Diabetes
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagy, A.
Right arrow Articles by Humphreys-Beher, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagy, A.
Right arrow Articles by Humphreys-Beher, M. G.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
Diabetes 50:2100-2104, 2001
© 2001 by the American Diabetes Association, Inc.

Reduced Oral Wound Healing in the NOD Mouse Model for Type 1 Autoimmune Diabetes and Its Reversal by Epidermal Growth Factor Supplementation

Akos Nagy1, Hiroyuki Nagashima2, Seunghee Cha2, Gregory E. Oxford2, Tivadar Zelles1, Ammon B. Peck3, and Michael G. Humphreys-Beher2

1 Department of Oral Biology, Semmelweis University Medical Center, Budapest, Hungary; and the Departments of
2 Oral Biology and
3 Pathology, Immunology and Laboratory Medicine, University of Florida, Gainesville, Florida


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Using the NOD mouse, a model for type 1 diabetes, we examined how reduced concentrations of epidermal growth factor (EGF) in the saliva, after onset of type 1 diabetes, affect oral wound healing. Diabetic NOD/LtJ mice on insulin therapy, prediabetic NOD/LtJ, and age- and sex-matched BALB/cJ mice were given a cutaneous tongue punch and allowed to undergo normal healing. With diabetes onset and a reduction in saliva-derived growth factor levels, the rate of tongue wound healing was reduced compared with nondiabetic NOD/LtJ and healthy BALB/cJ mice. Addition of exogenous EGF to the drinking water did not accelerate the rate of healing in BALB/cJ or prediabetic NOD/LtJ; however, diabetic NOD/LtJ mice exhibited accelerated wound healing similar to healthy mice. These results demonstrate that loss of growth factors from saliva is associated with profoundly reduced oral wound healing, suggesting that therapeutic treatment with topical delivery may be beneficial to patients with type 1 diabetes and oral wound complications.



    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Saliva and its constituents carry out a number of biological functions that are key to maintaining oral health. The component proteins produced and released into saliva by the salivary glands are grouped according to their functions: lubrication of the oral cavity (mucins, proline-rich proteins), remineralization (statherin, proline-rich proteins), digestion (amylase, lipase, proteases), antimicrobial activity (lysozyme, peroxidases, histatins), and mucosal integrity (water, mucins, growth factors) (1,2,3). Biologically active growth factors include epidermal growth factor (EGF) and nerve growth factor (NGF), both of which are synthesized and secreted by the granular convoluted tubule cells of the salivary glands (4,5). Transforming growth factors {alpha} and ß (6,7,8), insulin, IGF-I and -II (9,10,11,12), and fibroblast growth factor (13) have been localized to the ductal cells in salivary glands from which they are actively secreted into saliva.

By far, the most highly characterized of the growth factors for growth-promoting potential is EGF. EGF is produced in large quantities by the salivary glands and then is actively secreted in an exocrine manner into saliva (4). Injection of EGF, isolated from the submandibular gland, into neonatal mice or rats causes premature incisor eruption and precocious eyelid opening (14). In addition, members of this peptide growth factor family have been shown to be mitogenic for a variety of cell types, including those of the oral cavity (15,16,17).

In the adult mouse, salivary gland–derived EGF seems to play an important role in wound healing of skin and soft tissue as well as in maintaining organ homeostasis (18,19,20,21,22,23). Wound healing of the skin is enhanced by licking, most likely occurring by deposition of EGF onto the wound area. Another mechanism for EGF and other growth factors that promote wound healing include autocrine (local) production and secretion by cells at the site of a wound (24). It also has been reported that salivary gland–derived EGF enhances the healing of gastric ulcers and tongue lesions (17,19). In the partial hepatectomy model for liver regeneration (25), disruption of salivary EGF production through submandibular gland ablation results in delayed liver cell proliferation and a reduced capacity to regenerate the liver. Sialoadenectomy also has been shown to reduce sperm maturation and isoproterenol- and diet-induced parotid gland hyperplasia (20,21). Removal of maternal salivary glands prevents an increase in plasma and saliva EGF normally observed during pregnancy (23), a loss that results in the reduction in numbers of mothers who complete term pregnancies and overall pup size. Animal models of metabolic disease, such as diabetes, also have reported lower concentrations of growth factors in saliva (26,27,28).

