Diabetes
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Tables
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mentuccia, D.
Right arrow Articles by Celi, F. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mentuccia, D.
Right arrow Articles by Celi, F. S.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
Diabetes 51:880-883, 2002
© 2002 by the American Diabetes Association, Inc.


Brief Genetics Reports

Association Between a Novel Variant of the Human Type 2 Deiodinase Gene Thr92Ala and Insulin Resistance

Evidence of Interaction With the Trp64Arg Variant of the ß-3-Adrenergic Receptor

Daniela Mentuccia1,2, Laura Proietti-Pannunzi3, Keith Tanner1, Vincenzo Bacci4, Toni I. Pollin1, Eric T. Poehlman5, Alan R. Shuldiner1,6, and Francesco S. Celi3

1 Division of Endocrinology, Diabetes and Nutrition, Department of Medicine, University of Maryland, Baltimore, Maryland
2 Graduate Program in Endocrinology, University of Rome "Tor Vergata," Rome, Italy
3 Department of Experimental Medicine and Pathology, University of Rome "La Sapienza," Rome, Italy
4 Division of Nutrition, University of Rome "La Sapienza, Rome, Italy
5 Department of Nutrition, University of Montreal, Montreal, Canada
6 Baltimore Veterans Administration Geriatric Research and Education Clinical Center, Baltimore, Maryland


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 REFERENCES
 
Thyroid hormone action is an important determinant of energy and glucose metabolism. T4 metabolism is regulated by the deiodinases of which type 2 is expressed in humans in skeletal muscle and brown adipose tissue, where its transcription is stimulated by the ß-3 adrenergic pathway. We performed molecular scanning of the human type 2 deiodinase (DIO2) gene and evaluated a novel variant for associations with obesity and insulin resistance, assessing both the main effect and interaction with the Trp64Arg ß-3–adrenergic receptor (ADRB3) variant. Molecular scanning of DIO2 in 50 obese Caucasians demonstrated a Thr92Ala variant. Association studies in 972 nondiabetic patients, 135 of whom underwent euglycemic-hyperinsulinemic clamps, showed that subjects with the Thr92Ala variant had lower glucose disposal rate (0.54 ± 0.02 mg · min-1 · kg-1 fat-free mass Ala92 homozygotes vs. 0.44 ± 0.02 Ala92 heterozygotes vs. 0.42 ± 0.04 Thr92 homozygotes, P = 0.0088). Association analysis of the entire group showed significant evidence for a synergistic effect between the Thr92Ala DIO2 and Trp64Arg ADRB3 variants on BMI (both variants 34.3 ± 0.9 kg/m2 vs. neither variant 33.1 ± 0.4 kg/m2, P = 0.04 for interaction). To our knowledge, Thr92Ala is the first description of a missense mutation of DIO2. This variant strongly associates with insulin resistance and, in subjects with the Trp64Arg ADRB3 variant, an increased BMI, suggesting an interaction between these two common gene variants.



    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 REFERENCES
 
The cluster of obesity, hypertension, insulin resistance, and glucose intolerance/diabetes (Syndrome X) is a polygenic multifactorial condition in which the phenotype is the net result of the interaction between environmental factors and genetic predisposition deriving from variations in genes encoding proteins involved in metabolic pathways (1). In fact, polymorphisms in several candidate genes, such as the ß-3 adrenergic receptor (ADRB3) (2,3), insulin receptor substrate-1 (4), peroxisome proliferator–activated receptor-{gamma} (5), fatty acid binding protein-2 (6), and perhaps others, have shown association with various traits of Syndrome X.

Thyroid hormones are important elements in the regulation of metabolic rate (7,8) and, although the molecular and cell biology of this process is not yet fully understood, evidence suggests that the thyroid hormones stimulate resting metabolic rate (RMR) by increasing ATP expenditure and through the regulation of expression of uncoupling proteins in the mitochondria of fat and muscle (9). Thyroid hormone also modulates adrenergic receptor number and thus responsiveness to catecholamines, which are also regulators of metabolic rate (10). Thus, thyroid hormone action is an extremely important determinant of the maintenance of the energy homeostasis. Furthermore, thyroid hormone influences carbohydrate metabolism in skeletal muscle and adipose tissue via the positive transcriptional regulation of the muscle/fat specific GLUT4 (11,12).

