HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wahl, H. G. Articles by Häring, H.-U. Search for Related Content PubMed PubMed Citation Articles by Wahl, H. G. Articles by Häring, H.-U. Social Bookmarking                What's this?

Troglitazone Downregulates -6 Desaturase Gene Expression in Human Skeletal Muscle Cell Cultures

From the Department of Endocrinology and Metabolism, University of Tübingen, Tübingen, Germany

	ABSTRACT

TOP ABSTRACT INTRODUCTION RESEARCH DESIGN AND METHODS RESULTS DISCUSSION REFERENCES

 
-6 Desaturase, one of the rate-limiting enzymes, catalyzes the conversion of linoleic acid (C18:2 6) into -linolenic acid (C18:3 6), arachidonic acid (C20:4 6), and further metabolites. Recently, it has been shown that human -6 desaturase is expressed not only in liver but in a variety of human tissues, including muscle. Skeletal muscle is a major site of insulin action, and insulin sensitivity may be related to the fatty acid composition of muscle lipids. We examined the effects of troglitazone on the regulation of -6 desaturase gene expression in human muscle cell cultures obtained from muscle biopsies (n = 15). -6 Desaturase mRNA and peroxisome proliferator–activated receptor 2 (PPAR2) mRNA were quantified by two-step RT-PCR, and the activity of the -6 desaturase enzyme was estimated by gas chromatographic analysis of the 6-C18:3/C18:2 fatty acids ratio. In cells treated with 11.5 µmol troglitazone for 4 days, PPAR2 mRNA levels were significantly increased (301.0 ± 51.5%, P < 0.05) and -6 desaturase mRNA levels were significantly decreased (41.7 ± 5.9%, P < 0.0005) compared with the untreated controls. In accordance with the decrease of -6 desaturase mRNA, there was a significant decrease in the 6-C18:3/C18:2 ratio down to 47.4 ± 7.5% in cholesterol esters, 54.2 ± 7.4% in phospholipids, 56.7 ± 6.5% in nonesterified fatty acids, and 67.7 ± 5.9% in triglycerides. The troglitazone-induced decrease in -6 desaturase mRNA is associated with a change in the unsaturated fatty acid composition of the muscle cells. These results add new aspects to the known thiazolidinedione effects on lipid metabolism.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION RESEARCH DESIGN AND METHODS RESULTS DISCUSSION REFERENCES

Different monounsaturated fatty acids, polyunsaturated fatty acids (PUFAs), and eicosanoids (e.g., 15-deoxy-12,14-prostaglandin J₂) have been shown to be natural PPAR ligands (7). Diets rich in these fatty acids have been reported to lower serum cholesterol and triglyceride levels in humans (8,9), suggesting that these effects are mediated through PPAR. In several studies (10,11), it has been shown that the fatty acid composition of serum lipids (12) and skeletal muscle phospholipids (12–14) is associated with insulin sensitivity. The serum cholesterol ester proportion of palmitic (C16:0), palmitoleic (C16:1 7), and di-homo--linolenic (C20:3 6) acids correlates negatively, and that of linoleic acid (C18:2 6) positively, to insulin sensitivity (13). Analysis of skeletal muscle phospholipids revealed decreased insulin sensitivity to be associated with decreased concentrations of PUFAs (14). Significant changes in the metabolism of essential fatty acids and their metabolites have also been found in patients with essential hypertension, coronary heart disease, and type 2 diabetes (15). With the exception of marine fat sources, the availability of these PUFAs for humans depend greatly on the uptake of dietary essential fatty acids and their elongation and desaturation. -6 Desaturase, one of these rate-limiting enzymes, catalyzes the conversion of linoleic acid (C18:2 6) into -linolenic acid (C18:3 6), the precursor of arachidonic acid (C20:4 6) and its metabolites. After cloning of human -6 desaturase cDNA (16), Northern analysis revealed that it is expressed not only in liver but in a variety of human tissues including muscle (16,17).