Both patients with type 1 and type 2 diabetes, as well as animal models of diabetes, have reduced levels of EGF in their saliva (29,30). In the present investigation, we examined the impact of diabetes on wound healing by measuring the rate of oral wound healing after tongue-punch biopsies (25). With the onset of type 1 diabetes, NOD mice exhibit a decrease in the concentration of EGF in saliva with a concomitant decrease in oral wound healing rate that could be reversed with the addition of EGF to the drinking water.


    RESEARCH DESIGN AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Materials.
Female NOD/LtJ and BALB/cJ mice between 7 and 10 weeks of age were purchased from the Department of Pathology Mouse Colony (University of Florida, Gainesville, FL). Onset of diabetes in NOD/LtJ mice was determined by measuring urine and blood glucose levels as described previously (28). Mice with blood glucose levels >280 mg/dl for 2 consecutive weeks were considered diabetic (28). Mice in the Department of Pathology Mouse Colony become overtly diabetic starting at 12 ± 2 weeks of age. For the current experiments, mice 10–12 weeks of age were used to minimize xerostomic conditions related to the development of Sjögren’s syndrome–like exocrine tissue pathology, which does not develop before 12–16 weeks of age (31,32). Diabetic mice were maintained on daily intramuscular insulin injections (1 unit of Humulin/animal/24 h; Novo Nodisk, Bagsvaerd, Denmark) for 2 weeks before the initiation of the wound-healing experiments. All of the experiment procedures were approved by the University of Florida IACUC committee for animal welfare. Care was taken to minimize pain and suffering of the mice.

Treatment and wounding of the tongue in mice.
Healthy age-matched BALB/cJ mice, prediabetic NOD/LtJ mice, and insulin-maintained diabetic NOD/LtJ mice were divided randomly into three groups (n = 4–6 mice) and sedated with an i.p. injection of 0.3 ml of pentobarbital (1% in phosphate-buffered saline). Superficial circular punch biopsy wounds measuring ~2.0 mm were made in the middle of the tongue using a 1.0-mm Biopsy Punch (Acu-punch, Ft. Lauderdale, FL) by ablating the epithelial layer without damage to the underlying muscle. During sedation, three photographs of the wound areas were taken for each animal. For 4 days thereafter, animals were anesthetized every 24 h and new photographic documentation of the wound site healing was recorded. Animals that received EGF were provided 20 ml of fresh drinking water that contained 2.5 µg of EGF/ml or regular tap water. Epidermal growth factor (rhEGF) was obtained from Intergen (Purchase, NY). All other reagents were purchased from commercial sources and were of ultrapure quality. Wounds healed typically within 4 days. After examination of wound healing on day 4, animals were killed, and the submandibular gland, tongue, and total body weight were obtained.

Measurement of wound area.
While the animals were anesthetized, the maximum length and width of the wounds were measured using a stereomicroscope equipped with a calibrated eyepiece. The wound size was confirmed by the photographic data before calculation of the wound area. Wound margins were identified easily, and wound size was calculated by the method of Noguchi et al. (25), using the formula A = LW{pi}/4.

RNA isolation and RT-PCR detection of EGF mRNA.
After the animals were killed, the submandibular glands were explanted, minced in phosphate-buffered saline, and placed in lysis buffer, and mRNA was isolated using a Micro-FastTrack Kit (Invitrogen). Isolated mRNA was stored at -70°C in ethanol until all samples were collected. After isolation, mRNA was pelleted by centrifugation, and cDNA was prepared by reverse transcription using Superscript II Reverse Transcriptase. Copy DNA was synthesized in a standard 20-µl reverse transcriptase reaction and subsequent amplification of the desired mRNA by primer addition using the Perkin-Elmer-Cetus reverse transcriptase–polymerase chain reaction (RT-PCR) kit (San Francisco, CA) with the addition of 1.0 µg of mRNA. The amplification conditions were 94°C for 1 min, 58°C for 1 min, and 72°C for 3 min in a Biometra thermocycler for 25 cycles. All nucleotide primers and probes were synthesized in the ICBR DNA Synthesis Core Laboratory at the University of Florida (Gainesville, FL) and are described elsewhere (7,16). The primer sets used were as follows: ß-actin, forward 5'TGAAGGTCGGTGTGAAAACGGATTTGGC3', reverse 5'CATGTAGGCCATGAGGTCCACCAC3'; and EGF, forward 5'TAAGCCGAGACCGGAAGTACT3', reverse 5'AGTCTGTTCCATCAAATGCA3'.

