Diabetes
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Olsson, U.
Right arrow Articles by Camejo, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Olsson, U.
Right arrow Articles by Camejo, G.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
Diabetes 50:2126-2132, 2001
© 2001 by the American Diabetes Association, Inc.

Changes in Matrix Proteoglycans Induced by Insulin and Fatty Acids in Hepatic Cells May Contribute to Dyslipidemia of Insulin Resistance

Urban Olsson1,2, Ann-Charlotte Egnell1, Mariam Rodríguez Lee1, Gunnel Östergren Lundén1, Malin Lorentzon1, Markku Salmivirta3, Göran Bondjers1, and Germán Camejo1,4

1 Wallenberg Laboratory for Cardiovascular Research, Göteborg University, Sahlgrenska University Hospital, Göteborg
2 School of Health Sciences, University College of Borås
4 Department of Biochemistry and Microbiology, Uppsala University, Uppsala
3 AstraZeneca Preclinical Laboratories, Mölndal, Sweden


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Insulin resistance and type 2 diabetes are associated with elevated circulating levels of insulin, nonesterified fatty acids (NEFAs), and lipoprotein remnants. Extracellular matrix proteoglycan (PG) alterations are also common in macro- and microvascular complications of type 2 diabetes. In liver, extracellular heparan sulfate (HS) PGs contribute to the uptake of triglyceride-rich lipoprotein remnants. We found that HepG2 cells cultured with 10 or 50 nmol/l insulin or 300 µmol/l albumin-bound linoleic acid changed their PG secretion. The glycosaminoglycans (GAGs) of the secreted PGs from insulin-treated HepG2 cells were enriched in chondroitin sulfate (CS) PGs. In contrast, cells exposed to linoleic acid secreted PGs with decreased content of CS. Insulin caused a moderate increase in mRNA for versican (secreted CS PG), whereas linoleic acid markedly decreased mRNA for versican in HepG2 cells, as did the peroxisomal proliferator-activated receptor-{alpha} agonist bezafibrate. The effects of insulin or linoleic acid on syndecan 1, a cell surface HS PG, were similar to those on versican, but less pronounced. The livers of obese Zucker fa/fa rats, which are insulin-resistant and have high levels of insulin, NEFAs, and triglyceride-rich remnants, showed increased expression of CS PGs when compared with lean littermates. These changes in PG composition decreased the affinity of remnant ß-VLDL particles to PGs isolated from insulin-treated HepG2 cells and obese rat livers. The results indicated that insulin and NEFAs modulate the expression of PGs in hepatic cells. We speculate that in vivo this exchange of CS for HS may reduce the clearance of remnant ß-VLDLs and contribute to the dyslipidemia of insulin resistance.



    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The dyslipidemia of insulin resistance and type 2 diabetes appears to be a contributor to the three- to fourfold excess of cardiovascular disease in individuals suffering from these conditions (1). Lipoprotein retention by extracellular proteoglycans (PGs) in the arterial intima is a key event in the initiation of atherosclerotic disease (2,3,4). In addition, recent evidence has indicated that extracellular matrix PGs containing heparan sulfate (HS) in liver have a major physiological function in the retention and internalization of chylomicron and VLDL remnants. These particles are cleared by the liver after partial hydrolysis by lipoprotein lipase or enrichment in apolipoprotein (apo) E (5,6). In an in vitro study, we observed that exposure to albumin-bound nonesterified fatty acids (NEFAs) increased expression of chondroitin sulfate (CS) and dermatan sulfate (DS) PGs in arterial smooth muscle cells (7). NEFAs also induced a qualitative change in the carbohydrate portion of PGs synthesized by the smooth muscle cells, resulting in longer glycosaminoglycan (GAG) chains. Similarly, in endothelial cells, Hennig et al. (8) found that exposure to albumin-bound NEFAs changed the synthesis of HS PGs, induced the synthesis of a CS PG, and increased the permeability of the endothelial cell monolayer. In insulin resistance and type 2 diabetes, liver cells are subjected to a continuous influx of NEFAs that originates mainly from lipolysis in insulin-resistant adipose tissue. In this condition, the liver is also exposed to elevated insulin levels. Here, we describe how insulin and NEFAs affected hepatic cells’ PG biosynthesis and structure. Such alteration of the extracellular matrix reduced the binding of VLDL remnants to extracellular PGs of HepG2 cells. Also, the liver extracellular PGs of obese insulin-resistant rats showed a decreased affinity for VLDL remnants. We speculate that alterations of liver cell matrixes caused by NEFAs and insulin may contribute to the reduced remnant clearance of insulin resistance.


    RESEARCH DESIGN AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Materials.
Linoleic acid, bovine serum albumin (BSA; grade V), chondroitinase ABC, and HEPES were obtained from Sigma (St. Louis, MO). Heparitinase was obtained from ICN (Aurora, OH). NuSieve 3:1 agarose was obtained from FMC BioProducts (Rockland, ME). Disposable PD-10 columns (Sephadex G-25), HiTrap Q columns, and [35S]sulfate were obtained from Amersham Pharmacia Biotech (Uppsala, Sweden). Primers for reverse transcriptase (RT)–polymerase chain reaction (PCR) were obtained from Life Technologies (Gaithersburg, MD). Reagents and fluorescently labeled probes for real-time PCR were purchased from Applied Biosystems (Stockholm). Trypsin and cell culture media were obtained from Biowhittaker (Verviers, Belgium), and fetal bovine serum (FBS) was obtained from Biochrom KG (Berlin, Germany). Human blood serum was obtained from young healthy donors. Scintillation fluid was obtained from Beckman (Fullerton, CA). Human recombinant apoE3 was purchased from PanVera (Madison, WI). Darglitazone and bezafibrate were obtained from AstraZeneca (Mölndal, Sweden). Insulin was purchased from Novo Nordisk (Copenhagen). All other chemicals were of analytical grade and were obtained from Merck (Darmstadt, Germany).