The deiodinases play a key role in the maintenance of circulating and tissue levels of thyroid hormones. The pro-hormone T4 is converted in the periphery to its active form, T3, or to its inactive metabolite, reverse T3, by the action of these enzymes (13). The deiodinases are selenoenzymes characterized by a selenocysteine in the catalytic domain of the enzyme encoded by a UGA codon in the presence of a characteristic 3'untranslated region stem loop structure, the selenocysteine insertion sequence (SECIS) (14). Type 2 deiodinase appears to be a tissue-specific regulator of the intracellular T3 concentrations in brown fat, brain, and pituitary. In humans, type 2 deiodinase is also expressed in skeletal muscle (15). The type 2 deiodinase gene (DIO2) is localized on chromosome 14q24.3, and the entire gene is encoded by three exons (16). Experimental evidence demonstrates that DIO2 activity is regulated by metabolic stressors, such as cold exposure and adrenergic stimulation, via the generation of intracellular cAMP (17,18). Furthermore, the action of this enzyme provides the supply of T3 for local use by the tissue itself, thus creating a type of autoregulatory, autocrine feedback loop (19). We thus decided to study DIO2 as a candidate gene for obesity and insulin resistance in a population of morbidly obese Caucasians with normal thyroid function and to perform association studies of the gene variants in a well-characterized nondiabetic Caucasian population (Table 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1 Study population characteristics

 
By performing gene scanning of the entire coding region and the SECIS element of DIO2 with PCR–single strand conformation polymorphism (SSCP) analysis, followed by DNA sequence analysis, we identified a common nonconservative variant, 274 A->G, that predicts a nonconservative Thr92Ala substitution (Fig. 1). No other variants were observed. The allele frequency of the Thr92Ala DIO2 variant was 0.35 in the study population with a distribution meeting Hardy-Weinberg equilibrium. This variant was common in various ethnic groups, particularly in Pima Indians and Mexican-Americans with allele frequencies of 0.75 and 0.42, respectively (see online appendix at http://diabetes.diabetesjournals.org).



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 1. Thr92Ala Dio2 polymorphism. A: PCR-SSCP. B: Dydeoxy DNA sequencing. C: PCR-RFLP with Bsg-I. 1, Thr92 homozygote; 2, heterozygote; 3, Ala92 homozygote.

 
Association studies were performed in a large, well-characterized nondiabetic Caucasian population (20) recruited for energy balance studies. Hyperinsulinemic-euglycemic clamp studies were performed in a subgroup of 135 nondiabetic women. In this subgroup, there were no significant differences between genotypes in age, weight, BMI, fasting glucose levels, or RMR (Table 2). However, we observed a marked decrease in the glucose disposal rate in subjects with the Thr92Ala variant (Ala92 homozygotes 17.2 ± 1.6 mmol/min vs. Ala92 heterozygotes 18.2 ± 0.8 mmol/min vs. Thr92 homozygotes 22.6 ± 0.9 mmol/min, P = 0.0006), consistent with a dominant model (Table 2).


View this table:
[in this window]
[in a new window]
 
TABLE 2 Association of Thr92Ala DIO2 and glucose disposal euglycemic hyperinsulinemic clamp (n = 135 women)

 
A trend toward an increase of fasting insulin level was observed in carriers of the Ala92 DIO2 allele (Ala92 homozygotes 105.0 ± 18.6 pmol/l vs. heterozygotes 72.0 ± 9.6 pmol/l vs. Thr92 homozygotes 57.0 ± 10.2 pmol/l, P = 0.0814) consistent with greater insulin resistance.

In the larger group (n = 922), the Thr92Ala DIO2 polymorphism did not associate with body weight or BMI. However, significantly higher weight and BMI were observed in carriers of both the Thr92Ala DIO2 and Trp64Arg ADRB3 variants compared with subjects with neither or either variant alone, suggesting an interaction between the two (Table 3).