The objectives of the present investigation were to examine the effects of troglitazone on the regulation of -6 desaturase gene expression in human muscle and subsequent alterations in fatty acid composition. We therefore quantified PPAR2 and -6 desaturase mRNA in treated and untreated human muscle cell cultures obtained from muscle biopsies. The activity of the -6 desaturase enzyme was quantified by measuring the 6-C18:3/C18:2 fatty acids ratio in the different lipids extracted from the cell cultures.

	RESEARCH DESIGN AND METHODS

TOP ABSTRACT INTRODUCTION RESEARCH DESIGN AND METHODS RESULTS DISCUSSION REFERENCES

 
Subjects.
Percutaneous biopsies of vastus lateralis muscle (18,19) were taken from 15 nondiabetic healthy volunteers (5 men and 10 women; age, 27.9 ± 6.0 years; BMI, 22.2 ± 2.2 kg/m²), and muscle tissue was processed for cell cultures or immediately snap-frozen in liquid nitrogen. Glucose tolerance of the volunteers was determined by standard oral glucose tolerance test. Insulin sensitivity was determined by euglycemic-hyperinsulinemic glucose clamp (20,21) and expressed as clamp-derived glucose metabolic clearance rate (MCR). All clinical chemistry parameters were analyzed in the central laboratory of the University of Tübingen according to standard protocols. The study protocol was approved by the ethics committee of the University of Tü bingen. Informed written consent was obtained from all subjects.

Cell culture.
Myoblasts were isolated from needle biopsies (vastus lateralis muscle) and cultured as previously described by Henry et al. (18), with minor modifications (22). At 80% confluence, cells were fused in -minimal essential medium supplemented with 2% fetal bovine serum and 0.2% antibiotic-antimycotic solution. During the entire fusion period (120 h), cells were incubated with 11.5, 5.75, 2.875, or 0 µmol/l troglitazone dissolved in DMSO (final concentration did not exceed 0.05%). The medium was changed every other day. By the end of the fusion period, cells were harvested in PBS to prepare total RNA for RT-PCR and extract total lipids for quantification of fatty acids.

Quantitation of -6 desaturase and PPAR2 mRNA by RT-PCR: RNA isolation and reverse transcription.
Total RNA was isolated from myotubes treated with different concentrations of troglitazone (0, 2.875, 5.75, and 11.5 µmol/l for 120 h) using the optimized phenol guanidinium isothiocyanate extraction method according to the manufacturer’s instructions (peqGOLD TriFast; Peqlab Biotechnologie, Erlangen, Germany). Total RNA concentrations were determined by absorbance measurements at 260 nm. Subsequently, 1 µg total RNA was reverse-transcribed using AMV Reverse Transcriptase (1st Strand cDNA Synthesis Kit for RT-PCR; Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions.

Quantitation of cDNA.
Quantitative PCR of cDNA was done using SYBR Green I Dye on a high-speed thermal cycler with an integrated microvolume fluorimeter (LightCycler; Roche Diagnostics). The principal method is described in detail elsewhere (23,24). Briefly, the glass capillaries used in the cycler for reaction vessels serve at the same time as optical elements for efficient illumination and fluorescence, allowing for continuous online and real-time monitoring of the reaction kinetics. Quantification with the LightCycler software includes removing background fluorescence, identifying the log-linear portion of the standard’s amplification curve, and plotting crossing point (cycle number) versus the log of copy number (concentration). At the end of amplification, the PCR products can be melted, and a graph of the first negative derivative of the fluorescence (–dF/dT) versus temperature identifies specific products with different melting temperatures.