Densitometric analyses were performed to determine changes in the steady-state levels of mRNA for EGF relative to the concentration detected for the housekeeping gene ß-actin. Photographs of agarose gels were scanned using a Hewlett-Packard Scanjet IIcx and NIH Image Shareware (7).

Statistical analysis.
All measures of variance are given as standard errors of the mean. The distribution of rates for wound healing was found to be normal (P > 0.05) and was analyzed by a parametric analysis of variance (ANOVA). Tests of ANOVA between independent means were performed using SAS computer software programs (SAS Institute, Cary, NC). Values were considered significant at P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Detection of EGF steady-state mRNA levels.
With the onset of diabetes in NOD/LtJ mice, there was a concomitant decline in the concentration of salivary EGF (28). Consistent with this observation, RT-PCR analysis of mRNA from the submandibular gland of healthy control female BALB/c mice and prediabetic and diabetic NOD/LtJ mice revealed a reduction in the steady-state concentration of EGF mRNA with diabetes onset (Fig. 1). Based on densitometric analysis of the amplicons in agarose gels, diabetic NOD/LtJ mice had a 25–30% (P < 0.05) reduction in EGF mRNA, as compared with control mice. Prediabetic NOD/LtJ mice, when compared with BALB/cJ mice, showed a reduction of ~5%. Prediabetic NOD/LtJ mice, however, reportedly have a substantially higher concentration of EGF protein in their saliva than female BALB/cJ mice (34 vs. 54 ng EGF/ml) (28).



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 1. Steady-state mRNA levels for EGF in submandibular gland lysates from BALB/cJ and prediabetic and diabetic NOD/LtJ mice. RT-PCR amplicons for EGF and ß-actin were generated as described in RESEARCH DESIGN AND METHODS. The RNA was isolated from n = 4 mice per group, which was pooled and subjected to RT-PCR analysis on three separate occasions. The predicted size of the PCR products are 385 bp for ß-actin and 489 bp for EGF. The pGEM size standard (Promega, Madison, WI), with 676 bp indicated to the left of the marker lane, is included with the gel. PD, prediabetic; D, diabetic.

 
Measurement of lingual wound-healing rates in diabetic mice.
With the use of a punch-biopsy apparatus, BALB/cJ, prediabetic NOD/LtJ, and diabetic NOD/LtJ mice received a lingual surface wound. The rates of healing of these wounds then were followed over a 4-day period. As shown in Fig. 2, prediabetic NOD/LtJ mice healed within 3 days of wounding, whereas both BALB/cJ and diabetic NOD/LtJ mice still had measurable wound sites (P < 0.01). Although the same procedures and apparatus were used for the wounding of mice within each group, the initial wound size in diabetic NOD/LtJ mice was ~67% of the nondiabetic mice (21 mm2 for prediabetic vs. 14 mm2 for diabetic NOD/LtJ). With respect to normal wound-healing rates, prediabetic NOD/LtJ mice had a 100% reduction in the wound area (Fig. 3; P < 0.001) over the 4-day observation time. BALB/cJ mice had an 83% reduction in wound area, whereas diabetic NOD/LtJ mice had wound sites that were reduced in size only by 58% (Fig. 3; P < 0.05), even accounting for the smaller initial wound size. Taking this into account, the order of healing rates among the groups of mice were prediabetic NOD/LtJ > BALB/c J > diabetic NOD/LtJ.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 2. Histogram of the time course for healing of the punch-biopsy wound area on the lingual surface of healthy BALB/cJ and NOD/LtJ mice. After introduction of the wound, sets of mice were supplied with rhEGF in the drinking water as described previously (24,35). Results represent the mean ± SE for three separate sets of mice. The right half of each histogram represents mice that were provided with drinking water with EGF; the left half represents pair-fed mice that received regular water supply. PD, prediabetic; D, diabetic.

 


View larger version (99K):
[in this window]
[in a new window]
 
FIG. 3. Surface view of the tongue wound–healing site at 1 and 4 days after tissue injury. A: Wound site immediately after punch-biopsy wound in BALB/cJ mice. B: Wound site 72 h after punch-biopsy wound in BALB/cJ mice. C: Wound site immediately after punch-biopsy wound in prediabetic NOD/LtJ mice. D: Wound site 72 h after punch-biopsy wound in nondiabetic NOD/LtJ. E: Wound site immediately after punch-biopsy wound in diabetic NOD/LtJ. F: Wound site 72 h after punch-biopsy wound in diabetic NOD/LtJ mice. Photographs are representative of the wound in each group of animals. Magnification x20. Arrows highlight the wound area on the lingual surface epithelium. PD, prediabetic; D, diabetic.