View this table:
[in this window]
[in a new window]
 
TABLE 3 Interaction between Thr92Ala DIO2 and Trp64Arg ADRB3

 
To our knowledge, this is the first description of a missense variant of the human DIO2 gene. Although the crystal structure of the type 2 deiodinine is not yet known, it is worth noting that this nonconservative amino acid change (aliphatic for polar group), which is not located within the conserved deiodinase catalytic domain, could potentially affect its activity (21). However, this region of the enzyme is not phylogenetically conserved. The homologous amino acid is represented by a proline in rodents and by a glycine in chick. By contrast, humans and amphibians share a threonine in this position. The functional consequences of this common missense mutation are not yet known.

Our results indicate that the DIO2 Thr92Ala variant strongly associates with insulin resistance as measured by the hyperinsulinemic-euglycemic clamp. An inactivating mutation in DIO2 could lead to decreased intracellular availability of active thyroid hormone. A reduction in T3 would, in turn, decrease the transcription of GLUT4 in insulin-sensitive tissues, such as skeletal muscle and adipose tissue, contributing to insulin resistance. On the other hand, although DIO2 is not known to be expressed in liver, we cannot rule out the possibility of a decreased hepatic insulin action.

Several studies have demonstrated that the Trp64Arg ADRB3 variant generates, upon stimulation, a reduced amount of cAMP compared to the wild-type receptor (22). Furthermore, we and others (23,24) have demonstrated that a functional cyclic AMP-responsive element is present in the promoter region of the DIO2 gene. The interaction between the Thr92Ala DIO2 and the Trp64Arg ADRB3 variants and a higher BMI could thus be due to a reduction in the transcription of an already functionally defective enzyme, ultimately generating a reduction of adrenergic-driven thyroid hormone–mediated lipolysis in adipose tissue. No significant difference was observed in thyroid function parameters between subjects with or without the Thr92Ala DIO2 variant in the subgroup of Italian obese subjects (data not shown).

This study has several strengths. First, the number of subjects studied was quite large, enabling us to examine gene/gene interactions. Furthermore, we had good power to detect relatively modest differences in phenotypes. Second, all subjects were Caucasian, thus reducing the risk of false positive/negative associations due to stratification bias. Third, a subset of individuals underwent euglycemic-hyperinsulinemic clamps, which enabled us to evaluate direct measures of insulin sensitivity rather than relying on indirect and less precise measures, as is the case in other studies of this kind. Despite these strengths, there were also limitations. First, the vast majority of the subjects in our study were women, and no men underwent euglycemic-hyperinsulinemic clamp. Thus, we do not know if these findings apply to men. Second, we cannot rule out the possibility of stratification bias and cannot comment on the generalizability of our findings to other ethnic populations. Third, without functional studies, it is possible that the Thr92Ala variant is in linkage disequilibrium with another pathogenic variant in the DIO2 gene or a gene close by. Finally, our results could represent a type 1 error. However, the P values for clamp measurements remains significant at the 0.01 level, even if Bonferroni corrected for all 29 variables in our database. This finding, along with the scientific plausibility of an association, provides evidence against type 1 error.

In conclusion, we have identified a novel common missense mutation of the DIO2 gene, which strongly associates with insulin resistance and, in the presence of Trp64Arg ADRB3, increased BMI. Further association and in vivo and in vitro studies are needed to evaluate the functional and epidemiological importance of this variant alone and combined with other candidate gene variants for obesity and insulin resistance.


    RESEARCH DESIGN AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 REFERENCES
 
Study population.
DIO2 molecular scanning was performed in 50 unrelated morbidly obese Caucasian subjects. Abnormal thyrotropin (>5 mUI/l) or secondary causes of obesity were considered as exclusion criteria. A well-characterized (20) Caucasian population of 972 unrelated subjects (91 men and 901 women participating in energy balance and molecular genetics studies of obesity) were used for association studies. Inclusion criteria were as follows: nondiabetic, nonsmokers, not taking any medication, without cardiovascular disease or hypertension. Glucose disposal rate, determined by hyperinsulinemic-euglycemic clamp (25) (insulin infusion rate 40 mU · m-1 · min-1) on a subset of 135 women, was performed as previously described (20). All study subjects provided informed consent.

