic rats. Proc Natl Acad Sci U S A 96:11513–11518, 1999[Abstract/Free Full Text]
  15. Shimabukuro M, Koyama K, Lee Y, Unger RH: Leptin- or troglitazone-induced lipopenia protects islets from interleukin 1ß cytotoxicity. J Clin Invest 100:1750–1754, 1997[Medline]
  16. Schoonjans K, Staels B, Auwerx J: Role of the peroxisome proliferator-activated receptor (PPAR) in mediating the effects of fibrates and fatty acids on gene expression. J Lipid Res 37:907–925, 1996[Abstract]
  17. Phillips M, Liu Q, Hammond H, Dugan V, Hey P, Caskey C, Hess J: Leptin receptor missense mutation in the fatty Zucker rat. Nat Genet 13:18–19, 1996[Medline]
  18. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159, 1987[Medline]
  19. Tanaka Y, Gleason CE, Tran POT, Harmon JS, Robertson RP: Prevention of glucose toxicity in HIT-T15 cells and Zucker diabetic fatty rats by antioxidants. Proc Natl Acad Sci U S A 96:10857–10862, 1999[Abstract/Free Full Text]
  20. Unger RH, Grundy S: Hyperglycaemia as an inducer as well as a consequence of impaired islet cell function and insulin resistance: implications for the management of diabetes. Diabetologia 28:119–121, 1985[Medline]
  21. Rossetti L, Shulman GI, Zawalich W, DeFronzo RA: Effect of chronic hyperglycemia on in vivo insulin secretion in partially pancreatectomized rats. J Clin Invest 80:1037–1044, 1987
  22. Yki-Jarvinen H: Glucose toxicity. Endocr Rev 13:415–431, 1992[Medline]
  23. Leahy JL, Bonner-Weir S, Weir GC: ß-cell dysfunction induced by chronic hyperglycemia. Diabetes Care 15:442–455, 1992[Abstract]
  24. Ling Z, Kiekens R, Mahler T, Schuit FC, Pipeleers-Marichal M, Sener A, Kloppel G, Malaisse WJ, Pipeleers DG: Effects of chronically elevated glucose levels on the functional properties of rat pancreatic beta-cells. Diabetes 45:1774–1782, 1996[Abstract]
  25. Eizirik DL, Korbutt GS, Hellerstrom C: Prolonged exposure of human pancreatic islets to high glucose concentrations in vitro impairs the ß-cell function. J Clin Invest 90:1263–1268, 1992
  26. Robertson RP, Zhang H-J, Pyzdrowski KL, Walseth TF: Preservation of insulin mRNA levels and insulin secretion in HIT cells by avoidance of chronic exposure to high glucose concentrations. J Clin Invest 90:320–325, 1992
  27. Lu M, Seufert J, Habener JF: Pancreatic ß-cell-specific repression of insulin gene transcription by CCAAT/enhancer-binding protein ß. J Biol Chem 272:28349–28359, 1997[Abstract/Free Full Text]
  28. Robertson RP, Harmon J, Tanaka Y, Sacchi G, Tran PO, Gleason C, Poitout V: Glucose toxicity of the ß-cell. In Diabetes Mellitus: A Fundamental and Clinical Text. LeRoith D, Taylor SI, Olefsky JM, Eds. Philadelphia, Lippincott Williams & Wilkins, 2000, p. 125–132
  29. Listenberger LL, Ory DS, Shaffer JE: Palmitate-induced apoptosis can occur through a ceramide-independent pathway. J Biol Chem 276:14890–14895, 2001[Abstract/Free Full Text]
  30. Unger RH, Zhou Y-T, Orci L: Lipotoxicity. In Diabetes Mellitus: A Fundamental and Clinical Text. Roith DL, Taylor SI, Olefsky JM, Eds. Philadelphia, Lippincott Williams & Wilkins, 2000, p. 132–141
  31. Gremlich S, Bonny C, Waeber G, Thorens B: Fatty acids decrease IDX-1 expression in rat pancreatic islets and reduce GLUT2, glucokinase, insulin, and somatostatin levels. J Biol Chem 272:30261–30269, 1997[Abstract/Free Full Text]
  32. Prentki M, Corkey BE: Are the ß-cell signaling molecules malonyl-CoA and cytosolic long-chain acyl-CoA implicated in multiple tissue defects of obesity and NIDDM? Diabetes 45:273–283, 1996[Abstract]