 
Introduction of EGF into the drinking water of BALB/cJ and prediabetic NOD/LtJ mice yielded a slightly more rapid wound-healing process when compared with syngeneic mice that were not provided exogenous EGF (Fig. 3; P > 0.05). This was true for each of the 3 days on which measurements of the wound area were taken. Similarly, diabetic NOD/LtJ mice that received exogenous EGF also showed markedly increased rates of healing, nearly approaching those of the prediabetic NOD/LtJ and BALB/cJ mice (Figs. 2 and 3). At each of the three 24-h time measurements, the wound areas decreased by 25, 38, and 77%, respectively (P < 0.01). Despite the smaller wound size of the diabetic NOD mice at the time of the punch, the size of the wound areas at 24–72 h were in general healing more rapidly than those of the mice that had not received EGF in the drinking water (Figs. 2 and 3; P > 0.05).

Comparison of body and tissue weights.
The total body weight and that of the tongue and submandibular glands were obtained to determine the influence of type 1 diabetes and insulin treatment on the health and hydration state of tissues from the diabetic mice. As shown in Table 1, despite slight differences in the size of BALB/cJ and NOD/LtJ mice, there were no significant differences in the body weight or wet weight of tissues from the NOD/LtJ mice, whether they were diabetic or not.


View this table:
[in this window]
[in a new window]
 
TABLE 1 Comparison of body and tissue weight for BALB/cJ and NOD/LtJ mice

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Studies by Cohen and Levi-Montalcini (14,33,34) demonstrated that the submandibular glands of mice are one of the richest sources of EGF in the body. More recently, research reported from various laboratories has focused on the roles of saliva-derived growth factors in the control of oral and systemic wound healing (19,20,21,22,23). In these paradigms of wound repair, removal of the submandibular gland from mice and rats resulted in retarded rates of healing, which could be reversed by EGF supplementation. Not surprising, then, systemic disease, such as type 1 diabetes, which can negatively impact salivary gland function, dramatically alters the concentration of such factors as NGF and EGF in saliva (26,27,28). However, the present study is the first to specifically examine the impact of diabetes on the salivary-EGF wound-healing model. Although there may be strain-specific differences in wound-healing rates as evidenced by the ability of nondiabetic NOD/LtJ mice to heal more rapidly than the BALB/cJ mice, with or without the addition of exogenous EGF, diabetes and the decline in saliva concentration of EGF negatively impacted wound-healing rates of oral tissue.

Previous reports of reduced EGF levels resulting from diabetes have come from chemically induced insulin-dependent animals or models for type 2 diabetes (26,27). Here, we provide evidence that naturally occurring autoimmune type 1 diabetes also has a reduced expression of EGF levels. Messenger RNA analysis of the submandibular gland confirmed previous protein analyses that showed a reduction in saliva and serum concentrations of growth factors in diabetic animal models (25,26,27,28). The reduced levels of growth factors in saliva seem to decrease the wound-healing capacity of oral epithelium after superficial wounds to the tongue. However, consistent with previous reports (25), addition of EGF to the drinking water of normal healthy mice or prediabetic NOD/LtJ mice did not accelerate wound healing. Only in the diabetic mice, with reduced concentrations of salivary EGF, did supplementation with EGF improve the kinetics of healing to a similar level as that detected in the healthy controls. It is not known what other growth factors that are synthesized by the salivary glands (5,6,7,8,9,10,11,12,13) may be sensitive to disruption by changes in blood glucose and insulin levels or whether they additionally influence wound healing as saliva-derived EGF. Transforming growth factor-{alpha} (TGF-{alpha}), a member of the EGF growth factor family and capable of binding to the EGF receptor (24), also is produced by the salivary glands and is present in saliva (7). Unlike EGF, however, TGF-{alpha} is produced by the parotid gland in addition to the submandibular gland. What role TGF-{alpha} has in oral wound healing or in the impact of diabetes on the concentration in saliva has not been examined. We have observed that although the saliva concentration of TGF-{alpha} is lower in NOD/LtJ than in BALB/cJ mice, unlike EGF, the expression of this growth factor does not seem to be influenced by type 1 diabetes in this animal model (M.G. Humphreys-Beher, S. Cha, H. Nagashima, A.B. Reck, unpublished data). Brown et al. (35) demonstrated enhanced cutaneous wound closure after application of platelet-derived growth factor and TGF-{alpha} to db/db diabetic mice but not with EGF. Like EGF, NGF and IGF-II are reduced in saliva, whereas IGF-I concentrations remain high in diabetic mice (10,26).