Lipoproteins.
LDLs (d = 1.019–1.063 g/ml) were isolated from fresh human plasma by using differential ultracentrifugation and were stored as previously described (9). ß-VLDLs from rabbits fed 1% cholesterol for 1–5 weeks were isolated and combined with apoE3, as previously described (5).

Animals.
The experimental procedures were approved by the local ethics committee on animal experiments (Göteborg region) and were in accordance with Swedish laws on the use and treatment of experimental animals. Adult male obese Zucker fa/fa rats and their lean fa/+ littermates were maintained in a temperature-controlled (20–22°C) room with 12-h light/dark cycles, and they had free access to rodent diet (R3; Lactamin AB, Stockholm) and tap water.

Cell culture.
HepG2 cells were bought from American Type Culture Collection (Manassas, VA) and subcultured by standard procedures. The cells were grown in Eagle’s minimum essential medium (EMEM) with 10% (vol/vol) FBS with the addition of glutamine, sodium pyruvate, and antibiotics. For incubations with NEFAs, media were prepared according to a previously described method (10). In brief, 100 µmol/l BSA was added to EMEM with 10% FBS. Free fatty acids were dissolved in a small volume of hexane, precipitated by dropwise addition of 6 mol/l NaOH, evaporated under nitrogen to a thin film, and dissolved in 1 ml warm water. The NEFAs suspended in water were added dropwise to the media while stirring. The pH was adjusted to 7.4 with NaOH, and the media were filtered through a 0.22-µm filter. The NEFA content in the media was determined with a colorimetric kit from Wako (Neuss, Germany). We previously have not been able to find evidence of NEFA free radical-mediated oxidation in the incubation conditions used (7). In the indicated studies, we added 10 or 50 nmol/l insulin to the culture medium. EMEM (Biowhittaker) contained 5.6 mmol/l glucose, which corresponded to a normal fasting glucose level. With dilution caused by the additions, the final glucose concentration was 5.4 mmol/l.

Biolabeling of GAGs.
Biolabeling and purification of PGs from tissue culture were performed as previously described (7,11). HepG2 cells were trypsinized and seeded. The cells were then incubated overnight in EMEM with 10% FBS, glutamine (0.292 g/l), sodium pyruvate (0.11 g/l), and, as antibiotics, 100 units/ml penicillin, 0.1 mg/ml streptomycin, and 0.25 µg/ml amphotericin; afterward, fresh medium with the same ingredients was added, but with the addition of 100 µmol/l BSA (control), 100 µmol/l BSA plus 10 nmol/l insulin, or 100 µmol/l BSA plus 300 µmol/l linoleic acid. After a 24-h preincubation in these media, labeled GAGs were obtained by exposing cultured cells to corresponding fresh medium with the addition of 67 µCi [35S]sulfate for 72 h before harvest. At harvest, the cultures were in a subconfluent state.

Proteoglycan preparation
Cell cultures.
Proteoglycans were prepared from cultured HepG2 cells and medium and from frozen rat livers. Complete mini protease inhibitors (Roche, Mannheim, Germany) were added to the culture medium; the medium was then dialyzed against binding buffer containing 8 mol/l urea, 2 mmol/l EDTA, 0.5% Triton X-100, and 20 mmol/l Tris-HCl (pH 7.5) during a 48-h period. Cells were dissolved to the same buffer (with protease inhibitors). A HiTrap Q (5 ml; Amersham Pharmacia) column was equilibrated with binding buffer, and the sample was applied at 5 ml/min. The column was washed with 0.25 mol/l NaCl to remove weakly bound glycoproteins and unincorporated [35S]sulfate. The remaining bound material was eluted with a linear salt gradient composed of 0.25–2 mol/l NaCl in binding buffer. Fractions of 2.5 ml were collected. Total counts in each fraction were determined by liquid scintillation counting. The fractions containing PGs were pooled and dialyzed against H2O at 4°C, lyophilized, and then dissolved in a small volume of H2O and stored at -20°C until use.

Rat livers.
Whole frozen livers of obese Zucker rats and lean littermates were minced, dissolved to cold binding buffer (8 mol/l urea, 2 mmol/l EDTA, 0.5% Triton X-100, and 20 mmol/l Tris-HCl [pH 7.5]) with protease inhibitors and centrifuged for 15 min at 20,000g. The supernatants were filtered and used to isolate total PGs with the same column (HiTrap Q; Amersham Pharmacia), and salt gradient that was used to purify PGs from tissue culture (above). [35S]sulfate-labeled rat liver PGs were prepared with the same protocol after injecting two Zucker rats (one lean and one obese littermate) with 2 x 1 mCi [35S]sulfate, as previously described (5).

GAG analysis.
Digestion and electrophoresis of GAGs were done as previously described (12). GAGs were fixed with 0.1% cetylpyridinium chloride and stained with 0.1% toluidine blue (13). A Blyscan GAG assay kit (Biocolor, Belfast, U.K.) was used for GAG determinations. Protein was determined with a Pierce (Rockford, IL) protein determination kit. Compositional disaccharide analysis of [35S]-labeled HS was performed as described previously (14).

RT-PCR.
After incubations with NEFAs, cells were detached by a brief (5-min) incubation with trypsin, collected in cold phosphate-buffered saline with Ca2+ and Mg2+, and immediately put on ice. Cells were pelleted, and a kit was used to prepare total RNA (Invitrogen, Leek, the Netherlands). After converting mRNA to cDNA by incubation with RT and buffer containing 50 mmol/l Tris HCl, pH 8.3, 75 mmol/l KCl, 3 mmol/l MgCl2, and 10 mmol/l dithiothreitol, samples were divided. The fluorogenic 5' nuclease (TaqMan) assay (real-time PCR; Applied Biosystems, Foster City, CA) (15) and the ABI Prism 7700 sequence detection system (Applied Biosystems) were used to estimate mRNA content. Primers for human versican were selected in a region of versican that is common to all splice variants (16) and were sense GGTGCCTCTGCCTTCCAA (position 6754–6771) and antisense TGCCAGCCATAGTCACATGTC (position 6806–6826), defining a fragment of 73 nucleotides. A 6-carboxy-fluorescein (FAM)-labeled probe TTATGTTGGTGCACTTTGTGAGCAAGATACCG (position 6773–6804) was used. Primers for syndecan 1 were sense GAGGGCTGCTGAGGATGGA (position 772–790) and antisense ATTCTCCCCCGAGGTTTCAA (position 843–862), defining a fragment of 91 nucleotides; a FAM-labeled probe CCTCCAGTCAGCTCCCAGCAGCA (position 792–814) was used. A predeveloped primer/probe for control 18S ribosomal RNA (suitable for both human and rat) was purchased from Applied Biosystems.

Livers from lean and obese Zucker rats were excised and immediately frozen in liquid nitrogen. The frozen livers were kept at -80°C until use. The same kit that was used for isolation of RNA from HepG2 cells (Invitrogen) was used to prepare RNA from frozen rat livers, following the manufacturer’s instructions. Primers for rat versican were sense TGCCTCTGCCTTCCGAGTT (position 6435–6453) and antisense CAGCCATAGTCGCATGTCTCA (position 6482–6502), defining a fragment of 68 nucleotides; a FAM-labeled probe TGTCGGTGCACTCTGCGAACAAGAC (position 6455–6479) was used. Primers for rat syndecan 1 were sense GTTGTGGAGGATGAAACTACCAATC (position 803–827) and antisense AGCTGTGTTCTCCCCAGATGTT (position 874–895), defining a fragment of 93 nucleotides; a FAM-labeled probe CAAAGGTGAAGTCTTGTTCTCCAGAGCCCT (position 843–872) was used.

Gel mobility shift assay.
Gel mobility shift studies to evaluate PG-lipoprotein interaction were performed as previously reported (17). The same amounts of biolabeled HepG2 PGs as determined by [35S]sulfate content or rat liver PGs (as determined by GAG content) were incubated with increasing amounts of lipoproteins for 1 h at room temperature and electrophoresed. Evaluation of the gels was done by autoradiography (HepG2 cells) or by staining the gels for GAG (liver PGs).

Data analysis.
All densitometric evaluations were done with a Bio-Rad molecular imager system and evaluated with Quantity One software (Bio-Rad, Hercules, CA). Graph Pad Prism software (San Diego, CA) was used to fit one-site hyperbola binding curves to the data. Results are given as means ± SD. Differences between two groups were identified with a Student’s t test (Fig. 5). For multiple groups, a one-way analysis of variance (ANOVA) and Newman-Keuls post hoc test were used to identify differences (Figs. 2 and 3). P > 0.05 was considered nonsignificant.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 5. Evaluation of mRNA for PG core proteins in rat liver. Messenger RNA for versican and syndecan 1 was evaluated by real-time PCR, as described in RESEARCH DESIGN AND METHODS, in total RNA preparations from the livers of four lean ({square}) or four obese ({blacksquare}) Zucker rats. Data are presented as copy number normalized to 18S rRNA with SD (n = 4). Student’s t test was used to test the significance of the column representing results from obese rat livers versus the column representing results from lean rat livers. The analysis for versican and syndecan 1 results was done individually. *P < 0.01; **P < 0.001

 


View larger version (19K):
[in this window]
[in a new window]
 
FIG. 2. Evaluation of the effect of insulin and linoleic acid on mRNA for PG core proteins in HepG2 cells. Messenger RNA for versican (A) and syndecan 1 (B) was evaluated by real-time PCR, as described in RESEARCH DESIGN AND METHODS, in total RNA preparations from HepG2 cells. The cells were exposed for 48 h to 100 µmol/l BSA in EMEM with 10% FBS alone (Control), with 10 or 50 nmol/l insulin (Ins), or with 300 µmol/l linoleic acid (LA) alone or combined with 10 or 50 nmol/l insulin. Data are presented as percent of expression in control cells normalized for 18S rRNA content with SD (n = 3). One-way ANOVA was used to test significance versus control. The cell culture, mRNA isolation, and RT-PCR were repeated three times. Results from one representative experiment are shown. *P < 0.05; **P < 0.01; ***P < 0.001.

 


View larger version (19K):
[in this window]
[in a new window]
 
FIG. 3. Evaluation of the effect of darglitazone and bezafibrate on mRNA for versican core proteins in HepG2 cells. Messenger RNA for versican was evaluated by real-time PCR, as described in RESEARCH DESIGN AND METHODS, in total RNA preparations from HepG2 cells. The cells were exposed for 48 h to 100 µmol/l BSA in EMEM with 10% FBS alone (Control), 4 µmol/l darglitazone (Dargl), 100 µmol/l bezafibrate (Bezaf), or 300 µmol/l linoleic acid (LA). Data are presented as percent of expression in control cells normalized for 18S rRNA content with SD (n = 3). One-way ANOVA was used to test significance versus control. The cell culture, mRNA isolation, and RT-PCR were repeated three times. Results from one representative experiment are shown. *P < 0.001

 

    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To study PG expression in hepatic cells, we used an in vitro model (HepG2 cells) and an ex vivo model (livers from obese Zucker rats and their lean littermates). Isolated PGs from each model were subsequently used to estimate binding of ß-VLDL and model remnant particles (ß-VLDL + apoE) with gel mobility shift (17).