  33. Pick A, Clark J, Kubstrup C, Levisetti M, Pugh W, Bonner-Weir S, Polonsky KS: Role of apoptosis in failure of beta-cell mass compensation for insulin resistance and beta-cell defects in the male Zucker diabetic fatty rat. Diabetes 47:358–364, 1998[Abstract]
  34. Ohneda M, Johnson JH, Lee YH, Nagasawa Y, Unger RH: Post-GLUT2 defects in ß-cells of non-insulin-dependent diabetic obese rats. Am J Physiol 267:E968–E974, 1994[Abstract/Free Full Text]
  35. Jonas J-C, Sharma A, Hasenkamp W, Ilkova H, Patane G, Laybutt R, Bonner-Weir S, Weir GC: Chronic hyperglycemia triggers loss of pancreatic ß cell differentiation in an animal model of diabetes. J Biol Chem 274:14112–14121, 1999[Abstract/Free Full Text]
  36. Rossetti L, Smith D, Shulman GI, Papachristou D, DeFronzo RA: Correction of hyperglycemia with phlorizin normalizes tissue sensitivity to insulin in diabetic rats. J Clin Invest 79:1510–1515, 1987
  37. Zambon A, Hashimoto SI, Brunzell JD: Analysis of techniques to obtain plasma for measurement of levels of free fatty acids. J Lipid Res 34:1021–1028, 1993[Abstract]
  38. Hasegawa N, Ogawa Y, Tazawa Y, Umeda Y, Katayama Y, Nakamura T, Suda T: Beneficial effects of bezafibrate on glucose tolerance and insulin secretion in rats with type 2 diabetes mellitus. Diabetologia 43:501, 2000
  39. Berne C: The metabolism of lipids in mouse pancreatic islets: the biosynthesis of triacylglycerols and phospholipids. Biochem J 152:667–673, 1975[Medline]
  40. Zhou Y-P, Grill V: Long term exposure to fatty acids and ketones inhibits B-cell functions in human pancreatic islets of Langerhans. J Clin Endocr Metab 80:1584–1590, 1995[Abstract/Free Full Text]
  41. Roche E, Farfari S, Witters LA, Assimacopoulos-Jeannet F, Thumelin S, Brun T, Corkey BE, Saha AK, Prentki M: Long-term exposure of ß-INS cells to high glucose concentrations increases anaplerosis, lipogenesis, and lipogenic gene expression. Diabetes 47:1086–1094, 1998[Abstract]
  42. Shimabukuro M, Zhou Y-T, Levi M, Unger RH: Fatty acid-induced ß cell apoptosis: a link between obesity and diabetes. Proc Natl Acad Sci U S A 95:2498–2502, 1998[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
DiabetesHome page
Y. Lee, M. Ravazzola, B.-H. Park, Y. K. Bashmakov, L. Orci, and R. H. Unger
Metabolic Mechanisms of Failure of Intraportally Transplanted Pancreatic {beta}-Cells in Rats: Role of Lipotoxicity and Prevention by Leptin
Diabetes, September 1, 2007; 56(9): 2295 - 2301.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
C. Kjorholt, M. C. Akerfeldt, T. J. Biden, and D. R. Laybutt
Chronic Hyperglycemia, Independent of Plasma Lipid Levels, Is Sufficient for the Loss of {beta}-Cell Differentiation and Secretory Function in the db/db Mouse Model of Diabetes
Diabetes, September 1, 2005; 54(9): 2755 - 2763.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
H. Wang, G. Kouri, and C. B. Wollheim
ER stress and SREBP-1 activation are implicated in {beta}-cell glucolipotoxicity
J. Cell Sci., September 1, 2005; 118(17): 3905 - 3915.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. F. Pino, D. Z. Ye, K. D. Linning, C. D. Green, B. Wicksteed, V. Poitout, and L. K. Olson
Elevated Glucose Attenuates Human Insulin Gene Promoter Activity in INS-1 Pancreatic {beta}-Cells via Reduced Nuclear Factor Binding to the A5/Core and Z Element
Mol. Endocrinol., May 1, 2005; 19(5): 1343 - 1360.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Alemzadeh and K. M. Tushaus
Modulation of Adipoinsular Axis in Prediabetic Zucker Diabetic Fatty Rats by Diazoxide
Endocrinology, December 1, 2004; 145(12): 5476 - 5484.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. P. Robertson
Chronic Oxidative Stress as a Central Mechanism for Glucose Toxicity in Pancreatic Islet Beta Cells in Diabetes