Mutation screening and genotype analysis.
The entire coding region, the intron-exon junctions, and the SECIS element of DIO2 were screened with SSCP analysis. The gels (MDE; FMC, Rockland, ME) were run at four different conditions, i.e., 25°C or 4°C in the presence and absence of 10% glycerol. In our hands, the sensitivity of this method approaches 100%. The aberrantly migrating bands were confirmed with a second experiment. Direct dideoxy DNA sequencing on both strands of aberrantly migrating PCR products was performed manually according to established methods. The polymorphism was confirmed by PCR restriction fragment–length polymorphism (RFLP) analysis by digesting the PCR product resulting from a 5'CTCAGGGCTGGCAAAGTCAAG3' sense primer and a 5'CCACACTCTATTAGAGCCAATTG3' antisense primer with BsgI. The same PCR-RFLP strategy was used for population screening. PCR-RFLP of the Trp64Arg ADRB3 variant was performed as previously described (2).

Statistical analysis.
Data were analyzed by age-adjusted and, where appropriate, sex-adjusted general linear models using SAS version 7.0 (SAS Institute, Cary, NC). To examine the main effect of the DIO2 Thr92Ala variant, the three genotypes (Thr/Thr, Thr/Ala, and Ala/Ala) were considered separately, followed by pooling the Thr/Ala and Ala/Ala groups when the glucose disposal data provided evidence of a dominant effect. In the analysis of interaction with Trp64Arg ADRB3, each of the two variants was modeled as dichotomous variables representing the presence or absence of at least one copy of the respective variant.


    ACKNOWLEDGMENTS
 
The financial support of Telethon-Italy (Grant E.763) is gratefully acknowledged. F.S.C. is a recipient of the American Heart Association Grant 0160358U.


    FOOTNOTES
 
Address correspondence and reprint requests to Francesco Saverio Celi, Division of Endocrinology, Diabetes and Nutrition, University of Maryland School of Medicine, 660 West Redwood St., Room 484, Baltimore, MD 21201. E-mail: fceli{at}medicine.umaryland.edu or francescosaverio.celi{at}uniroma1.it.

Received for publication 1 October 2001 and accepted in revised form 5 December 2001.

Additional information for this article can be accessed at http://diabetes.diabetesjournals.org.

ADRB3, ß-3–adrenergic receptor; DIO2, human type 2 deiodinase; RFLP, restriction fragment–length polymorphism; RMR, resting metabolic rate; SECIS, selenocysteine insertion sequence; SSCP, single strand conformation polymorphism.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 REFERENCES
 