Diabetes, a disease that affects vascular function, disrupts normal salivary gland function, including a reduced saliva flow rate and volume (36,37). Therefore, the possibility that xerostomia contributes to the reduced wound healing in diabetic NOD/LtJ tissue cannot be discounted (25). However, no differences were noted in diabetic mice maintained on insulin treatment and nondiabetic NOD/LtJ or BALB/cJ mice. Restoration of normal rates of healing in diabetic mice by EGF treatment supports the concept that reduced saliva-derived EGF is a major contributor in the pathogenic complication of decreased wound healing associated with diabetes. A direct action for EGF in the healing processes of the lingual surface is supported further by the presence of the EGF receptor in the epithelial cells that form the taste buds as well as the need for saliva-derived EGF to maintain the presence and morphology of this tissue (38).

The punch wounds generated on the lingual surface of diabetic mice were consistently smaller in size than prediabetic mice or healthy controls. Although diabetic mice received daily insulin injections, it is possible that microvascular constriction, as well as neuropathy and tissue desiccation, affected the physiological state of the tongue. No changes in salivary gland or total body weight were observed for the diabetic group compared with the controls. However, the tongue, being exposed to the external environment, may be more prone to desiccation. This potential complication in generating equal-sized punch wounds between diabetic and prediabetic mice probably needs to be factored into preventing the full restoration of the accelerated wound-healing rate observed after the addition of EGF to the drinking water.

Although a positive impact of EGF on lingual wound healing was noted in the diabetic mice, EGF had little effect in the healing rates of healthy or prediabetic mice. A number of factors could account for this observation. As indicated, saliva contains a number of biologically active peptides besides EGF (5,6,7,8,9,10), some of which may not be affected by hyperglycemia and insulin fluctuations observed with diabetes. Locally infiltrating cells and platelets at the site of wounds produce a variety of growth factors (39), and these have been shown to play important roles in the wound healing of skin, suggesting that several saliva-derived growth factors might play an important role in oral wound healing. Despite this autocrine contribution, with a longer period of diabetes onset than the 2 weeks used in these studies, a more accelerated pattern of healing may have been determined with EGF supplementation in the drinking water. In addition, we used hrEGF in a mouse receptor system, a combination that may be suboptimal for receptor activation. Thus, with slightly different binding kinetics, a longer period of lingual confinement/contact may be necessary to promote optimal wound healing than could be accomplished through the transient exposure provided by EGF in the drinking water.

In conclusion, we provided further evidence that saliva-derived EGF is an important protagonist in oral wound healing. Furthermore, metabolic disorders, such as diabetes, reduce the level of EGF in saliva with the consequence that the normal wound-repair process is negatively affected. The introduction of growth factor supplementation may be beneficial to patients with identified complications in situations that require tissue repair associated with dysregulation of salivary sources of EGF.


    ACKNOWLEDGMENTS
 
This work was supported by NIH/NIDCR Grant DE-13290.

The authors acknowledge the technical contributions of Joy Nanni and Stephanie Diggs.

A.N., H.N., and S.C. contributed equally to this work.


    FOOTNOTES
 
Address correspondence and reprint requests to Michael G. Humphreys-Beher, P.O. Box 100424, Department of Oral Biology, University of Florida, Gainesville, FL 32610. E-mail: h-beher{at}dental.ufl.edu.

Received for publication 19 October 2000 and accepted in revised form 23 May 2001.