J. Biol. Chem., October 8, 2004; 279(41): 42351 - 42354.
[Full Text] [PDF]


Home page
DiabetesHome page
R. P. Robertson, J. Harmon, P. O. T. Tran, and V. Poitout
{beta}-Cell Glucose Toxicity, Lipotoxicity, and Chronic Oxidative Stress in Type 2 Diabetes
Diabetes, February 1, 2004; 53(90001): S119 - 124.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
H. Wang, P. Maechler, P. A. Antinozzi, L. Herrero, K. A. Hagenfeldt-Johansson, A. Bjorklund, and C. B. Wollheim
The Transcription Factor SREBP-1c Is Instrumental in the Development of beta -Cell Dysfunction
J. Biol. Chem., May 2, 2003; 278(19): 16622 - 16629.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
R. P. Robertson, J. Harmon, P. O. Tran, Y. Tanaka, and H. Takahashi
Glucose Toxicity in {beta}-Cells: Type 2 Diabetes, Good Radicals Gone Bad, and the Glutathione Connection
Diabetes, March 1, 2003; 52(3): 581 - 587.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. R. Laybutt, M. Glandt, G. Xu, Y. B. Ahn, N. Trivedi, S. Bonner-Weir, and G. C. Weir
Critical Reduction in beta -Cell Mass Results in Two Distinct Outcomes over Time. ADAPTATION WITH IMPAIRED GLUCOSE TOLERANCE OR DECOMPENSATED DIABETES
J. Biol. Chem., January 24, 2003; 278(5): 2997 - 3005.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
J. L. Evans, I. D. Goldfine, B. A. Maddux, and G. M. Grodsky
Are Oxidative Stress-Activated Signaling Pathways Mediators of Insulin Resistance and {beta}-Cell Dysfunction?
Diabetes, January 1, 2003; 52(1): 1 - 8.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
J. L. Evans, I. D. Goldfine, B. A. Maddux, and G. M. Grodsky
Oxidative Stress and Stress-Activated Signaling Pathways: A Unifying Hypothesis of Type 2 Diabetes
Endocr. Rev., October 1, 2002; 23(5): 599 - 622.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
I. Briaud, C. L. Kelpe, L. M. Johnson, P. O. T. Tran, and V. Poitout
Differential Effects of Hyperlipidemia on Insulin Secretion in Islets of Langerhans From Hyperglycemic Versus Normoglycemic Rats
Diabetes, March 1, 2002; 51(3): 662 - 668.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
V. Poitout and R. P. Robertson
Minireview: Secondary {beta}-Cell Failure in Type 2 Diabetes--A Convergence of Glucotoxicity and Lipotoxicity
Endocrinology, February 1, 2002; 143(2): 339 - 342.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harmon, J. S.
Right arrow Articles by Robertson, R. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harmon, J. S.
Right arrow Articles by Robertson, R. P.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME