Diabetes
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
50.01.02.db01-0280v1
51/1/1    most recent
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Echwald, S. M.
Right arrow Articles by Pedersen, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Echwald, S. M.
Right arrow Articles by Pedersen, O.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
Diabetes 51:1-6, 2002
© 2002 by the American Diabetes Association, Inc.


Rapid Publication

A P387L Variant in Protein Tyrosine Phosphatase-1B (PTP-1B) Is Associated With Type 2 Diabetes and Impaired Serine Phosphorylation of PTP-1B In Vitro

Søren M. Echwald1, Helle Bach1, Henrik Vestergaard2, Bjørn Richelsen3, Kurt Kristensen3, Thomas Drivsholm4, Knut Borch-Johnsen1, Torben Hansen1, and Oluf Pedersen1

1 Steno Diabetes Center and Hagedorn Research Institute, Copenhagen, Denmark
2 Department of Endocrinology, Herlev University Hospital, Herlev, Denmark
3 Department of Medicine and Endocrinology, Aarhus, Denmark
4 Centre of Preventive Medicine, Glostrup University Hospital, Glostrup, Denmark


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In the present study, we tested the hypothesis that variability in the protein tyrosine phosphatase-1B (PTP-1B) gene is associated with type 2 diabetes. Using single-strand conformational polymorphism analysis, we examined cDNA of PTP-1B from 56 insulin-resistant patients with type 2 diabetes as well as cDNA from 56 obese patients. Four silent variants, (NT CGA->CGG) R199R, (NT CCC->CCT) P303P, 3'UTR+104insG, and 3'UTR+86T->G, and one missense variant, P387L, were found. Subsequent analysis on genomic DNA revealed two intron variants, IVS9+57C->T and IVS9+58G->A, and two missense variants, G381S and T420M. The G381S and 3'UTR+104insG insertion variants were not associated with type 2 diabetes. In an association study, the P387L variant was found in 14 of 527 type 2 diabetic subjects (allelic frequency 1.4%, 0.4–2.4 CI) and in 5 of 542 glucose-tolerant control subjects (allelic frequency 0.5%, CI 0.1–1.1), showing a significant association to type 2 diabetes (P = 0.036). In vitro, p34 cell division cycle (p34cdc2) kinase–directed incorporation of [{gamma}-32P]ATP was reduced in a mutant peptide compared with native peptide (387P: 100% vs. 387L: 28.4 ± 5.8%; P = 0.0012). In summary, a rare P387L variant of the PTP-1B gene is associated with a 3.7 (CI 1.26–10.93, P = 0.02) genotype relative risk of type 2 diabetes in the examined population of Danish Caucasian subjects and results in impaired in vitro serine phosphorylation of the PTP-1B peptide.



    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Type 2 diabetes is a complex disorder with a strong genetic background (1). The multiple clinical manifestations of type 2 diabetes appear to originate from both defective insulin secretion as well as from an impaired action of insulin in target tissues (2). After binding of insulin, signaling through the insulin receptor is mediated by tyrosine phosphorylation of downstream signaling proteins such as insulin receptor substrate (IRS)-1 and -2, which initiate a signaling cascade (3). Modulators of this cascade include protein tyrosine phosphatases that regulate the activity of multiple cellular proteins by controlling their phosphorylation status (4). The protein tyrosine phosphatase-1B (PTP-1B) is an ubiquitously expressed tyrosine phosphatase; in in vitro studies, PTP-1B blocks the insulin-stimulated tyrosine phosphorylation of the insulin receptor and thereby the IRS-1, two important mediators of insulin signaling (5,6). Intriguingly, PTP-1B localizes to the endoplasmic reticulum through a 35-aa COOH-terminal motif, extending the phosphatase domain toward the cytoplasma (7). It has recently been shown that mice deficient in PTP-1B exhibit increased insulin sensitivity as well as resistance to weight gain when fed a high-fat diet (8,9). The increased insulin sensitivity correlated to increased insulin-stimulated phosphorylation of the insulin receptor and IRS-1 (8). Also, recent reports indicate that upregulation of PTP-1B may be involved in the pathogenesis of both obesity and type 2 diabetes by blocking the insulin cascade signal transduction in vivo (10,11). Given the key role of PTP-1B, we hypothesized that variations in the human PTP-1B gene modulate insulin sensitivity and/or insulin secretion and predispose to type 2 diabetes. Because the genomic characterization of the human PTP-1B was only recently published (12), we analyzed the coding region of the PTP-1B gene for mutations potentially involved in the pathogenesis of type 2 diabetes in muscle cDNA from 56 insulin-resistant type 2 diabetic subjects and adipose tissue cDNA from 56 obese subjects.


    RESEARCH DESIGN AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Study groups.
The primary mutation analysis was performed on cDNA derived from muscle biopsies from 56 unrelated insulin-resistant type 2 diabetic patients as previously described (13) and on cDNA derived from subcutaneous fat biopsies from 56 unrelated obese patients (age 42.5 ± 11.7 years and BMI 43.2 ± 6.1 kg/m2). The association studies of the G381S, P387L, and 3'UTR+104insG variants were performed using 527 unrelated type 2 diabetic patients (58% men and 42% women), who were recruited from the outpatient clinic at Steno Diabetes Center. The mean age of the patients was 60.0 ± 11.0 years, and their mean BMI was 29.0 ± 5.0 kg/m2. Twenty-eight percent of the patients were treated with diet, 57% with an oral hypoglycemic agent, and 15% with insulin. The association studies also comprised 542 unrelated age-matched glucose-tolerant control subjects (49% men and 51% women) who were traced in the central population register and living in the same area of Copenhagen as the type 2 diabetic patients examined at Steno Diabetes Center (n = 240) (14) and in the Copenhagen County Center of Preventive Medicine during 1994–1997 (n = 302) (15). The control subjects had a mean age of 56 ± 10 years and a mean BMI of 25 ± 8 kg/m2. All participants underwent a 75-g oral glucose tolerance test. Diabetes was diagnosed in accordance to the 1985 World Health Organization criteria (16). Only normal glucose-tolerant subjects were used in the association study, and all study participants were Danish Caucasians by self-report. The studies were approved by the Ethics Committee of Copenhagen (KA-96008) and were carried out in accordance with Helsinki Declaration II. Before participating in the study, informed consent was obtained from all subjects.

Biochemical assays.
Blood samples for measurement of serum levels of insulin, total cholesterol, HDL cholesterol, triglycerides, and plasma glucose were drawn after a 12-h overnight fast. Serum triglycerides, total serum cholesterol, serum HDL cholesterol, and serum LDL cholesterol were analyzed using enzymatic colorimetric methods (GPO-PAP and CHOD-PAP; Boehringer Mannheim, Mannheim, Germany). The plasma glucose concentration was analyzed by a glucose oxidase method (Granutest; Merck, Darmstadt, Germany); serum-specific insulin, excluding des(31,32) and intact proinsulin, was measured by enzyme-linked immunosorbent assay (Dako insulin kit K6219; Dako Diagnostics, Ely, U.K.). HbA1c was measured by ion-exchange high-performance liquid chromatography (nondiabetic reference range: 4.1–6.4%).

Mutation analyses.
We conducted a primary mutation analysis on cDNA prepared from total RNA extracted from 56 biopsies from the vastus lateralis muscle and 56 subcutaneous fat biopsies according to standard procedures as previously described (13,17). The PTP-1B cDNA was amplified by a primary polymerase chain reaction (PCR) segment covering parts of the 5' and 3' untranslated region and the coding region (primers are listed in Table 1 according to sequence published by Chernoff et al. [18] [GenBank accession no. M31724]). Secondary PCRs were performed with incorporation of [{alpha}-32P]dCTP on 2 µl of the primary PCR in a total reaction volume of 25 µl. In this way, the primary PCR was reamplified in seven overlapping secondary PCR segments ranging in size from 267 to 313 bp (primers listed in Table 1). All PCRs were performed in 25-µl reaction volumes containing 1 x PCR buffer, 0.2 µmol/l of each primer, 0.2 mmol/l dNTP, 10 mCi/ml [{alpha}-32P]dCTP, 0.3 units AmpliTaq DNA polymerase (Perkin Elmer, Forster City, CA), and 1.5 mmol/l MgCl2. The cycling program was a denaturation step at 95°C for 2 min followed by 95°C for 30 s, annealing for 30 s (annealing temperature for each primer set is given in Table 1), 72°C elongation for 30 s in 35 cycles, and finally an extension at 72°C for 9 min (except for the primary PCR, which was elongated for 2 min using a GeneAMp 9600 thermal cycler [Perkin Elmer]). The secondary PCR samples were analyzed by single-strand conformational polymorphism (SSCP) and heteroduplex analysis, applying two different experimental conditions as previously reported (19). The variants identified were sequenced on both strands using an ABI377 automated sequencer (Perkin Elmer) or by dideoxysequencing using the Thermo Sequenase cycle sequencing kit (USB, Cleveland, OH). All variants identified were confirmed on genomic DNA.


View this table:
[in this window]
[in a new window]
 
TABLE 1 Nucleotide sequences of primers used for PCR amplification of the PTP-1B cDNA segments for SSCP-heteroduplex gel analyses and sequencing of variants

 
Genotyping.
Genotyping of the P387L variant was carried out by PCR amplification of a 327-bp segment covering exon 9 on genomic DNA using the primers (5'-3'sense primer) CATCTCTGCCCTCTGATTCC and (5'-3' antisense primer) TGAGACTGGCTCAGATGCAC (Tanneal 60°C and 2.0 mmol/l MgCl2). The mutation removes a Bsl I restriction enzyme site at position 101 in the segment. An additional control site is present at position 290 in the segment. Thus, enzyme digestion of PCR segments from wild-type carriers will produce three fragments: 37, 101, and 189 bp, whereas homozygous mutant carriers will produce only the 37-bp fragment and a 290-bp fragment. Heterozygous carriers will contain all fragments. Screening is performed by adding 5 units of Bsl I enzyme (New England Biolabs, Beverly, MA) into 20 µl of amplified PCR product, and after 4 h incubation at 55°C, products are loaded onto 3% agarose gels and visualized by staining with ethidium bromide.