Effects of insulin and linoleic acid HepG2 cell PGs.
HepG2 cells were exposed to low and high levels of albumin-bound linoleate or insulin that were within physiological ranges. In all experiments performed, HepG2 cells incubated with 10 nmol/l insulin secreted ~15% more extracellular matrix PGs, measured as incorporated [35S]sulfate per milligram of cell protein, whereas cells incubated with 300 µmol/l albumin-bound linoleate appeared to decrease their PG secretion by 10%. To determine the GAG distribution in the PGs produced under the different growth conditions, the PG preparations were digested with chondroitinase AC that hydrolyzes CS-4 and -6, chondroitinase ABC that degrades CS and DS, and heparitinase that hydrolyzes HS. The largest effect appeared to be on CS secretion: insulin increased CS secretion, whereas linoleic acid markedly decreased CS secretion (Fig. 1). In cells incubated with both insulin and linoleic acid, the NEFAs appeared to almost neutralize the insulin action. Cell surface PGs appeared to contain mostly HS, with very little CS and almost no DS. No changes in the cell surface PGs were observed with insulin and linoleic acid (not shown). The degree of 6-O and 2-O sulfation (18) of the cell-associated and secreted HS was similar between the two incubation conditions (not shown). However, other structural changes of HS could not be excluded.



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 1. GAG composition in HepG2 cells. Papain digestion of PGs produced by HepG2 cells incubated under control conditions, with 10 nmol/l insulin (Ins) and/or 300 µmol/l linoleic acid (LA). The GAG distribution in secreted PGs is shown. Autoradiographs (A) of the agarose gels with GAG incubated in buffer (lanes 1), chondroitinase AC (lanes 2), chondroitinase ABC (lanes 3), and heparitinase (lanes 4) were evaluated densitometrically. The enzymatic digestion experiment was performed twice. Data from one of the experiments is shown in A. The data presented as percent of total GAG (average from two experiments) is shown in B. The figures are (averages ± range) as follows. Control: 31.8 ± 2.8% HS, 39.6 ± 2.6% DS, 28.6 ± 5.4% CS; 10 nmol/l insulin: 30.4 ± 4.4% HS, 26.6 ± 7.4% DS, 43 ± 3% CS; 300 µmol/l linoleic acid: 39.0 ± 9.4% HS, 48.4 ± 1.6% DS, 12.3 ± 7.7% CS; and 300 µmol/l linoleic acid plus 10 nmol/l insulin: 38.4±% HS, 31.0 ± 2.0% DS, 30.6 ± 0.6% CS. {square}, CS; , DS; {blacksquare}, HS.

 
RT-PCR showed that in HepG2 cells, insulin induced an increase in the mRNA for the core protein of versican, a secreted CS PG (Fig. 2A). High levels of NEFAs (300 µmol/l linoleic acid), on the other hand, markedly decreased mRNA for versican. Combining linoleic acid and insulin partially neutralized the effect of linoleic acid (Fig. 2A). Syndecan 1, a membrane-bound PG with predominantly HS GAG, appeared to be similarly affected by insulin and linoleic acid (Fig. 2B). However, linoleic acid had a less intense effect on syndecan 1 mRNA.

Linoleic acid or its metabolites acid may stimulate proliferator activated receptor-{alpha} in hepatic cells (19). We were unable to find regions with high homology to the proposed peroxisomal proliferator response element in the promoter region of versican (20). We tested to see whether darglitazone and bezafibrate, both proliferator-activated receptor-{alpha} (PPAR-{alpha}) agonists, could mimic the effect of linoleic acid (Fig. 3). Bezafibrate decreased mRNA for versican to the same extent as did linoleic acid, whereas darglitazone had no observable effect. The concentrations of darglitazone and bezafibrate used usually show effects in vitro (7,19). The decrease in versican mRNA that linoleic acid induced, although observed in all studies, varied somewhat. The difference in magnitude of the effects seen in individual experiments is illustrated by the differences between Figs. 2A and 3.

Characteristics of liver PGs of Zucker obese and lean rats.
As an ex vivo model of the possible chronic effects of high NEFA levels and insulin on liver PGs, we used obese Zucker fa/fa rats and their lean fa/+ littermates. The obese animals had insulin levels of 4.0 ± 1.0 nmol/l, plasma NEFA levels of 550–1,200 µmol/l, and triglyceride levels of 7–11 mmol/l, mostly associated with remnant particles. The lean littermates had insulin levels of 0.4 ± 0.2 nmol/l, NEFA levels of 50–140 µmol/l, and triglyceride levels of 0.7–1.2 mmol/l, mostly VLDLs. To estimate the GAG composition in rat liver PGs, the PGs were labeled in vivo with [35S]sulfate and purified as described in RESEARCH DESIGN AND METHODS. The GAG distribution of the isolated PGs was estimated by enzymatic digestion, as were those of HepG2 cells; the percent distribution of [35S]sulfate as HS, DS, and CS was calculated. These data indicated a shift toward increased CS content at the expense of HS in the liver of the obese rat (Fig. 4). It should be stressed that the PGs extracted from whole liver were a mixture of cell surface and secreted (extracellular matrix) PGs. When mRNA for versican and syndecan 1 core proteins from liver of obese and lean Zucker rats were compared, the obese animals show increased expression of these proteins (Fig. 5). This resembled the pattern induced by insulin on HepG2 cells (Fig. 2). Preliminary data indicated that when both obese and lean littermate Zucker rats were older, the differences remained, but were less pronounced (not shown).