  1. Stern MP: Strategies and prospects for finding insulin resistance genes. J Clin Invest 106:323–327, 2000[Medline]
  2. Walston J, Silver K, Bogardus C, Knowler WC, Celi FS, Austin S, Manning B, Strosberg D, Stern MP, Raben N, Sorkin J, Roth J, Shuldiner AR: Time of onset of non-insulin-dependent diabetes mellitus and genetic variation of the B3-adrenergic-receptor gene. N Engl J Med 333:343–347, 1995[Abstract/Free Full Text]
  3. Widen E, Lehto M, Kanninen T, Walston J, Shuldiner AR, Groop LC: Association of a polymorphism in the beta 3-adrenergic-receptor gene with features of the insulin resistance syndrome in Finns. N Engl J Med 333:348–351, 1995[Abstract/Free Full Text]
  4. Almind K, Bjorbaek C, Vestergaard H, Hansen T, Echwald S, Pedersen O: Aminoacid polymorphisms of insulin receptor substrate-1 in non-insulin-dependent diabetes mellitus. Lancet 342:828–832, 1993[Medline]
  5. Beamer BA, Yen CJ, Andersen RE, Muller D, Elahi D, Cheskin LJ, Andres R, Roth J, Shuldiner AR: Association of the Pro12Ala variant in the peroxisome proliferator-activated receptor-{gamma}2 gene with obesity in two Caucasian populations. Diabetes 47:1806–1808, 1998[Medline]
  6. Baier LJ, Sacchettini JC, Knowler WC, Eads J, Paolisso G, Tataranni PA, Mochizuki H, Bennett PH, Bogardus C, Prochazka M: An amino acid substitution in the human intestinal fatty acid binding protein is associated with increased fatty acid binding, increased fat oxidation, and insulin resistance. J Clin Invest 95:1281–1287, 1995[Medline]
  7. Silva JE: Thyroid hormone control of thermogenesis and energy balance. Thyroid 5:481–492, 1995[Medline]
  8. al-Adsani H, Hoffer LJ, Silva JE: Resting energy expenditure is sensitive to small dose changes in patients on chronic thyroid hormone replacement. J Endocrinol Metab 82:1118–1125, 1997[Abstract/Free Full Text]
  9. Reitman ML, He Y, Gong DW: Thyroid hormone and other regulators of uncoupling proteins. Int J Obes Relat Metab Disord 23 (Suppl. 6):S56–S59, 1999[Medline]
  10. Rubio A, Raasmaja A, Silva JE: Thyroid hormone and norepinephrine signaling in brown adipose tissue. II. Differential effects of thyroid hormone on beta 3-adrenergic receptors in brown and white adipose tissue. Endocrinology 136:3277–3284, 1995[Abstract]
  11. Torrance CJ, Devente JE, Jones JO, Dohm GL: Effects of thyroid hormone on GLUT 4 glucose transporter gene expression and NIDDM in rats. Endocrinology 138:1204–1214, 1997[Abstract/Free Full Text]
  12. Richardson JM, Pessin JE: Identification of a skeletal muscle-specific regulatory domain in the rat GLUT4/muscle-fat gene. J Biol Chem 268:21021–21027, 1993[Abstract/Free Full Text]
  13. Kohrle J: Local activation and inactivation of thyroid hormones: the deiodinase family. Mol Cell Endocrinol 151:103–119, 1999[Medline]