ANOVA, analysis of variance; EGF, epidermal growth factor; NGF, nerve growth factor; RT-PCR, reverse transcriptase–polymerase chain reaction; TGF-{alpha}, transforming growth factor-{alpha}.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Herrera JL, Lyons MF, Johnson LF: Saliva: its role in health and disease. J Clin Gastroenterol10:569–578, 1988
  2. Fox PC: Saliva composition and its importance in dental health. Compend Suppl 13:S457–S460, 1989
  3. Zelles T, Purushotham KR, Macauley SP, Oxford GE, Humphreys-Beher MG: Saliva and growth factors: the fountain of youth resides in us all. J Dent Res 74:1826–1832, 1995[Abstract/Free Full Text]
  4. Gubits RM, Shaw PA, Gresik EW, Onetti-Muda A, Barka T: Epidermal growth expression is regulated differently in mouse kidney and submandibular gland. Endocrinology 119:1382–1387, 1986[Abstract]
  5. Watson AY, Anderson JK, Siminoski K, Mole SE, Murphy RA: Cellular and subcellular colocalization of nerve growth factor and epidermal growth factor in mouse submandibular glands. Anat Rec 213:365–376, 1985[Medline]
  6. Yeh Y-C, Guh S-Y, Yeh J, Yeh H-W: Transforming growth factor type alpha in normal human adult saliva. Molec Cell Endocrinol 67:247–255, 1989
  7. Humphreys-Beher MG, Macauley SP, Chegini N, van Setten G, Purushotham KR, Stewart C, Schultz GS: Characterization of the synthesis and secretion of transforming growth factor alpha from salivary glands and saliva. Endocrinology 134:963–970, 1994[Abstract]
  8. Smith PH, Patel DG: Immunochemical studies of the insulin-like material in the parotid gland of rats. Diabetes 33:661–666, 1984[Abstract]
  9. Costigan DC, Guyda HJ, Posner B: Free insulin-like growth factor I (IGF-I) and IGF-II in human saliva. J Clin Endocrinol 66:1014–1018, 1988[Abstract]
  10. Kerr M, Lee A, Wang PL, Purushotham KR, Chegini N, Yamamoto H, Humphreys-Beher MG: Detection of insulin, insulin like growth factors I and II in saliva and potential synthesis in the salivary glands of mice. Effect of type 1 diabetes mellitus. Biochem Pharmacol 49:1521–1531, 1995[Medline]
  11. Murikami K, Taniquchi H, Baba S: Presence of insulin-like immunoreactivity and its biosynthesis in rat and human parotid gland. Diabetolgia 22:358–361, 1982[Medline]
  12. Ryan J, Mantle T, McQuaid CJ, Costigan DC: Salivary insulin-like growth factor originates from local synthesis. J Endocrinol 135:85–90, 1992[Abstract/Free Full Text]
  13. Hiramatsu Y, Kagami H, Kosaki K, Sigetomi T, Ueda M, Kobayashi S, Sakanaka M: The localization of basic fibroblast growth factor (FGF-2) in rat submandibular glands. Nagoya J Med Sci 57:143–152, 1994[Medline]
  14. Cohen S: Isolation of a mouse submaxillary protein accelerating incisor eruption and eyelid opening in the newborn animal. J Biol Chem 237:1555–1562, 1962[Free Full Text]
  15. Niall M, Ryan GB, O’Brien BM: The effect of epidermal growth factor on wound healing in mice. J Surg Res 33:164–169, 1982[Medline]
  16. Rall LB, Scott J, Bell GI, Crawford RJ, Penschow JD, Naill HD, Coghlan RD: Mouse prepro-epidermal growth factor synthesis by the kidney and other tissues. Nature 313:228–231, 1985[Medline]
  17. Noguchi S, Ohba Y, Oka T: Influence of epidermal growth factor on liver regeneration after partial hepatectomy in mice. J Endocrinol 128:425–431, 1991[Abstract/Free Full Text]
  18. Olsen PS, Poulsen SS, Kirkegaard P, Nexo E: Role of submandibular saliva and epidermal growth factor in gastric cytoprotection. Gastroenterology 87:103–108, 1984[Medline]
  19. Konturek SJ, Dembinski A, Warzecha Z, Brzozowski T, Gregory H: Role of epidermal growth actor in healing of chronic gastrointestinal ulcers in rats. Gastroenterology 94:1300–1307, 1988[Medline]
  20. Schneyer CA, Humphreys-Beher MG: Effects of epidermal growth factor and nerve growth factor for isoproterenol induced DNA synthesis in rat parotid and pancreas following removal of the submandibular/sublingual glands. J Oral Pathol 17:350–356, 1988