The following specific primers (5' to 3' orientation) were designed from -6 desaturase sequence (Genbank accession no. AF126700) yielding a 460-bp fragment: cctacaatcaccagcacgaa and ccatgcttggcacatagaga. The amplified product was sequenced (ABI PRISM, 310 Genetic Analyzer; Perkin Elmer, Rodgau-Jugesheim, Germany) to verify its identity. The PCR conditions were optimized using a gradient cycler (Eppendorf, Hamburg, Germany). Specific primers from the PPAR2 sequence (Genbank accession no. AB005520) yielding a 267-bp fragment were designed as reported earlier (25). PCR amplification was performed using the LightCycler/DNA Master SYBR Green I kit (Roche Diagnostics) according to the manufacturer’s instructions. Cycling parameters for -6 desaturase cDNA were 95°C for 8 s, 64°C for 5 s, and 72°C for 12 s, with heating and cooling at a rate of 20° C/s. The temperatures for PPAR-2 were 95°C for 8 s, 60°C for 5 s, and 72°C for 11 s. The melting curves were acquired at a heating rate of 0.2°C/s, starting at 55°C for PPAR2 and at 59°C for -6 desaturase. For each set of experiments (cell cultures from one muscle biopsy, treated with 11.5, 5.75, 2.875, or 0 µmol/l troglitazone), the -6 desaturase and PPAR2 cDNA from the control cells (no troglitazone treatment) were diluted (1:1, 1:5, and 1:10) and used for the amplification standard curve. All analyses were done in triplicate and reported in percent increase or decrease relative to the untreated cells.

Fatty acid analysis.
Quantitation of fatty acids was perfomed by capillary gas chromatography as previously reported (26), with minor modifications. Total lipids were extracted from the cells and separated by thin-layer chromatography into individual classes of phospholipids, nonesterified fatty acids (NEFAs), diglycerides, triglycerides, and cholesterol ester. The different lipids were scraped off the plate and transferred into screw-capped vials for direct transesterification (27–29). The fatty acid methyl esters of each class were separated by gas chromatography (HP 5890; Hewlett Packard, Waldbronn, Germany) with a flame ionization detector. Separation of the 20 most commonly found fatty acids, including linoleic acid (C18:2 6) and -linolenic acid (C18:3 6), was achieved with a fused silica column, 60 m x 0.25 mm internal diameter, coated with a 0.2-µm film of Rtx-2330 (Restek, Bad Homburg, Germany). Helium was used as carrier gas at a column head pressure of 16 psi. The oven temperature program was 130°C for 0.2 min, heated at a rate of 2°C/min, and held at 260°C for 10 min. Injection mode was 1 µl splitless with different times for the individual lipid classes. Standard curves were used for all 20 fatty acids, with cis-13,16,19-docosatrienoic acid as internal standard. Quantitation was done using HP Chemstation software. The results of linoleic acid (C18:2 6) and -linolenic acid (C18:3 6) were confirmed by gas chromatography mass spectrometry analysis.

Chemicals.
All fatty acids, including the internal standards used for the calibration curve, were from Sigma (St. Louis, MO). All other reagents were of analytical grade. Troglitazone was a gift from Dr. H. Horikoshi, Sankyo Pharmaceuticals, Tokyo, Japan.

Statistical analysis.
All results are presented as means ± SE unless noted otherwise. Statistical analysis was done using Student’s t test for paired comparison and multiple regression. A P value <0.05 was considered statistically significant. All analyses were done with SSP statistical package.

	RESULTS

TOP ABSTRACT INTRODUCTION RESEARCH DESIGN AND METHODS RESULTS DISCUSSION REFERENCES

 
Subjects.
Laboratory tests (means ± SD) of fasting plasma glucose (4.8 ± 0.3 mmol/l), fasting insulin (5.3 ± 1.8 mU/l), triglycerides (0.89 ± 0.26 mmol/l), and NEFAs (218 ± 55 µmol/l) were within reference intervals. All subjects had normal glucose tolerance tests according to American Diabetes Association criteria. Clamp-derived glucose MCRs were determined as 7.8 ± 2.2 ml · kg^-1 · min^-1.

Quantitation of -6 desaturase and PPAR2 mRNA by RT-PCR.
Quantitation of -6 desaturase mRNA and PPAR2 mRNA from troglitazone-treated and untreated control cells was done with a two-step RT-PCR (LightCycler; Roche Diagnostics). Figure 1 shows the quantitation procedure for one set of experiments for both -6 desaturase mRNA and PPAR2 mRNA: after removing background fluorescence (baseline adjustment, Fig. 1A) and identifying the log-linear portion of the standard’s amplification curve (Fig. 1B), the crossing points were plotted versus the log of copy number. From the resulting crossing points (cycle numbers), a log-linear relationship could be established for the complete range of concentrations in all experiments, with mean squared errors between 0.0013 and 0.0035. In addition to the specificity shown by the melting curve analysis (Fig. 2A), agarose gel separation was done to confirm the amplification products (Fig. 2B).