Genotyping of the G381S variant was carried out by PCR amplification of a segment covering exon 9 on genomic DNA using the primers (5'-3'sense primer) TACCCATCTCTGCCCTCT and (5'-3' antisense primer) GGTAGGATTCAGTTCTGTG (Tanneal 56°C and MgCl2 1.5 mmol/l) and PCR-SSCP and heteroduplex analysis. Genotyping of the 3'UTR+104insG variant was carried out by PCR amplification of a segment covering exon 10 and part of the 3'UTR region using the primers (5'-3' sense primer) GTCTGGGCTCATCTGAACTGT and (5'-3' antisense primer) GGACGGACGTTGGTTCTG (Tanneal 58°C and MgCl2 1.5 mmol/l) and by PCR-SSCP and heteroduplex analysis. SSCP genotyping revealed two intronic variants as described in RESULTS.

Statistical analysis.
Fisher’s exact test was applied to test for differences in allele and genotype frequencies. P < 0.05 was considered significant. SPSS software for windows (version 10.0) was used to carry out descriptive analysis and analysis using a generalized linear model. The analysis included age and BMI as covariate and sex and genotype as a fixed factor. The normal distribution of the residuals was visually verified. The odds ratios from the case-control study were calculated using logistic regression while controlling for age. For comparison of the quantification of the radioactive incorporation into peptides, a two-tailed distribution paired Student’s t test was used on the log10-transformed data set from each of four independent assays. The values are expressed as means ± SD.

In vitro peptide phosphorylation assay.
Incorporation of [{gamma}-32P]ATP into wild-type peptide (RRRGAQAASPAKGE: 387P) and mutant peptide (RRRGAQAASLAKGE: 387L) by the p34 cell division cycle (p34cdc2) kinase was performed in a final reaction mixture containing 50 µl of 1 mmol/l of wild-type (387P) or mutant peptide (387L), 100 µmol/l ATP at a final specific activity of 100 µCi/µmol [{gamma}-32P]ATP (Amersham Pharmacia Biotech), and reaction buffer containing 50 mmol/l Tris-HCl, 10 mmol/l MgCl2, 2 mmol/l dithiothreitol, 1 mmol/l EGTA, 0.01% Brij 35, pH 7.5, and 0.272 units recombinant p34cdc2 protein kinase (New England Biolabs). The peptides were synthesized using Fmoc chemistry, and the resin-cleaved peptides were analyzed by mass spectral analysis (MALDI/TOF; Research Genetics, Invitrogen, Huntsville, AL). For negative and positive controls, a 0.33-µg/µl concentration of myelin basic protein (MBP; Sigma) was used in the final 50-µl reaction. The substrate and reaction mixtures were heated separately at 30°C for 1 min before mixing and then incubated at 30°C for 30 min. The reaction was stopped by the addition of 50 µl of 2 x Tricine SDS sample buffer (cat. no. LC1676; Novex, San Diego, CA) and 2.5% of 2-mercaptoethanol. The samples were subsequently heated for 2 min at 85°C, and then 25 µl of each sample was applied on a 16% tricine gel (Novex) and electrophoresed for 2 h at 110 V. The tricine gels were silver-stained to ensure peptide location using the protein silver stain kit PlusOne (Amersham Pharmacia Biotech). After gel exposure to phosphoimager screens, the radioactivity of the peptides was quantified by scanning in a Typhoon 8600 (Molecular Dynamics, Amersham Pharmacia Biotech). Quantification of the incorporation of [{gamma}-32P]ATP into wild-type and mutant peptide was examined in four independent assays (Fig. 1) using Image Quant 5.1 software (Molecular Dynamics, Amersham Pharmacia Biotech). The wild type from each assay was standardized to 100%, and the mutant was counted as a percentage of the wild type. SD is calculated from the log10-transformed data set (Fig. 2).



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 1. In vitro peptide serine phosphorylation by p34cdc2 protein kinase. Equal amounts of wild-type and mutant peptide were loaded. Visualized are radioactive incorporation into wild-type (387P) and mutant (387L) peptide after gel exposure to a phosphoimager screen. Twenty-five µl 387P reactions (lanes 1-3); 15 µl BenchMark protein marker (lane 4); 25 µl 387L reactions (lanes 5–7); 25 µl MBP (lane 8; positive control); and 25 µl reaction mixture without p34cdc2 kinase added and with MBP as substrate (lane 9; negative control).

 


View larger version (12K):
[in this window]
[in a new window]
 
FIG. 2. Percentage incorporation of [{gamma}-32P]ATP by the p32cdc2 kinase into wild-type peptides (RRRGAQAASPAKGE: 387P) and mutant peptides (RRRGAQAASLAKGE: 387L). The figure represents a mean of four independent in vitro peptide phosphorylation assays quantified and corrected for background using ImageQuant 5.1 software. The wild type from each assay is 100%, and the mutant is counted as a percentage of the wild type, 387P = 100% and 387L = 28.4% ± 5.8. SD is calculated from the log10-transformed data set. *P = 0.0012.