  14. Berry MJ, Banu L, Chen Y, Mandel SJ, Kieffer DJ, Harney JW, Larsen PR: Recognition of UGA as a selenocysteine codon in type I deodinase requires sequences in the 3' untranslated region. Nature 353:273–276, 1991[Medline]
  15. St Germain DL, Galton VA: The deiodinase family of selenoproteins. Thyroid 7:655–658, 1997[Medline]
  16. Celi FS, Canettieri G, Mentuccia D, Proietti-Pannunzi L, Fumarola A, Sibilla R, Predazzi V, Ferraro M, Andreoli M, Centanni M: Structural organization and chromosomal localization of the human type II deiodinase gene. Eur J Endocrinol 143:267–271, 2000[Abstract]
  17. Silva JE, Larsen PR: Adrenergic activation of triiodothyronine production in brown adipose tissue. Nature 305:712–713, 1983[Medline]
  18. Safran M, Farewell AP, Leonard JL: Catalytic activity of type II iodothyronine 5'-deiodinase polipeptide is dependent upon cyclic AMP activation factor. J Biol Chem 271:16363–16368, 1996[Abstract/Free Full Text]
  19. Bianco AC, Silva JE: Nuclear 3,5,3'-triiodothyronine (T3) in brown adipose tissue: receptor occupancy and sources of T3 as determined by in vivo techniques. Endocrinology 120:55–62, 1987[Abstract]
  20. Garcia-Rubi E, Starling RD, Tchernof A, Matthews DE, Walston JD, Shuldiner AR, Silver K, Poehlman ET, Calles-Escandon J: Trp64Arg variant of the beta3-adrenoceptor and insulin resistance in obese postmenopausal women. J Clin Endocrinol Metab 83:4002–4005, 1998[Abstract/Free Full Text]
  21. Buettner C, Harney JW, Larsen PR: The role of selenocysteine 133 in catalysis by the human type 2 iodothyronine deiodinase. Endocrinology 141:4606–4612, 2000[Abstract/Free Full Text]
  22. Kimura K, Sasaki N, Asano A, Mizukami J, Kayahashi S, Kawada T, Fushiki T, Morimatsu M, Yoshida T, Saito M: Mutated human beta3-adrenergic receptor (Trp64Arg) lowers the response to beta3-adrenergic agonists in transfected 3T3–L1 preadipocytes. Horm Metab Res 32:91–96, 2000[Medline]
  23. Canettieri G, Celi FS, Baccheschi G, Salvatori L, Andreoli M, Centanni M: Isolation of human type 2 deiodinase gene promoter and characterization of a functional cyclic adenosine monophosphate response element. Endocrinology 141:1804–1813, 2000[Abstract/Free Full Text]
  24. Bartha T, Kim SW, Salvatore D, Gereben B, Tu HM, Harney JW, Rudas P, Larsen PR: Characterization of the 5'-flanking and 5'-untranslated regions of the cyclic adenosine 3',5'-monophosphate-responsive human type 2 iodothyronine deiodinase gene. Endocrinology 141:229–237, 2000[Abstract/Free Full Text]
  25. DeFronzo RA, Tobin JD, Andres R: Glucose clamp technique: a method for quantifying insulin secretion and resistance. Am J Physiol 237:E214–E223, 1979[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
HypertensionHome page
L. H. Canani, M. A. Leie, W. E. Machado, C. Capp, and A. L. Maia
Type 2 Deiodinase Thr92Ala Polymorphism Is Not Associated With Arterial Hypertension in Type 2 Diabetes Mellitus Patients
Hypertension, June 1, 2007; 49(6): e47 - e47.
[Full Text] [PDF]