View larger version (36K): [in this window] [in a new window]   FIG. 1. Quantitative PCR of -6 desaturase and PPAR2 cDNA. Total RNA was isolated from myotubes treated with different concentrations of troglitazone (0, 2.875, 5.75, and 11.5 µmol/l for 120 h) and reverse-transcribed. Quantitative PCR of cDNA was done using SYBR Green I Dye on a high-speed thermal cycler with an integrated microvolume fluorimeter (LightCycler; Roche Diagnostics). After removing background fluorescence (baseline adjustment, A) and identifying the log-linear portion of the standard’s amplification curve (B), the crossing points were plotted versus the log of copy number. From the resulting crossing points (cycle numbers), a log-linear relationship could be established for the complete range of concentrations in all experiments, with mean squared errors between 0.0013 and 0.0035.

View larger version (28K): [in this window] [in a new window]   FIG. 2. Confirmation of amplification products (cells treated with 0, 2.8, 5.75, and 11.5 µmol/l troglitazone). The specificity of amplification products is shown by the melting-curve analysis (A) and confirmed by agarose gel separation of the 460-bp fragment for -6 desaturase cDNA and the 267-bp fragment for PPAR2 cDNA (B).

View larger version (20K): [in this window] [in a new window]   FIG. 3. Chromatogram of transmethylated fatty acids from cholesterol ester lipid fraction showing linoleic acid (C18:2 6) and -linolenic acid (C18:3 6). IS, internal standard.

Troglitazone effects on PPAR2 and -6 desaturase mRNA.

View larger version (23K): [in this window] [in a new window]   FIG. 4. Dose dependence. Increasing levels of troglitazone up to 11.5 µ mol/l caused a dose-dependent decrease (means ± SE) in -6 desaturase mRNA (A) and an increase in PPAR2 mRNA (B) in human skeletal muscle cell cultures (n = 15).

View larger version (58K): [in this window] [in a new window]   FIG. 5. Troglitazone effects. In cells (n = 15) treated with 11.5 µmol troglitazone for 4 days, PPAR2 mRNA levels were significantly (P < 0.05, paired t test) increased to 301.0 ± 51.5% of the untreated controls (Fig. 5A) and -6 desaturase mRNA levels were significantly (P < 0.0005, paired t test) decreased to 41.7 ± 5.9% of the untreated controls (Fig. 5B). Paralleling the decrease of -6 desaturase mRNA by troglitazone, there was a significant decrease of the 6-C18:3/C18:2 ratio (desaturase activity index) in all lipid classes under investigation (P < 0.05) (Fig. 5C). Relative to the untreated cell cultures, the ratio decreased to 47.4 ± 7.5% in cholesterol esters (CE), 54.2 ± 7.4% in phospholipids (PL), 56.7 ± 6.5% in NEFAs, and 67.7 ± 5.9% in triglycerides (TG). All results are presented as means ± SE.

	DISCUSSION

TOP ABSTRACT INTRODUCTION RESEARCH DESIGN AND METHODS RESULTS DISCUSSION REFERENCES

 
Our results, showing regulation of -6 desaturase by troglitazone, are in good agreement with the downregulation of stearoyl-CoA desaturase 1 (SCD1) gene expression in 3T3-L1 adipocytes by thiazolidinediones (30). SCD1, a -9 desaturase, catalyzes the conversion of stearic (C18:0) to oleic acid (C18:1 9) and palmitic (C16:0) to palmitoleic acid (C16:1 7). It was shown by mRNA differential display method that both troglitazone and pioglitazone downregulate SCD1 gene expression in 3T3-L1 adipocytes in a dose-dependent manner (30). SCD1 enzyme–catalyzed 9-cis desaturation was subsequently inhibited as shown by the significantly lower content of C16:1 and C18:1 fatty acids (weight percentage) in the treated adipocytes.