 

    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mutation analysis of the PTP-1B gene.
Primary analysis of the coding region of the PTP-1B gene, including the 5'-UTR from position -42 before translation start site and the 3'UTR to position +138 after the stop codon, revealed five variants. There were four silent variants, (NT CGA->CGG) R199R, (NT CCC->CCT) P303P, 3'UTR+104insG (insertion variant), and 3'UTR+86T->G (transversion variant), and one missense variant (NT CCA->CTA) P387L. Furthermore, during SSCP genotyping on genomic DNA using intronic primers, two missense variants, (NT GGT->AGT) G381S and (NT ACG->ATG) T420M, and two single-intron variants, IVS9+57C->T and IVS9+58G->A, were found. The T420M, 3'UTR+86T->G, IVS9+57C->T, and IVS9+58G->A variants were only found in one case each.

Association studies of the missense variants G381S and P387L and the insertion variant 3'UTR+104insG in type 2 diabetes.
The prevalence of the G381S, P387L, and 3'UTR+104insG variants were further evaluated in a case-control study of type 2 diabetic patients and matched glucose-tolerant control subjects. As presented in Table 2, the allelic frequency of the G381S variant was 0.4% in type 2 diabetic patients and 1.1% in control subjects (P = 0.143). The allelic frequency of the 3'UTR+104insG insertion variant was 6.9% among type 2 diabetic patients and 10.2% among control subjects (P = 0.20) (Table 2). The observed genotype frequencies of these variants were in Hardy-Weinberg equilibrium. Furthermore, the 3'UTR+104insG variant was not found to be associated with BMI, fasting serum insulin, or fasting plasma glucose among control subjects (data not shown).


View this table:
[in this window]
[in a new window]
 
TABLE 2 Genotype and allele frequencies of the G381S, P387L, and 3'UTR+104insG variants in PTP-1B and allelic frequencies in type 2 diabetic patients and glucose-tolerant control subjects

 
The allelic frequency of the P387L variant was 1.4% (95% CI 0.4–2.4) among 527 type 2 diabetic patients and 0.5 (-0.1 to 1.1) among 542 glucose-tolerant control subjects. Thus, the P387L variant was significantly associated with type 2 diabetes (P = 0.037) (Table 2), with carriers having an age-corrected relative risk of type 2 diabetes of 3.7 (1.26–10.93, P = 0.02). When comparing heterozygous carriers of the P387L variant with the remaining group of wild-type carriers, the phenotypical and biochemical characteristics were not significantly different between the two groups (Table 3).


View this table:
[in this window]
[in a new window]
 
TABLE 3 Clinical and biochemical characteristics of type 2 diabetic patients and age-matched glucose-tolerant control subjects classified according to genotype of the P387L variant of the PTP-1B gene

 
In vitro peptide phosphorylation assay.
The P387L variant is situated next to a serine residue that is a target of the proline-directed p34cdc2 protein kinase. We investigated the incorporation of [{gamma}-32P]-labeled radioactivity into wild-type peptide (387P) versus mutant peptide (387L) in an in vitro kinase assay (Fig. 1). The assay results showed significantly lower p34cdc2 kinase proline–directed phosphorylation of the mutant compared with the wild-type peptides (387P: 100% vs. 387L: 28.4 ± 5.8%; P = 0.0012) (Fig. 2).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Considering the crucial role of PTP-1B in regulating insulin signaling and the clear physiological effect on insulin-stimulated glucose uptake associated with the lack of PTP-1B in mice, PTP-1B is a credible candidate to be involved in the assumed polygenic basis of type 2 diabetes in humans. In addition, PTP-1B is located on the chromosomal region 20q13.1–13.2 on the long arm of chromosome 20, which has been linked to quantitative trait loci for obesity and fasting serum insulin levels (20) as well as type 2 diabetes (21). In the present study, we have identified a rare P387L variant of the PTP-1B gene that is associated with type 2 diabetes in the Danish population and with impaired in vitro serine phosphorylation of a PTP-1B peptide. We found that the variant has an almost three times higher prevalence among type 2 diabetic patients, conferring an effective relative risk of 3.7 for carriers of this variant.

The proline at position 387 in the COOH-terminal regulatory region of the protein is conserved between mouse, rat, and humans and, in the human sequence, is located next to a serine residue (position 386). It is part of a consensus sequence known to be phosphorylated in vitro by the proline-directed kinase p34cdc2 (22,23), in vivo in states of mitosis (24,25) and, perhaps more importantly, in response to various stress stimuli (26). Replacing the proline by a leucine reduced the phosphorylation of the serine by 70% in our in vitro studies of the relevant peptide. Testing the replacement on the NetPhos 2.0 Phosphorylation Prediction database further confirmed that the predicted likelihood of serine 386 being a phosphorylation target was reduced from 0.884 to 0.135 (range from 0 to 1.0) when replacing proline 387 with leucine (27).