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 4. GAG composition in rat livers. PGs of an obese Zucker rat and a lean littermate were biolabeled in vivo with [35S]sulfate. GAG composition was estimated by enzymatic digestion, as in Fig. 1. Densitometric evaluation of the results was used to calculate the percent distribution of GAGs. {square}, CS; , DS; {blacksquare}, HS.

 
VLDL remnant binding to PGs of hepatic cells.
ApoE-enriched rabbit ß-VLDLs have been used as a model for the retention of remnant particles mediated by liver PGs (6). Using these particles, we estimated lipoprotein-binding affinities to PGs isolated from HepG2 cells and Zucker rat livers. The altered PG composition after treatment with insulin appeared to decrease the binding of rabbit apoE-enriched ß-VLDLs to secreted HepG2 cell PGs (Fig. 6), whereas the binding of LDLs was unaffected (not shown). Binding of ß-VLDLs without apoE to PGs secreted from HepG2 cells was low and was unaffected by insulin or NEFAs (not shown). Linoleic acid partially reversed the effect of insulin on the binding isotherm. Thus, high insulin combined with high NEFA levels appeared to decrease the affinity of the remnant lipoproteins for the PGs. ß-VLDL (without additional apoE) bound to PGs isolated from lean rat livers in a saturable manner and with an apparent Kd of 25–50 ng/ml, whereas the rate at which ß-VLDLs bound to PGs isolated from obese rat livers was lower than the detection limit of the assay (not shown). The maximal binding of apoE-enriched ß-VLDLs to PGs isolated from obese rat livers was ~40% of that bound to PGs isolated from lean rat livers (Fig. 7). The electrophoretic mobility of PGs isolated from all rat livers showed a higher negative charge than that of PGs isolated from obese rat liver. This probably reflected the higher relative content of HS-containing PGs in lean liver. A low negative-charge density of PGs from the obese animals could explain their reduced binding of apoE-enriched remnant VLDLs.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 6. Binding of lipoproteins to PGs from HepG2 cells. Increasing amounts of apoE-enriched ß-VLDLs were added to [35S]-labeled PGs purified from HepG2 cells. Binding was evaluated by gel-mobility shift assay and autoradiography densitometry. Added ß-VLDL is indicated on the x-axis. One-site hyperbola binding curves were fitted to the data. The experiment was performed three times with PGs isolated from HepG2 cells incubated under control ({circ}) conditions and with linoleic acid (LA; •) alone and twice with PGs from cells incubated with insulin (Ins; {square}) and insulin plus linoleic acid (Ins + LA; {blacksquare}). Data from one of the experiments are shown. Data points are averages ± SD (n = 3).

 


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 7. Binding of lipoproteins to PGs from rat livers. Increasing amounts of lipoproteins were added to (unlabeled) PGs purified from rat livers. Binding was evaluated by gel-mobility shift assay. The gels were stained for GAG content and evaluated densitometrically. Added ß-VLDL is indicated on the x-axis. The points are averages of duplicate experiments, and the bars represent variation of the duplicates. One-site hyperbola binding curves were fitted to the data. PGs were prepared from the livers of four lean ({circ}) and four obese (•) rats. The experiments were done with two PG preparations of each type (lean or obese).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We found that the addition of insulin and albumin-bound linoleic acid to standard culture medium increased and decreased, respectively, the PGs synthesized by HepG2 cells and induced qualitative changes in their distribution (Fig. 1). Alterations were also observed in PGs from livers of obese Zucker rats—liver cells that were chronically exposed to high insulin and NEFA levels (Fig. 4). Interestingly, PGs isolated from both insulin-treated HepG2 cells and obese Zucker rats showed decreased binding of apoE-enriched VLDL remnants, a step that may be critical for lipoprotein internalization by liver cells (6). The most important effects of insulin and NEFAs on HepG2 cells were seen on secreted PGs. To what extent secreted or membrane-bound PGs contribute to binding and internalization of lipoproteins in intact liver remains to be explored in detail. Mahley and Ji (6) suggested that secreted PGs may contribute to this process by presenting or transporting lipoproteins to other receptors, such as the LDL receptor-related protein.

We evaluated versican and syndecan 1 expression in this study because syndecan 1 is abundant in liver cells, and our preliminary experiments indicated the presence of versican in hepatocytes (21). We failed to find evidence of the presence of decorin in HepG2 cells. Changes in the expression of versican and syndecan 1 may have reflected the quantitative changes in PG production and should have been the cause of qualitative differences in the most common GAGs, which are CS, DS, and HS (Figs. 1 and 4). Syndecan 1 appeared to mediate a large part of the binding of chylomicrons and VLDL remnant particles to hepatic cells, and inhibition of its synthesis markedly decreased the binding of remnant lipoproteins to HepG2 cells (21). Our results showed that exposure to insulin slightly increased PG synthesis in HepG2 cells and shifted the GAG composition in secreted PGs toward PGs with a lower affinity for VLDL remnants. Linoleic acid appeared to affect PG synthesis in the opposite direction (Figs. 1 and 2), as did bezafibrate (Fig. 3). We speculate that this may have been a manifestation of NEFA-induced insulin resistance at the level of extracellular matrix metabolism. At the concentrations used, downregulation of versican by linoleic acid appeared to be more intense than its upregulation by insulin in HepG2 cells in vitro (Fig. 2). We found a higher level of versican in the liver of obese Zucker rats chronically exposed to high circulating insulin and NEFA levels than in the liver of lean rats (Fig. 5). It should be pointed out, however, that the in vivo labeling was performed in only two animals (Fig. 4). We speculate that in this in vivo model, the insulin effect overrode the NEFA effect. Although this preliminary observation may indicate that the PG alterations of HepG2 cells and liver cells of Zucker rat may have had similar origin, one should be careful to not overinterpret the resemblance, as these two models have many differences. Specifically, the effects of insulin and NEFAs studied in HepG2 cells were from relatively short exposure experiments, whereas in the hyperinsulinemic dyslipidemic Zucker rat, these agents acted chronically.