Troglitazone and other thiazolidinediones (TZDs) mediate their effects by binding to and activating the transcription factor PPAR (31–33). Most studies on PPAR and TZDs have been performed in adipose tissue or tissue cultures. Improvements in skeletal muscle action and glucose metabolism may then be indirect, by lowering of lipid levels through the glucose–fatty acid cycle (34); however, with PPAR being present in skeletal muscle (4,35), there could also be direct effects. This might especially be true in type 2 diabetic and nondiabetic obese subjects, where PPAR mRNA expression in human skeletal muscle is increased (35). Troglitazone treatment of human skeletal muscle culture (4 days, 11.5 µmol/l) led to a 1.43 ± 0.25-fold increase of PPAR1 mRNA (90% of total PPAR) and a 2.5 ± 0.7-fold increase of PPAR2 mRNA (10% of total PPAR) compared with untreated controls (5). Next to the regulation of -6 desaturase gene expression, we were therefore interested in the effects of troglitazone on the regulation of PPAR2 mRNA in the same human muscle cell cultures obtained from muscle biopsies. Increasing the level of troglitazone up to 11.5 µmol/l caused a dose-dependent increase in PPAR2 mRNA levels in the human skeletal muscle cell cultures. In cells treated with 11.5 µmol troglitazone for 4 days, PPAR2 mRNA levels were significantly increased to 301.0 ± 51.5% of the untreated controls (P < 0.05, paired t test). There was a strong correlation (P = 0.0012, multiple regression) between the increase in PPAR2 mRNA and the decrease in -6 desaturase mRNA, suggesting that the regulation of -6 desaturase gene expression is mediated by PPAR. In this regard, it will be of interest to see if a functional PPRE (PPAR response element) is found in the promotor region of the -6 desaturase gene.

Regulation of desaturase gene expression will eventually lead to altered fatty acid composition of lipids. In the case of serum lipids, it has been shown that the serum cholesterol ester proportion of palmitic (C16:0), palmitoleic (C16:1 7), and di-homo--linolenic (C20:3 6) acids correlated negatively, and that of linoleic acid (C18:2 6) positively, to insulin sensitivity (12). Analysis of skeletal muscle phospholipids from healthy subjects revealed decreased insulin sensitivity to be associated with decreased concentrations of PUFAs (14). Although it is not statistically significant, there seems to be a noteworthy difference between -6 and -5 desaturase activity with regard to insulin sensitivity. The ratio of 6-C20:4/C20:3 as -5 desaturase activity index correlated positively (r = 0.84, P < 0.001), whereas the ratio of 6-C18:3/C18:2 as -6 desaturase activity index showed a negative coefficient (r = -0.28, P > 0.05) (14). These studies (12,14) suggest that PUFAs do not in general correlate with insulin sensitivity, but there seem to be differences between the individual PUFAs. To further elucidate the effect of troglitazone on muscle fatty acid composition and, in particular, on PUFAs, it would be important to investigate its effect on all the desaturases involved (-9, -6, and -5) as well as the complete fatty acid profiles.

-6 Desaturase enzymatic activity varies with hormonal and nutritional manipulation (16,36,37). In addition to being affected by insulin, fasting, and feeding, the activity is highly dependent on the composition of dietary fat (36–38). Fats rich in essential fatty acids (EFAs) cause a lower activity than than those low in EFAs (37). In mice, a triolein-rich (EFA-deficient) diet caused a significantly higher -6 desaturase enzymatic activity compared with a corn oil–rich (EFA-rich) diet (16). Both -6 desaturase and -5 desaturase in human Hep G2 cells are rate limiting to fatty acid interconversion and are upregulated under essential fatty acid–deficient conditions (39). Certain mono- and polyunsaturated fatty acids and their metabolites (7), as well as TZDs and fibrates, have been shown to interact directly with PPAR and/or PPAR. Because PPARs appear to play a central role in the catabolism and storage of fatty acids, this could be the underlying molecular mechanism whereby dietary lipids affect such metabolic diseases as obesity, atherosclerosis, and type 2 diabetes.