Because a lack of PTP-1B is associated with increased insulin sensitivity, a PTP-1B variant associated with type 2 diabetes would be hypothesized to cause increased PTP-1B levels and phosphatase activity. However, the direct consequences on enzyme function of the P387L variant is still unclear, and Ser386 phosphorylation can be associated with both increased (24) as well as decreased (25) PTP-1B enzymatic activity. Moreover, human studies have also shown conflicting results in relating PTP-1B mRNA levels and phosphatase activity to insulin sensitivity and obesity (10,28,29,30,31), and in vitro studies suggest that the expression levels of PTPases may not be the primary determinant of their insulin receptor phosphorylation activity (32), indicating that other factors may regulate PTPase activity. This is also suggested by the surprising localization of the PTP-1B to the endoplasmic reticulum by a COOH-terminal motif (7). Therefore, it is likely that the in vivo action of the PTP-1B protein is regulated by both the phosphorylation status as well as by restricted accessibility to intracellular substrates, and it might be hypothesized that the P387L variant and potentially the phosphorylation status at position Ser386 may affect the activity or localization of the protein. Thus, a recent study has shown that increased phosphoserine content of PTP-1B in vivo was followed by increased PTP-1B activity and indicated that insulin and protein kinase A have a critical role in the regulation of PTP-1B (33). However, the mechanisms of COOH-terminal PTP-1B regulation have not been fully elucidated, and further studies are needed to evaluate the functional consequences of the P387L variant.

The search for variability in the human PTP-1B gene also identified several additional variants, of which only the silent variant P303P has been previously identified and reported to have no association with type 2 diabetes (34). The association study of the missense variant G381S and the insertion variant 3'UTR+104insG showed no significant association with type 2 diabetes, although the 3'UTR+104insG variant shows a trend toward an association. These findings need to be tested in larger association studies.

In conclusion, we identified a rare P387L variant in the PTP-1B gene that was associated with type 2 diabetes in the examined Danish population. The variant peptide exhibited reduced in vitro serine phosphorylation. Testing for association of the variant to diabetes in other populations as well as further studies of the effect of the variant on PTP-1B function are needed.


    ACKNOWLEDGMENTS
 
The present study was supported in by the Poul and Erna Sehested-Hansen Foundation, the Danish Council for Health Science ("Growth and Regeneration"), the Danish Diabetes Association, the Danish Medical Research Council (grant nos. 9900810 and 9902592), the Velux Foundation, the Danish Heart Foundation, and the EEC (grants BMH4-CT98-3084 and QLRT-CT-1999-00546).

The authors thank Helle Fjordvang, Annemette Forman, Lene Aabo, Inge Lise Wantzin, and Christina B.P. Søholm for dedicated and careful technical assistance, Søren N. Jacobsen (Novo Nordisk, Bagsvaerd, Denmark) for helpful advice on the kinase assay, Bendix Carstensen for statistical assistance, and Grete Lademann for secretarial support.


    FOOTNOTES
 
Address correspondence and reprint requests to Søren M. Echwald, PhD, Steno Diabetes Center and Hagedorn Research Institute, Niels Steensens vej 6, DK-2820 Gentofte, Denmark. E-mail: sme{at}hagedorn.dk.

Received for publication 20 April 2001 and accepted in revised form 31 October 2001. Posted on the World Wide Web at http://www.diabetes.org/diabetes_rapids on 11 December 2001.