Studies on smooth muscle cells (7) and endothelial cells (8) have indicated that albumin-bound oleic and linoleic acids have similar effects on PG modulation. However, Hennig and colleagues (10,22,23,24,25) found that linolenic acid and saturated fatty acids were less potent modulators than linoleic acid on endothelial barrier function and PG synthesis. Although the effects on smooth muscle and endothelial cells are not necessarily transferable to hepatic cells, the above considerations led us to choose linoleic acid as a first model to study NEFAs’ effects on hepatic cells. The level of 300 µmol/l of BSA-bound linoleic acid was selected as a value that showed clear effects, but that was well within the physiological concentrations that could exist in extracellular fluid (26). An alternative approach would have been to use a mixture of fatty acids that mimic a more physiological situation. The use of mixtures with several physiologically relevant compositions is an important question that should be addressed in depth in a separate set of studies.

There were several nonexclusive mechanisms that could explain the observed effects of insulin and NEFAs on metabolism of extracellular matrix PGs. It has been proposed that the hexosamine biosynthetic pathway is a nutrient-sensing pathway that can be primed by several stimuli, including infusion of NEFAs (27). The end products of this pathway, UDP-Glc-NAc and UDP-Gal-Nac, are the building blocks for the synthesis of the GAG chains of PGs. The concentration of some of the end products of the hexosamine pathway can be altered by NEFAs (27). On the other hand, activation of protein kinase C (PKC) isoforms appears to be involved in several diabetic complications, including basement membrane thickening by excess extracellular matrix production (28). PKC also modulates some of the effects of NEFAs on smooth muscle cells, probably through the action of diacylglycerol, which interferes with insulin signaling (29,30), on PKC isoforms. In preliminary experiments, we found that some of the effects of NEFAs on PG secretion in HepG2 cells could be partially reversed by PKC inhibition (not shown). The observed opposite effects of linoleic acid and insulin on PG biosynthesis and GAG composition observed in HepG2 cells (Figs. 1 and 2) are compatible with such interference of NEFAs with insulin action.

A third mechanism involving the transcription factor PPAR-{alpha} is supported by the observed similitude of the action of the PPAR-{alpha} agonist bezafibrate and linoleic acid on gene expression of the versican core protein (Fig. 3). In hepatocytes, polyunsaturated fatty acids and their oxidation products may be ligands for nuclear transcription factors that modulate expression of genes controlling lipid and carbohydrate metabolism in liver cells (20). Such mechanisms may also have been involved in the effects of insulin and NEFAs on PG synthesis reported here, which in this case was modulated by a PPAR-{alpha} but not a PPAR-{gamma} agonist (Fig. 3). Such results contrast with those from studies of human arterial smooth muscle cells (7). In these cells, the PPAR-{gamma} agonist darglitazone opposed the stimulatory action of linoleate on decorin gene expression. These differences should be subject to detailed investigation, but we speculate that they may be related to the differential effects of NEFAs on gene expression for the core protein of different PGs. The lack of effect of darglitazone on HepG2 PGs may also have been related to the more prominent expression of PPAR-{alpha} in liver cells than in smooth muscle cells.

One of the important functions of hepatic extracellular PGs is their participation in lipoprotein metabolism as high-capacity low-affinity receptors of chylomicron and VLDL remnants (6). Our binding studies showed a decreased binding of apoE-enriched ß-VLDLs to secreted PGs from HepG2 cells when the cells were cultured in medium enriched in insulin (Fig. 6). The curves in Fig. 6 indicated no change of apoE-enriched ß-VLDL binding to PGs produced by HepG2 cells incubated in medium supplemented with 300 µmol/l linoleic acid when compared with PGs produced by control cells. Addition of insulin alone to the culture medium drastically changed the binding characteristics, and we were unable to fit a one-site binding curve to this data. Interestingly, PGs secreted by HepG2 cells that were cultured in medium supplemented with insulin and linoleic acid exhibited about half the total PG binding of control cells or cells incubated only with linoleate (Fig. 6). Lipoproteins and apolipoproteins show specificity in their binding to different GAGs (2). Thus NEFA- or insulin-induced extracellular GAG changes of hepatic cells could modify the binding of specific lipoproteins, especially changes involving HS PGs that in hepatic cells appear critical for binding and internalization of apoE-enriched ß-VLDLs (Fig. 6) (6). The importance of liver HS PGs for postprandial clearance of remnants, and the fact that their postprandial clearance rate is reduced in type 2 diabetes, have been previously described (31). However, to our knowledge, whether liver PGs and GAGs are affected in type 2 diabetes has not been investigated. In our studies, obese rat liver appeared to contain relatively more CS, at the expense of DS and HS, than lean rat liver (Fig. 4). This observation is in line with studies showing a marked increase in the core protein genes for both syndecan 1 and versican, which are CS PGs, in liver from obese rats compared with liver from lean rats (Fig. 5). Our studies indicated a decreased binding of ß-VLDLs and apoE-enriched ß-VLDLs to PGs isolated from livers of obese rats (Fig. 7). If a similar situation existed in vivo, it could contribute to increased circulating remnant particles in obese Zucker rats. In a type 1 diabetes model, Ebara et al. (32) found delayed catabolism of apoB-48 lipoproteins because of decreased HS PG production in diabetic mice. They suggested that the effect was attributable to the effects of hyperglycemia on matrix production. Our findings suggest that in insulin resistance, the chronically elevated levels of insulin and circulating NEFAs affect PGs of the liver extracellular matrix and decrease the clearance rate for triglyceride-rich remnant lipoproteins. This is a condition that could contribute to the dyslipidemia of insulin resistance and type 2 diabetes.