In summary, we showed that increasing levels of troglitazone caused a dose-dependent increase in PPAR2 mRNA levels and a decrease in -6 desaturase mRNA in human skeletal muscle cell cultures. In cells treated with 11.5 µmol/l troglitazone, PPAR2 mRNA levels were significantly increased and -6 desaturase mRNA levels significantly decreased, with a corresponding decrease in -6 desaturase enzyme activity. The decrease in -6 desaturase mRNA levels led to a change in the muscle cells’ unsaturated fatty acid composition; these results add new aspects to the known TZD effects on lipid metabolism in muscle.

	FOOTNOTES

 
Address correspondence and reprint requests to Dr. Hans Günther Wahl, Klinikum Fulda, Institut für Laboratoriumsmedizin, 36043 Fulda, Germany. E-mail: hgwahl{at}klinikum-fulda.de.

Received for publication 13 March 2001 and accepted in revised form 27 December 2001.

EFA, essential fatty acid; MCR, metabolic clearance rate; PPAR, peroxisome proliferator-activated receptor ; PUFA, polyunsaturated fatty acid; TZD, thiazolidinedione.

	REFERENCES

TOP ABSTRACT INTRODUCTION RESEARCH DESIGN AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Nolan JJ, Ludvik B, Beerdsen P, Joyce M, Olefsky J: Improvement in glucose tolerance and insulin resistance in obese subjects treated with troglitazone. N Engl J Med331 :1188 –1193,1994[Abstract/Free Full Text]
2. Spencer CM, Markham A: Troglitazone. Drugs54 :89 –101,1997[Medline]
3. Fajas L, Auboeuf D, Raspe E, Schoonjans K, Lefebvre AM, Saladin R, Najib J, Laville M, Fruchart JC, Deeb S, Vidal-Puig A, Flier J, Briggs MR, Staels B, Vidal H, Auwerx J: The organization, promoter analysis, and expression of the human PPAR gamma gene. J Biol Chem272 :18779 –18789,1997[Abstract/Free Full Text]
4. Vidal-Puig AJ, Considine RV, Jimenez-Liñan M, Werman A, Pories WJ, Caro JF, Flier JS: Peroxisome proliferator-activated receptor gene expression in human tissues. J Clin Invest99 :2416 –2422,1997[Medline]
5. Park KS, Ciaraldi TP, Lindgren K, AbramsCarter L, Mudaliar S, Nikoulina SE, Tufari SR, Veerkamp JH, Vidal-Puig A, Henry RR: Troglitazone effects on gene expression in human skeletal muscle of type II diabetes involve up-regulation of peroxisome proliferator-activated receptor-gamma. J Clin Endocrinol Metab83 :2830 –2835,1998[Abstract/Free Full Text]
6. Lapsys NM, Kriketos AD, Lim-Fraser M, Poynten AM, Lowy A, Furler SM, Chisholm DJ, Cooney GJ: Expression of genes involved in lipid metabolism correlate with peroxisome proliferator-activated receptor gamma expression in human skeletal muscle. J Clin Endocrinol Metab85 :4293 –4297,2000[Abstract/Free Full Text]
7. Kliewer SA, Sundseth SS, Jones SA, Brown PJ, Wisely GB, Koble CS, Devchand P, Wahli W, Willson TM, Lenhard JM, Lehmann JM: Fatty acids and eicosanoids regulate gene expression through direct interactions with peroxisome proliferator-activated receptors and . Proc Natl Acad Sci U S A94 :4318 –4323,1997[Abstract/Free Full Text]
8. Horrobin DF: Essential fatty acids and the complications of diabetes mellitus. Wien Klin Wochenschr8 :289 –293,1989
9. Horrobin DF: Abnormal membrane concentrations of 20 and 22-carbon essential fatty acids: a common link between risk factors and coronary and peripheral vascular disease? Prostaglandins Leukot Essent Fatty Acids53 :385 –396,1995[Medline]
10. Storlien LH, Baur LA, Kriketos AD, Pan DA, Cooney GJ, Jenkins AB, Calvert GD, Campbell LV: Dietary fats and insulin action. Diabetologia39 :621 –631,1996[Medline]
11. Storlien LH, Kriketos AD, Calvert GD, Baur LA, Jenkins AB: Fatty acids, triglycerides and syndromes of insulin resistance. Prostaglandins Leukot Essent Fatty Acids57 :379 –385,1997[Medline]
12. Vessby B, Aro A, Skarfors E, Berglund L, Salminen I, Lithell H: The risk to develop NIDDM is related to the fatty acid composition of the serum cholesterol esters. Diabetes43 :1353 –1357,1994[Abstract]
13. Vessby B, Tengblad S, Lithell H: Insulin sensitivity is related to the fatty acid composition of serum lipids and skeletal muscle phospholipids in 70-year-old men. Diabetologia37 :1044 –1050,1994[Medline]
14. Borkman M, Storlien LH, Pan DA, Jenkins AB, Chisholm DJ, Campbell LV: The relation between insulin sensitivity and the fatty-acid composition of skeletal-muscle phospholipids. N Engl J Med328 :238 –244,1993[Abstract/Free Full Text]
15. Das UN: Essential fatty acid metabolism in patients with essential hypertension, diabetes mellitus and coronary heart disease. Prostaglandins Leukot Essent Fatty Acids52 :387 –391,1995[Medline]
16. Cho HP, Nakamura MT, Clarke SD: Cloning, expression, and nutritional regulation of the mammalian delta-6 desaturase. J Biol Chem274 :471 –477,1999[Abstract/Free Full Text]