Home page
DiabetesHome page
W. S. da-Silva, J. W. Harney, B. W. Kim, J. Li, S. D.C. Bianco, A. Crescenzi, M. A. Christoffolete, S. A. Huang, and A. C. Bianco
The Small Polyphenolic Molecule Kaempferol Increases Cellular Energy Expenditure and Thyroid Hormone Activation
Diabetes, March 1, 2007; 56(3): 767 - 776.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
O. Gumieniak, T. S. Perlstein, J. S. Williams, P. N. Hopkins, N. J. Brown, B. A. Raby, and G. H. Williams
Ala92 Type 2 Deiodinase Allele Increases Risk for the Development of Hypertension
Hypertension, March 1, 2007; 49(3): 461 - 466.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
F. J. de Jong, R. P. Peeters, T. den Heijer, W. M. van der Deure, A. Hofman, A. G. Uitterlinden, T. J. Visser, and M. M. B. Breteler
The Association of Polymorphisms in the Type 1 and 2 Deiodinase Genes with Circulating Thyroid Hormone Parameters and Atrophy of the Medial Temporal Lobe
J. Clin. Endocrinol. Metab., February 1, 2007; 92(2): 636 - 640.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
N. Grarup, M. K. Andersen, C. H. Andreasen, A. Albrechtsen, K. Borch-Johnsen, T. Jorgensen, J. Auwerx, O. Schmitz, T. Hansen, and O. Pedersen
Studies of the Common DIO2 Thr92Ala Polymorphism and Metabolic Phenotypes in 7342 Danish White Subjects
J. Clin. Endocrinol. Metab., January 1, 2007; 92(1): 363 - 366.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
R. P Peeters, W. M van der Deure, and T. J Visser
Genetic variation in thyroid hormone pathway genes; polymorphisms in the TSH receptor and the iodothyronine deiodinases.
Eur. J. Endocrinol., November 1, 2006; 155(5): 655 - 662.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Zeold, L. Pormuller, M. Dentice, J. W. Harney, C. Curcio-Morelli, S. M. Tente, A. C. Bianco, and B. Gereben
Metabolic Instability of Type 2 Deiodinase Is Transferable To Stable Proteins Independently of Subcellular Localization
J. Biol. Chem., October 20, 2006; 281(42): 31538 - 31543.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J.-M. Fernandez-Real, A. Lopez-Bermejo, A. Castro, R. Casamitjana, and W. Ricart
Thyroid Function Is Intrinsically Linked to Insulin Sensitivity and Endothelium-Dependent Vasodilation in Healthy Euthyroid Subjects
J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3337 - 3343.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
J. P Brouwer, B. C Appelhof, R. P Peeters, W. J G Hoogendijk, J. Huyser, A. H Schene, J. G P Tijssen, R. Van Dyck, T. J Visser, W. M Wiersinga, et al.
Thyrotropin, but not a polymorphism in type II deiodinase, predicts response to paroxetine in major depression.
Eur. J. Endocrinol., June 1, 2006; 154(6): 819 - 825.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. C. Appelhof, R. P. Peeters, W. M. Wiersinga, T. J. Visser, E. M. Wekking, J. Huyser, A. H. Schene, J. G. P. Tijssen, W. J. G. Hoogendijk, and E. Fliers
Polymorphisms in Type 2 Deiodinase Are Not Associated with Well-Being, Neurocognitive Functioning, and Preference for Combined Thyroxine/3,5,3'-Triiodothyronine Therapy
J. Clin. Endocrinol. Metab., November 1, 2005; 90(11): 6296 - 6299.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
R. P. Peeters, A. W. van den Beld, H. Attalki, H. v. Toor, Y. B. de Rijke, G. G. J. M. Kuiper, S. W. J. Lamberts, J. A. M. J. L. Janssen, A. G. Uitterlinden, and T. J. Visser
A new polymorphism in the type II deiodinase gene is associated with circulating thyroid hormone parameters
Am J Physiol Endocrinol Metab, July 1, 2005; 289(1): E75 - E81.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. H. Canani, C. Capp, J. M. Dora, E. L. S. Meyer, M. S. Wagner, J. W. Harney, P. R. Larsen, J. L. Gross, A. C. Bianco, and A. L. Maia
The Type 2 Deiodinase A/G (Thr92Ala) Polymorphism Is Associated with Decreased Enzyme Velocity and Increased Insulin Resistance in Patients with Type 2 Diabetes Mellitus
J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3472 - 3478.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. K. Hansen, E.-M. D. Nielsen, J. Ek, G. Andersen, C. Glumer, B. Carstensen, P. Mouritzen, T. Drivsholm, K. Borch-Johnsen, T. Jorgensen, et al.
Analysis of Separate and Combined Effects of Common Variation in KCNJ11 and PPARG on Risk of Type 2 Diabetes
J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3629 - 3637.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. E. Baum, L. C. Solberg, P. Kopp, N. Ahmadiyeh, G. Churchill, J. S. Takahashi, J. L. Jameson, and E. E. Redei
Quantitative Trait Loci Associated with Elevated Thyroid-Stimulating Hormone in the Wistar-Kyoto Rat
Endocrinology, February 1, 2005; 146(2): 870 - 878.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
T-W Guo, F-C Zhang, M-S Yang, X-C Gao, L Bian, S-W Duan, Z-J Zheng, J-J Gao, H Wang, R-L Li, et al.
Positive association of the DIO2 (deiodinase type 2) gene with mental retardation in the iodine-deficient areas of China
J. Med. Genet., August 1, 2004; 41(8): 585 - 590.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
S. L. Kirstein and P. A. Insel
Autonomic Nervous System Pharmacogenomics: A Progress Report
Pharmacol. Rev., March 1, 2004; 56(1): 31 - 52.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. P. Peeters, H. van Toor, W. Klootwijk, Y. B. de Rijke, G. G. J. M. Kuiper, A. G. Uitterlinden, and T. J. Visser
Polymorphisms in Thyroid Hormone Pathway Genes Are Associated with Plasma TSH and Iodothyronine Levels in Healthy Subjects
J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2880 - 2888.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Tables
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mentuccia, D.
Right arrow Articles by Celi, F. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mentuccia, D.
Right arrow Articles by Celi, F. S.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Diabetes Diabetes Care Clinical Diabetes Diabetes Spectrum