    ACKNOWLEDGMENTS
 
This work was supported by grants from the Swedish Medical Research Council, the Swedish Heart-Lung Foundation, Strategic Funds National Network for Cardiovascular Research, the foundations of the National Board of Health and Welfare, the Medical Faculty at Göteborg University, Magnus Bergvalls Foundation, and AstraZeneca.

We thank Eva Gottfridsson for her technical help.


    FOOTNOTES
 
Address correspondence and reprint requests to Dr. Germán Camejo, AstraZeneca Preclinical Research Laboratories, S-413 45 Mölndal, Sweden. E-mail: german.camejo{at}astrazeneca.com.

Received for publication 21 December 2000 and accepted in revised form 30 May 2001.

U.O. is currently affiliated with Amersham Pharmacia Biotech, Uppsala, Sweden; M.S. is currently affiliated with Turku Centre for Biotechnology, Turku, Finland.

apo, Apolipoprotein; ANOVA, analysis of variance; BSA, bovine serum albumin; CS, chondroitin sulfate; DS, dermatan sulfate; EMEM, Eagle’s minimum essential medium; FAM, 6-carboxy-fluorescein; FBS, fetal bovine serum; GAG, glycosaminoglycan; HS, heparan sulfate; NEFA, nonesterified fatty acid; PCR, polymerase chain reaction; PG, proteoglycan; PKC, protein kinase C; PPAR-{alpha}, proliferator activated receptor-{alpha}; RT, reverse transcriptase.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lehto S, Rönnema T, Haffner S, Pyörälä K, Kallio V, Laakso M: Dyslipidemia and hyperglycemia predict coronary heart disease events in middle-aged patients with NIDDM. Diabetes 46:1354–1359, 1997[Abstract]
  2. Camejo G: The interaction of lipids and lipoproteins with the intercellular matrix of arterial tissue: its possible role in atherogenesis. Adv Lipid Res 19:1–54, 1982[Medline]
  3. Camejo G, Hurt-Camejo E, Wiklund O, Bondjers G: Association of lipoproteins with arterial proteoglycans: pathological significance. Atherosclerosis 139:205–222, 1998[Medline]
  4. Williams K, Tabas I: The response-to-retention hypothesis of atherogenesis reinforced. Curr Opin Lipidol 9:471–474, 1998[Medline]
  5. Ji Z, Brecht WJ, Miranda RD, Hussain MM, Innerarity TL, Mahley RW: Role of heparan sulfate proteoglycans in the binding and uptake of apolipoprotein E-enriched remnant lipoproteins by cultured cells. J Biol Chem 268:10160–10167, 1993[Abstract/Free Full Text]
  6. Mahley RW, Ji Z: Remnant lipoprotein metabolism: key pathways involving cell-surface heparan sulfate proteoglycans and apolipoprotein E. J Lipid Res 40:1–16, 1999[Abstract/Free Full Text]
  7. Olsson U, Bondjers G, Camejo G: Fatty acids modulate the composition of extracellular matrix in cultured human arterial smooth muscle cells by altering the expression of genes for proteoglycan core proteins. Diabetes 48:616–622, 1999[Abstract]
  8. Hennig B, Lipke DW, Biossonneault GA, Ramasamy S: Role of fatty acids and eicosanoids in modulating proteoglycan metabolism in endothelial cells. Prostaglandins Leukot Essent Fatty Acids 53:315–324, 1995[Medline]
  9. Hurt-Camejo E, Camejo G, Rosengren B, Lopez F, Wiklund O, Bondjers G: Differential uptake of proteoglycan-selected subfractions of low density lipoprotein by human macrophages. J Lipid Res 31:1387–1398, 1990[Abstract]
  10. Ramasamy S, Boissenault GA, Lipke DW, Hennig B: Proteoglycans and endothelial barrier function: effect of linoleic acid exposure to porcine pulmonary artery endothelial cells. Atherosclerosis 103:279–290, 1993[Medline]
  11. Sartipy P, Johansen B, Camejo G, Rosengren B, Bondjers G, Hurt-Camejo E: Binding of human phospholipase A2 type II to proteoglycans: differential effect of glycosaminoglycans on enzyme activity. J Biol Chem 271:26307–26314, 1996[Abstract/Free Full Text]
  12. Fager G, Camejo G, Olsson U, Östergren-Lunden G, Lustig F, Bodjers G: Binding of platelet derived growth factor and low density lipoproteins to glycosaminoglycan species produced by human smooth muscle cells. J Cell Physiol 163:380–392, 1995[Medline]
  13. Alves CS, Murao PAS: Interaction of high molecular weight chondroitin sulfate from human aorta with plasma low density lipoprotein. Atherosclerosis 73:113–124, 1988[Medline]
  14. Safaiyan F, Lindahl U, Salmivirta M: Selective reduction of 6-O-sulfation in heparan sulfate from transformed mammary epithelial cells. Eur J Biochem 252:576–582, 1998[Medline]
  15. ABI Prism 7700 sequence detection system. Available from http://www.perkin-elmer.com.
  16. Lemire JM, Braun KR, Maurel P, Kaplan ED, Schwartz SM, Wight TN: Versican/PG-M isoforms in vascular smooth muscle cells. Arterioscler Thromb Vasc Biol 19:1630–1639, 1999[Abstract/Free Full Text]
  17. Hurt-Camejo E, Camejo G, Sartipy P: Measurements of proteoglycan-lipoprotein interaction by gel mobility shift assay. In Methods in Molecular Biology. Ordovas JM, Ed. Totowa, NJ, Human Press, 1998, p. 267–279
  18. Feyzi E, Saldeen T, Larsson E, Lindahl U, Salmivirta M: Age-dependent modulation of heparan sulfate structure and function. J Biol Chem 273:13395–13398, 1998[Abstract/Free Full Text]
  19. Willson TM, Brown PJ, Sternbach DD, Henke BR: The PPARs: from orphan receptors to drug discovery. J Med Chem 43:527–550, 2000[Medline]
  20. Schoonjans K, Martin G, Staels B, Auwerx J: Peroxisome proliferator-activated receptors: orphans with ligands and functions. Curr Opin Lipidol 8:159–166, 1997[Medline]
  21. Zeng B, Mortimer B, Martins IJ, Seydel U, Redgrave TG: Chylomicron remnant uptake is regulated by the expression and function of heparan sulfate proteoglycan in hepatocytes. J Lipid Res 39:845–860, 1998[Abstract/Free Full Text]
  22. Hennig B, Shasby DM, Fulton AB, Spector AA: Exposure to free fatty acid increases the transfer of albumin across cultured endothelial monolayers. Arteriosclerosis 4:489–497, 1984[Abstract/Free Full Text]
  23. Hennig B, Shasby DM, Spector AA: Exposure to fatty acid increases human low density lipoprotein transfer across cultured endothelial monolayers. Circ Res 57:776–780, 1985[Abstract/Free Full Text]
  24. Hennig B, Watkins BA: Linoleic acid and linolenic acid: effect on permeability properties of cultured endothelial cell monolayers. Am J Clin Nutr49:301–305, 1989
  25. Ramasamy S, Boissonneault GA, Decker EA, Hennig B: Linoleic acid-induced endothelial cell injury: role of membrane-bound enzyme activities and lipid oxidation. J Biochem Toxicol 6:29–35, 1991[Medline]
  26. Spector AA: Structure and lipid binding properties of serum albumin. Methods Enzymol128:320–339, 1986
  27. Hawkins M, Barzilai N, Hu M, Chen W, Rossetti L: Role of the glucosamine pathway in fat-induced insulin resistance. J Clin Invest 99:2173–2182, 1997[Medline]
  28. Koya D, King GL: Protein kinase C activation and the development of diabetic complications. Diabetes 47:859–866, 1998[Abstract]
  29. Lu G, Morinelli TA, Meier KE, Rozenzweig SA, Egan BM: Oleic acid-induced mitogenic signaling in vascular smooth muscle cells: a role for protein kinase C. Circ Res79:611–618, 1996
  30. Griffin M, Marcucci M, Cline G, Bell K, Barucci N, Lee D, Goodyear L, Kraegen E, White M, Schulman G: Free fatty acid-induced insulin resistance is associated with activation of protein kinase C {theta} and alterations in the insulin signaling cascade. Diabetes 48:1270–1274, 1999[Abstract]
  31. Willnow TE: Mechanisms of hepatic chylomicron remnant clearance. Diabet Med 14 (Suppl. 3):S75–S80, 1997
  32. Ebara T, Conde K, Kako Y, Liu Y, Xu Y, Ramakrishnan R, Goldberg I, Shachter N: Delayed catabolism of apoB-48 lipoproteins due to decreased heparan sulfate proteoglycan production in diabetic mice. J Clin Invest 105:1807–1818, 2000[Medline]