17. Wahl HG, Machicao F, Rettig A, Weisser A, Häring HU, Rett K: Expression of delta-6 desaturase in human tissues (Abstract). Atherosclerosis147 (Suppl. 2) :S36 ,1999
18. Henry RR, Abrams L, Nikoulina S, Ciaraldi TP: Insulin action and glucose metabolism in nondiabetic control and NIDDM subjects: comparison using human skeletal muscle cell cultures. Diabetes44 :936 –946,1995[Abstract]
19. Wahl HG, Mestrovic K, Houdali B, Werner R, Renn W, Maerker E, Häring HU, Rett K: Insulin sensitivity is related to the fatty acid composition of muscle lipids (Abstract). Atherosclerosis147 (Suppl. 2) :S37 ,1999
20. DeFronzo RA, Tobin JD, Andres R: Glucose clamp technique: a method for quantifying insulin secretion and resistance. Am J Physiol237 :E214 –E223,1979[Abstract/Free Full Text]
21. Volk A, Renn W, Overkamp D, Mehnert B, Maerker E, Jacob S, Balletshofer B, Häring HU, Rett K: Insulin action and secretion in healthy, glucose tolerant first degree relatives of patients with type 2 diabetes mellitus: influence of body weight. Exp Clin Endocrinol Diabetes107 :140 –147,1999[Medline]
22. Krutzfeldt J, Kausch C, Volk A, Klein HH, Rett K, Haring HU, Stumvoll M: Insulin signaling and action in cultured skeletal muscle cells from lean healthy humans with high and low insulin sensitivity. Diabetes49 :992 –998,2000[Abstract]
23. Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP: Continuous fluorescence monitoring of rapid cycle DNA amplification. BioTechniques22 :130 –138,1997[Medline]
24. Wittwer CT, Ririe KM, Andrew RV, David DA, Gundry RA, Balis UJ: The LightCycler: a microvolume multisample fluorimeter with rapid temperature control. BioTechniques22 :176 –181,1997[Medline]
25. Koch M, Rett K, Maerker E, Volk A, Haist K, Deninger M, Renn W, Haring HU: The PPARgamma2 amino acid polymorphism Pro 12 Ala is prevalent in offspring of type II diabetic patients and is associated to increased insulin sensitivity in a subgroup of obese subjects. Diabetologia42 :758 –762,1999[Medline]
26. Liebich HM, Jakober B, Wirth C, Pukrop A, Eggstein M: Analysis of the fatty acid composition of the lipid classes in human blood serum under normal diet and when supplemented with fish oil. High Resolution Chromatography14 :433 –437,1991
27. Lepage G, Roy CC: Improved recovery of fatty acid through direct transesterification without prior extraction or purification. J Lipid Res25 :1391 –1396,1984[Abstract]
28. Lepage G, Roy CC: Direct transesterification of all classes of lipids in a one-step reaction. J Lipid Res27 :114 –120,1986[Abstract]
29. Lepage G, Roy CC: Specific methylation of plasma nonesterified fatty acids in a one-step reaction. J Lipid Res29 :227 –235,1988[Abstract]
30. Kurebayashi S, Hirose T, Miyashita Y, Kasayama S, Kishimoto T: Thiazolidinediones downregulate stearoyl-CoA desaturase 1 gene expression in 3T3–L1 adipocytes. Diabetes46 :2115 –2118,1997[Abstract]
31. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Wilson TM, Kliewer SA: An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor (PPAR). J Biol Chem270 :12953 –12956,1995[Abstract/Free Full Text]
32. Schoonjans K, Staels B, Auwerx J: The peroxisome proliferator activated receptors (PPARs) and their effects on lipid metabolism and adipocyte differentiation. Biochim Biophys Acta1302 :93 –109,1996[Medline]
33. Schoonjans K, Martin G, Staels B, Auwerx J: Peroxisome proliferator-activated receptors, orphans with ligands and functions. Curr Opin Lipidol8 :159 –166,1997[Medline]
34. Spiegelman BM, Flier JS: Adipogenesis and obesity: rounding out the big picture. Cell87 :377 –389,1996[Medline]
35. Park KS, Ciaraldi TP, Abrams Carter L, Mudaliar S, Nikoulina SE, Henry RR: PPAR-gamma gene expression is elevated in skeletal muscle of obese and type II diabetic subjects. Diabetes46 :1230 –1234,1997[Abstract]
36. Brenner RR: Regulatory function of delta6 desaturate: key enzyme of polyunsaturated fatty acid synthesis. Adv Exp Med Biol83 :85 –101,1977[Medline]
37. Brenner RR: Factors influencing fatty acid chain elongation and desaturation. In The Role of Fats in Human Nutrition. Vergroesen AJ, Crawford M, Eds. San Diego, CA, Academic Press,1989 , p.45 –79
38. Keelan M, Clandinin MT, Thomson AB: Dietary lipids influence the activity of delta 5-desaturase and phospholipid fatty acids in rat enterocyte microsomal membranes. Can J Physiol Pharmacol75 :1009 –1014,1997[Medline]
39. Melin T, Nilsson A: Delta-6-desaturase and delta-5-desaturase in human Hep G2 cells are both fatty acid interconversion rate limiting and are upregulated under essential fatty acid deficient conditions. Prostaglandins Leukot Essent Fatty Acids56 :437 –442,1997[Medline]