IRS, insulin receptor substrate; p34cdc2 , p34 cell division cycle; MBP, myelin basic protein; PCR, polymerase chain reaction; PTP-1B, protein tyrosine phosphatase-1B; SSCP, single-strand conformation polymorphism.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Kahn CR, Vicent D, Doria A: Genetics of non-insulin-dependent (type 2) diabetes mellitus. Annu Rev Med 47:509–531, 1996[Medline]
  2. DeFronzo RA: Pathogenesis of type 2 diabetes: metabolic and molecular implications for identifying diabetes genes. Diabetes Rev 5:177–269, 1997
  3. Shepherd PR, Kahn BB: Glucose transporters and insulin action: implications for insulin resistance and diabetes mellitus. N Engl J Med 341:248–257, 1999[Free Full Text]
  4. Elchebly M, Cheng A, Tremblay ML: Modulation of insulin signaling by protein tyrosine phosphatases. J Mol Med 78:473–482, 2000[Medline]
  5. Seely BL, Staubs PA, Reichart DR, Berhanu P, Milarski KL, Saltiel AR, Kusari J, Olefsky JM: Protein tyrosine phosphatase 1B interacts with the activated insulin receptor. Diabetes 45:1379–1385, 1996[Abstract]
  6. Goldstein BJ, Bittner-Kowalczyk A, White MF, Harbeck M: Tyrosine dephosphorylation and deactivation of insulin receptor substrate-1 by protein-tyrosine phosphatase 1B: possible facilitation by the formation of a ternary complex with the Grb2 adaptor protein. J Biol Chem 275:4283–4289, 2000[Abstract/Free Full Text]
  7. Frangioni JV, Beahm PH, Shifrin V, Jost CA, Neel BG: The nontransmembrane tyrosine phosphatase PTP-1B localizes to the endoplasmic reticulum via its 35 amino acid C-terminal sequence. Cell 68:545–560, 1992[Medline]
  8. Elchebly M, Payette P, Michaliszyn E, Cromlish W, Collins S, Lee-Loy A, Normandin D, Cheng A, Himms-Hagen J, Chan C, Ramachandran C, Gresser MJ, Tremblay ML, Kennedy BP: Increased insulin sensitivity and obesity resistance in mice lacking the protein tyrosine phosphatase-1B gene. Science 283:1544–1548, 1999[Abstract/Free Full Text]
  9. Klaman LD, Boss O, Peroni OD, Kim JK, Martino JL, Zabolotny JM, Moghal N, Lubkin M, Kim YB, Sharpe AH, Stricker-Krongrad A, Shulman GI, Neel BG, Kahn BB: Increased energy expenditure, decreased adiposity, and tissue-specific insulin sensitivity in protein-tyrosine phosphatase 1B-deficient mice. Mol Cell Biol 20:5479–5489, 2000[Abstract/Free Full Text]
  10. Ahmad F, Azevedo JL, Cortright R, Dohm GL, Goldstein BJ: Alterations in skeletal muscle protein-tyrosine phosphatase activity and expression in insulin-resistant human obesity and diabetes. J Clin Invest 100:449–458, 1997[Medline]
  11. Dadke SS, Li HC, Kusari AB, Begum N, Kusari J: Elevated expression and activity of protein-tyrosine phosphatase 1B in skeletal muscle of insulin-resistant type II diabetic Goto-Kakizaki rats. Biochem Biophys Res Commun 274:583–589, 2000[Medline]
  12. Forsell PKAL, Boie Y, Montalibet J, Collins S, Kennedy BP: Genomic characterization of the human and mouse protein tyrosine phosphatase-1B genes. Gene 260:145–153, 2000[Medline]
  13. Hansen L, Hansen T, Vestergaard H, Bjorbaek C, Echwald SM, Clausen JO, Chen YH, Chen MX, Cohen PT, Pedersen O: A widespread amino acid polymorphism at codon 905 of the glycogen-associated regulatory subunit of protein phosphatase-1 is associated with insulin resistance and hypersecretion of insulin. Hum Mol Genet 4:1313–1320, 1995[Abstract/Free Full Text]
  14. Urhammer SA, Fridberg M, Hansen T, Rasmussen SK, Moller AM, Clausen JO, Pedersen O: A prevalent amino-acid polymorphism at codon-98 in the hepatocyte nuclear factor-1-alpha gene is associated with reduced serum C-peptide and insulin responses to an oral glucose challenge. Diabetes 46:912–916, 1997[Abstract]
  15. Drivsholm T, Ibsen H, Schroll M, Davidsen M, Borch-Johnsen K: Increasing prevalence of diabetes mellitus and impaired glucose tolerance among 60-year-old Danes. Diabet Med 18 126–132, 2001
  16. World Health Organization: Diabetes Mellitus: Report of a WHO Study Group. Geneva, World Health Org., 1985 (Tech. Rep. Ser., no. 727)
  17. Pedersen SB, Børglum J, Jørgensen JO, Richelsen B: Growth hormone treatment of obese premenopausal women: effects on isolated adipocyte metabolism. Endocrin and Metab 2:251–258, 1995