Add to CiteULike CiteULike   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Histochem. Cytochem.Home page
T. O. McDonald, R. G. Gerrity, C. Jen, H.-J. Chen, K. Wark, T. N. Wight, A. Chait, and K. D. O'Brien
Diabetes and Arterial Extracellular Matrix Changes in a Porcine Model of Atherosclerosis
J. Histochem. Cytochem., November 1, 2007; 55(11): 1149 - 1157.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Rodriguez-Lee, G. Ostergren-Lunden, B. Wallin, J. Moses, G. Bondjers, and G. Camejo
Fatty Acids Cause Alterations of Human Arterial Smooth Muscle Cell Proteoglycans That Increase the Affinity for Low-Density Lipoprotein
Arterioscler. Thromb. Vasc. Biol., January 1, 2006; 26(1): 130 - 135.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
G. Camejo
Differential Antiatherogenic Effects of PPAR{alpha} Versus PPAR{gamma} Agonists: Should We Be Surprised?
Arterioscler. Thromb. Vasc. Biol., September 1, 2005; 25(9): 1763 - 1764.
[Full Text] [PDF]


Home page
DiabetesHome page
K. J. Williams, M.-L. Liu, Y. Zhu, X. Xu, W. R. Davidson, P. McCue, and K. Sharma
Loss of Heparan N-Sulfotransferase in Diabetic Liver: Role of Angiotensin II
Diabetes, April 1, 2005; 54(4): 1116 - 1122.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. H. A. Lee, J. M. Trowbridge, K. R. Taylor, V. B. Morhenn, and R. L. Gallo
Dermatan Sulfate Proteoglycan and Glycosaminoglycan Synthesis Is Induced in Fibroblasts by Transfer to a Three-dimensional Extracellular Environment
J. Biol. Chem., November 19, 2004; 279(47): 48640 - 48646.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. J. Baron, G. R. Bolduc, M. B. Goldberg, T. C. Auperin, and L. C. Madoff
Alpha C Protein of Group B Streptococcus Binds Host Cell Surface Glycosaminoglycan and Enters Cells by an Actin-dependent Mechanism
J. Biol. Chem., June 4, 2004; 279(23): 24714 - 24723.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Olsson, U.
Right arrow Articles by Camejo, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Olsson, U.
Right arrow Articles by Camejo, G.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Diabetes Diabetes Care Clinical Diabetes Diabetes Spectrum