CiteULike

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				A. G. Smith and G. E. O. Muscat Orphan nuclear receptors: therapeutic opportunities in skeletal muscle Am J Physiol Cell Physiol, August 1, 2006; 291(2): C203 - C217. [Abstract] [Full Text] [PDF]

				P. Benatti, G. Peluso, R. Nicolai, and M. Calvani Polyunsaturated Fatty Acids: Biochemical, Nutritional and Epigenetic Properties J. Am. Coll. Nutr., August 1, 2004; 23(4): 281 - 302. [Abstract] [Full Text] [PDF]

				J. K. Kim, J. J. Fillmore, O. Gavrilova, L. Chao, T. Higashimori, H. Choi, H.-J. Kim, C. Yu, Y. Chen, X. Qu, et al. Differential Effects of Rosiglitazone on Skeletal Muscle and Liver Insulin Resistance in A-ZIP/F-1 Fatless Mice Diabetes, June 1, 2003; 52(6): 1311 - 1318. [Abstract] [Full Text] [PDF]

				J.-M. Ye, M. A. Iglesias, D. G. Watson, B. Ellis, L. Wood, P. B. Jensen, R. V. Sorensen, P. J. Larsen, G. J. Cooney, K. Wassermann, et al. PPARalpha /gamma ragaglitazar eliminates fatty liver and enhances insulin action in fat-fed rats in the absence of hepatomegaly Am J Physiol Endocrinol Metab, March 1, 2003; 284(3): E531 - E540. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wahl, H. G. Articles by Häring, H.-U. Search for Related Content PubMed PubMed Citation Articles by Wahl, H. G. Articles by Häring, H.-U. Social Bookmarking                What's this?