  21. Tsutsumi O, Kurachi H, Oka T: A physiological role of epidermal growth factor in male reproductive system. Science 233:975–977, 1986[Abstract/Free Full Text]
  22. Kurachi H, Oka T: Changes in epidermal growth factor concentrations of submandibular gland, plasma, and urine of normal and sialoadenectomized female mice during various reproductive states. J Endocrinol 106:197–202, 1985[Abstract/Free Full Text]
  23. Tsutsumi O, Taketani Y, Oka T: The uterine growth promoting action of epidermal growth factor and its function in the fertility of mice. J Endocrinol 138:437–444, 1993[Abstract/Free Full Text]
  24. Massagué J: Epidermal growth factor like transforming growth factor. II. Interaction with epidermal growth factor receptors in human placenta membranes and A431 cells. J Biol Chem 258:13614–13620, 1983[Abstract/Free Full Text]
  25. Noguchi S, Ohba Y, Oka T: Effect of salivary epidermal growth factor on wound healing of tongue in mice. Am J Physiol 260:E620–E625, 1991[Abstract/Free Full Text]
  26. Kasayama S, Oka T: Impaired production of nerve growth factor in the submandibular gland of diabetic mice. Am J Physiol 257:E400–E404, 1989[Abstract/Free Full Text]
  27. Serrero G, Lepak NM, Hayashi J, Goodrich SP: Impaired epidermal growth factor production in genetically obese ob/ob mice. Am J Physiol 264:E800–E803, 1993[Abstract/Free Full Text]
  28. Hu Y, Nakagawa Y, Purushotham KR, Humphreys-Beher MG: Functional changes in salivary glands of autoimmune disease-prone NOD mice. Am J Physiol 263:E607–E614, 1992[Abstract/Free Full Text]
  29. Knighton DR, Fiegel VD: Growth factors and comprehensive surgical care of diabetic wounds. Curr Opin Gen Surg 1:32–39, 1993
  30. Oxford GE, Tayari L, Barfoot MD, Peck AB, Tanaka Y, Humphreys-Beher MG: Salivary EGF levels reduced in diabetic patients. J Diabetes Complications 14:140–145, 2000[Medline]
  31. Robinson CP, Cornelius J, Bounous DI, Yamamoto H, Humphreys-Beher MG, Peck AB: Characterization of the changing lymphocyte populations and cytokine expression in the exocrine tissues of autoimmune NOD mice. Autoimmunity 27:29–44, 1998[Medline]
  32. Humphreys-Beher MG, Hu Y, Wang P-L, Purushotham KR: Utilization of the NOD mouse as an animal model for the study of secondary Sjögren’s syndrome. Adv Exp Med Biol 350:631–636, 1994[Medline]
  33. Levi-Montalcini R, Cohen S: Effects of the mouse submaxillary glands on the sympathetic system in mammals. Ann N Y Acad Sci 85:324–341, 1960
  34. Carpenter G, Cohen S: Epidermal growth factor. Annu Rev Biochem 48:193–216, 1979[Medline]
  35. Brown RL, Breeden MP, Greenhalgh DG: PDGF and TGF-alpha act synergistically to improve wound healing in the genetically diabetic mouse. J Surg Res 56:562–70, 1994[Medline]
  36. Anderson LC, Johnson DA: Effects of alloxan diabetes on rat parotid gland and saliva. Comp Biochem Physiol 70B:725–730, 1984
  37. Maeda N, Nakagawa Y, Sakia M, Uno K, Takahashi A, Fujita H, Ishibashi K, Humphreys-Beher MG: Streptozotocin induced dry mouth in ICR mice. In Sjögren’s Syndrome—State of the Art. Homma M, Sugia S, Tojo T, Miyasaka N, Akizuki M, Eds. Amsterdam, Kugler Publications, 1993, p. 513–518
  38. Morris-Wiman J, Sego R, Brinkley L, Dolce C: The effects of sialoadenectomy and exogenous EGF on taste bud morphology and maintenance. Chem Senses 25:9–19, 2000[Abstract/Free Full Text]
  39. Pessa ME, Bland KI, Copeland ED III: Growth factors and determinants of wound healing. J Surg Res 42:207–217, 1987[Medline]

Add to CiteULike CiteULike   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
J. Jacobi, J. J. Jang, U. Sundram, H. Dayoub, L. F. Fajardo, and J. P. Cooke
Nicotine Accelerates Angiogenesis and Wound Healing in Genetically Diabetic Mice
Am. J. Pathol., July 1, 2002; 161(1): 97 - 104.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagy, A.
Right arrow Articles by Humphreys-Beher, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagy, A.
Right arrow Articles by Humphreys-Beher, M. G.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Diabetes Diabetes Care Clinical Diabetes Diabetes Spectrum