  18. Chernoff J, Schievella AR, Jost CA, Erikson RL, Neel BG: Cloning of a cDNA for a major human protein-tyrosine-phosphatase. Proc Natl Acad Sci U S A 87:2735–2739, 1990[Abstract/Free Full Text]
  19. Echwald SM, Sorensen TD, Sorensen TI, Tybjaerg-Hansen A, Andersen T, Chung WK, Leibel RL, Pedersen O: Amino acid variants in the human leptin receptor: lack of association to juvenile onset obesity. Biochem Biophys Res Commun 233:248–252, 1997[Medline]
  20. Lembertas AV, Perusse L, Chagnon YC, Fisler JS, Warden CH, Purcell-Huynh DA, Dionne FT, Gagnon J, Nadeau A, Lusis AJ, Bouchard C: Identification of an obesity quantitative trait locus on mouse chromosome 2 and evidence of linkage to body fat and insulin on the human homologous region 20q. J Clin Invest 100:1240–1247, 1997[Medline]
  21. Ghosh S, Watanabe RM, Valle TT, Hauser ER, Magnuson VL, Langefeld CD, Ally DS, Mohlke KL, Silander K, Kohtamaki K, Chines P, Balow JJ, Birznieks G, Chang J, Eldridge W, Erdos MR, Karanjawala ZE, Knapp JI, Kudelko K, Martin C, Morales-Mena A, Musick A, Musick T, Pfahl C, Porter R, Rayman JB: The Finland-United States investigation of non-insulin-dependent diabetes mellitus genetics (FUSION) study. I. An autosomal genome scan for genes that predispose to type 2 diabetes. Am J Hum Genet 67:1174–1185, 2000[Medline]
  22. Moreno S, Nurse P: Substrates for p34cdc2: in vivo veritas? Cell 61:549–551, 1990[Medline]
  23. Kamijo M, Yasuda H, Yau PM, Yamashita M, Nagahama Y, Ohba Y: Preference of human cdc2 kinase for peptide substrate. Pept Res 5:281–285, 1992[Medline]
  24. Schievella AR, Paige LA, Johnson KA, Hill DE, Erikson RL: Protein tyrosine phosphatase 1B undergoes mitosis-specific phosphorylation on serine. Cell Growth Differ 4:239–246, 1993[Abstract]
  25. Flint AJ, Gebbink MF, Franza BR, Hill DE, Tonks NK: Multi-site phosphorylation of the protein tyrosine phosphatase, PTP1B: identification of cell cycle regulated and phorbol ester stimulated sites of phosphorylation. EMBO J 12:1937–1946, 1993[Medline]
  26. Shifrin VI, Davis RJ, Neel BG: Phosphorylation of protein-tyrosine phosphatase PTP-1B on identical sites suggests activation of a common signaling pathway during mitosis and stress response in mammalian cells. J Biol Chem 272:2957–2962, 1997[Abstract/Free Full Text]
  27. Blom N, Gammeltoft S, Brunak S: Sequence and structure-based prediction of eukaryotic protein phosphorylation sites. J Mol Biol 294:1351–1362, 1999[Medline]
  28. McGuire MC, Fields RM, Nyomba BL, Raz I, Bogardus C, Tonks NK, Sommercorn J: Abnormal regulation of protein tyrosine phosphatase activities in skeletal muscle of insulin-resistant humans. Diabetes 40:939–942, 1991[Abstract]
  29. Kusari J, Kenner KA, Suh KI, Hill DE, Henry RR: Skeletal muscle protein tyrosine phosphatase activity and tyrosine phosphatase 1B protein content are associated with insulin action and resistance. J Clin Invest 93:1156–1162, 1994
  30. Worm D, Vinten J, Staehr P, Henriksen JE, Handberg A, Beck-Nielsen H: Altered basal and insulin-stimulated phosphotyrosine phosphatase (PTPase) activity in skeletal muscle from NIDDM patients compared with control subjects. Diabetologia 39:1208–1214, 1996[Medline]
  31. Cheung A, Kusari J, Jansen D, Bandyopadhyay D, Kusari A, Bryer-Ash M: Marked impairment of protein tyrosine phosphatase 1B activity in adipose tissue of obese subjects with and without type 2 diabetes mellitus. J Lab Clin Med 134:115–123, 1999[Medline]
  32. Bleyle LA, Peng Y, Ellis C, Mooney RA: Dissociation of PTPase levels from their modulation of insulin receptor signal transduction. Cell Signal 11:719–725, 1999[Medline]
  33. Tao J, Malbon CC, Wang H: Insulin stimulates tyrosine phosphorylation and inactivation of protein tyrosine phosphatase 1B in vivo. J Biol Chem276:29520–29525, 2001
  34. Klupa T, Nam M, Antonellis A, Pezzolesi M, Ji L, Malecki MT, Krolewski AS: Examination of 3 candidate genes on 20q13.1, a region linked with type 2 diabetes (Abstract). Diabetes 49 (Suppl. 1):A201, 2000

Add to CiteULike CiteULike   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Clin. Chem.Home page
R. Meshkani, M. Taghikhani, H. Al-Kateb, B. Larijani, S. Khatami, G. K. Sidiropoulos, R. A. Hegele, and K. Adeli
Polymorphisms within the Protein Tyrosine Phosphatase 1B (PTPN1) Gene Promoter: Functional Characterization and Association with Type 2 Diabetes and Related Metabolic Traits
Clin. Chem., September 1, 2007; 53(9): 1585 - 1592.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Uchida, N. Iwashita, M. Ohara-Imaizumi, T. Ogihara, S. Nagai, J. B. Choi, Y. Tamura, N. Tada, R. Kawamori, K. I. Nakayama, et al.
Protein Kinase C{delta} Plays a Non-redundant Role in Insulin Secretion in Pancreatic beta Cells
J. Biol. Chem., January 26, 2007; 282(4): 2707 - 2716.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
K. P. Burdon, J. L. Bento, C. D. Langefeld, J. K. Campbell, J. J. Carr, L. M. Wagenknecht, D. M. Herrington, B. I. Freedman, S. S. Rich, and D. W. Bowden
Association of Protein Tyrosine Phosphatase-N1 Polymorphisms With Coronary Calcified Plaque in the Diabetes Heart Study
Diabetes, March 1, 2006; 55(3): 651 - 658.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
N. J. Spencer-Jones, X. Wang, H. Snieder, T. D. Spector, N. D. Carter, and S. D. O'Dell
Protein Tyrosine Phosphatase-1B Gene PTPN1: Selection of Tagging Single Nucleotide Polymorphisms and Association With Body Fat, Insulin Sensitivity, and the Metabolic Syndrome in a Normal Female Population
Diabetes, November 1, 2005; 54(11): 3296 - 3304.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
A. Sharma, S. Chavali, A. Mahajan, R. Tabassum, V. Banerjee, N. Tandon, and D. Bharadwaj
Genetic Association, Post-translational Modification, and Protein-Protein Interactions in Type 2 Diabetes Mellitus
Mol. Cell. Proteomics, August 1, 2005; 4(8): 1029 - 1037.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
J. C. Florez, C. M. Agapakis, N. P. Burtt, M. Sun, P. Almgren, L. Rastam, T. Tuomi, D. Gaudet, T. J. Hudson, M. J. Daly, et al.
Association Testing of the Protein Tyrosine Phosphatase 1B Gene (PTPN1) With Type 2 Diabetes in 7,883 People
Diabetes, June 1, 2005; 54(6): 1884 - 1891.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
W. Qiu, R. K. Avramoglu, N. Dube, T. M. Chong, M. Naples, C. Au, K. G. Sidiropoulos, G. F. Lewis, J. S. Cohn, M. L. Tremblay, et al.
Hepatic PTP-1B Expression Regulates the Assembly and Secretion of Apolipoprotein B-Containing Lipoproteins: Evidence From Protein Tyrosine Phosphatase-1B Overexpression, Knockout, and RNAi Studies
Diabetes, December 1, 2004; 53(12): 3057 - 3066.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
J. L. Bento, N. D. Palmer, J. C. Mychaleckyj, L. A. Lange, C. D. Langefeld, S. S. Rich, B. I. Freedman, and D. W. Bowden
Association of Protein Tyrosine Phosphatase 1B Gene Polymorphisms With Type 2 Diabetes
Diabetes, November 1, 2004; 53(11): 3007 - 3012.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
N. D. Palmer, J. L. Bento, J. C. Mychaleckyj, C. D. Langefeld, J. K. Campbell, J. M. Norris, S. M. Haffner, R. N. Bergman, and D. W. Bowden
Association of Protein Tyrosine Phosphatase 1B Gene Polymorphisms With Measures of Glucose Homeostasis in Hispanic Americans: The Insulin Resistance Atherosclerosis Study (IRAS) Family Study
Diabetes, November 1, 2004; 53(11): 3013 - 3019.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
S. De Cosmo, A. Marucci, E. Ciociola, R. Di Paola, L. Pucci, G. Penno, S. Del Prato, G. P. Piras, R. Trevisan, S. Giunti, et al.
Lack of evidence for the 1484insG variant at the 3'-UTR of the protein tyrosine phosphatase 1B (PTP1B) gene as a genetic determinant of diabetic nephropathy development in type 1 diabetic patients
Nephrol. Dial. Transplant., September 1, 2004; 19(9): 2419 - 2420.
[Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. Olivier, C. A. Hsiung, L.-M. Chuang, L.-T. Ho, C.-T. Ting, V. I. Bustos, T. M. Lee, A. de Witte, Y.-D. I. Chen, R. Olshen, et al.
Single nucleotide polymorphisms in protein tyrosine phosphatase 1{beta} (PTPN1) are associated with essential hypertension and obesity
Hum. Mol. Genet., September 1, 2004; 13(17): 1885 - 1892.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Zabolotny, F. G. Haj, Y.-B. Kim, H.-J. Kim, G. I. Shulman, J. K. Kim, B. G. Neel, and B. B. Kahn
Transgenic Overexpression of Protein-tyrosine Phosphatase 1B in Muscle Causes Insulin Resistance, but Overexpression with Leukocyte Antigen-related Phosphatase Does Not Additively Impair Insulin Action
J. Biol. Chem., June 4, 2004; 279(23): 24844 - 24851.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
J. N. ANDERSEN, P. G. JANSEN, S. M. ECHWALD, O. H. MORTENSEN, T. FUKADA, R. DEL VECCHIO, N. K. TONKS, and N. P. H. MOLLER
A genomic perspective on protein tyrosine phosphatases: gene structure, pseudogenes, and genetic disease linkage
FASEB J, January 1, 2004; 18(1): 8 - 30.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
J. Weng, J. Yan, Z. Huang, Y. Sui, and L. Xiu
Missense Mutation of Pro387Leu in Protein Tyrosine Phosphatase-1B (PTP-1B) Is Not Associated With Type 2 Diabetes in a Chinese Han Population
Diabetes Care, October 1, 2003; 26(10): 2957 - 2957.
[Full Text] [PDF]


Home page
DiabetesHome page
G. Andersen, C. S. Rose, Y. H. Hamid, T. Drivsholm, K. Borch-Johnsen, T. Hansen, and O. Pedersen
Genetic Variation of the GLUT10 Glucose Transporter (SLC2A10) and Relationships to Type 2 Diabetes and Intermediary Traits
Diabetes, September 1, 2003; 52(9): 2445 - 2448.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. Asante-Appiah and B. P. Kennedy
Protein tyrosine phosphatases: the quest for negative regulators of insulin action
Am J Physiol Endocrinol Metab, April 1, 2003; 284(4): E663 - E670.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
M. Peppa, T. Goldberg, W. Cai, E. Rayfield, and H. Vlassara
Glycotoxins: A Missing Link in the "Relationship of Dietary Fat and Meat Intake in Relation to Risk of Type 2 Diabetes in Men"
Diabetes Care, October 1, 2002; 25(10): 1898 - 1899.
[Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
50.01.02.db01-0280v1
51/1/1    most recent
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Echwald, S. M.
Right arrow Articles by Pedersen, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Echwald, S. M.
Right arrow Articles by Pedersen, O.
Social Bookmarking
 Add to CiteULike