Diabetes
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rydén, M.
Right arrow Articles by Arner, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rydén, M.
Right arrow Articles by Arner, P.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
Diabetes 51:1601-1608, 2002
© 2002 by the American Diabetes Association, Inc.

Effect of the (C825T) Gß3 Polymorphism on Adrenoceptor-Mediated Lipolysis in Human Fat Cells

Mikael Rydén, Gary Faulds, Johan Hoffstedt, Anders Wennlund, and Peter Arner

From the Department of Medicine, Karolinska Institutet and Clinical Research Center at the Center of Metabolism and Endocrinology, Huddinge Hospital, Huddinge, Sweden


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A common Gß3 gene polymorphism (C825T) influences G protein receptor-mediated signal transduction. We investigated whether this polymorphism influences lipolysis in isolated subcutaneous fat cells from 114 healthy obese subjects. The Gß3 protein content was markedly decreased in adipocytes of TT carriers, but the alternatively spliced short form of Gß3 previously shown in platelets of 825T carriers was not detected. Fat cells of TT carriers showed a significant 10-fold decrease in the half-maximum effective concentration of agonists selective for lipolytic ß1- and ß2-adrenoceptors as well as for the antilipolytic {alpha}2A-adrenoceptor. In TT carriers, maximum ß-adrenoceptor agonist-stimulated lipolysis was decreased, but the maximum antilipolytic effect of {alpha}2-adrenoceptors was less marked. Norepinephrine induced adipocyte lipolysis and circulating fasting levels of free fatty acids and glycerol were reduced by half in TT carriers. The polymorphism did not influence the adipocyte content of {alpha}2A-adrenoceptors, ß2-adrenoceptors, G{alpha}i, or G{alpha}s. In conclusion, the C825T variant of Gß3 influences lipolysis. Adipocytes of TT carriers have a lower 3 protein content and a decreased function of native Gs- as well as Gi-coupled adrenoceptors, which reduces the lipolytic effect of catecholamines. These data differ from those obtained in other cell systems that have shown increased expression of an alternative spliced Gß3 variant and enhanced G protein signaling in 825T carriers, indicating that the polymorphism has cell type-specific effects that may be of importance for type 2 diabetes and other insulin-resistant conditions.



    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Polymorphisms in genes for proteins involved in G protein receptor signaling pathways may alter corresponding hormone function and therefore be involved in the pathogenesis of several endocrine disorders, including diabetes and obesity. G proteins are composed of three subunits—{alpha}, ß, and {gamma}-with each having a number of isoforms (1). These interact in different combinations that in turn determine the nature of the downstream signal. The ß and {gamma} subunits form heterodimers that interact with different {alpha} components. After ligand receptor binding, the {alpha} component dissociates from the ß and {gamma} dimers and initiates distinct downstream signaling cascades. Several of these pathways affect cAMP formation and regulate metabolic processes related to diabetes, such as fat cell lipolysis. A common polymorphism (C825T) in the gene coding an isoform of the ß subunit, Gß3 and located in exon 10, has been reported to cause variation in protein expression (2). Because of a paradoxical alternative splicing of exon 9, an additional 41-amino-acid shorter form (Gß3-s) is produced. Functional studies on transformed lymphoblasts and transfected insect cells have suggested that Gß3-s enhances G protein signaling, possibly by formation of a tighter G{alpha}i{gamma} complex than full-length Gß3 (2). It has been suggested that the Gß3 polymorphism is a genetic component of hypertension (3), although the hypertensive effect could be mediated by indirect effects (2). It is also possible that the 3 polymorphism plays a role in the development of obesity and type 2 diabetes. Several studies have shown increased 825T allele frequency among obese or type 2 diabetic subjects (46). Women with this allele are also at high risk for postpregnancy weight retention (7). Because the frequency of the 825T allele is much higher among African and Asian than among Caucasian populations, it has been suggested that Gß3 is a "thrifty gene" that may contribute to obesity, diabetes, and hypertension if Westernization of lifestyle continues (8)

So far, information is available only about the effect of C825T on the function of signaling pathways that involve G{alpha}i (1). It is not known whether this Gß3 gene polymorphism also influences signal transduction through G{alpha}s. The ß subunit of the G protein complex is common for both G{alpha}i and G{alpha}s, and Gß3 is ubiquitously expressed (1). Therefore, a functional variation in the protein may influence the action of G{alpha}s- as well as G{alpha}i-coupled receptors. Furthermore, the silent C825T polymorphism may have different effects on Gß3 mRNA splicing and protein production among specific native cell types

The subcutaneous fat cell is a useful and relatively easily available cell type for studying native human receptors that signal through G proteins (9). ß1- and ß2-adrenoceptors (G{alpha}s coupled and stimulatory) and {alpha}2A-adrenoceptors (G{alpha}i coupled and inhibitory) coexist in human fat cells, where they can fully activate or inhibit lipolysis, respectively, as a primary event in these cells. Human fat cells also contain a ß3-adrenoceptor that is not fully active in the subcutaneous adipose region (9,10)

It is not known whether the C825T Gß3 gene polymorphism influences adrenoceptor-mediated lipolysis in fat cells. This question is of considerable clinical relevance because of the putative role of catecholamines in regulating lipolysis in insulin-resistant subjects (10). A functional polymorphism in a gene controlling early events in adipocyte receptor signaling, such as Gß3, might have consequences for the final, and physiologically most important, metabolic event—namely, stimulation/inhibition of lipolysis in adipocytes. However, a change in G protein signal transduction might also be compensated for at a distal step in the lipolysis cascade, resulting in a normal lipolysis phenotype. As part of a study to characterize adrenergic regulation of lipolysis in isolated subcutaneous adipocytes in obesity, we identified 114 obese but otherwise healthy subjects with the C825T polymorphism in the Gß3 gene. The in vitro effects of norepinephrine and selective lipolysis acting agents were compared between carriers of the C and T alleles. We hypothesized that if the polymorphism is important for lipolysis regulation in native human fat cells, then it would be accompanied by variations in the activity of selective ß- as well as {alpha}2-adrenoceptor agonists and also perhaps of natural catecholamines. The protein content of Gß3 and other key elements in the G protein signaling system in fat cells was also assessed by Western blot analysis


    RESEARCH DESIGN AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Subjects
We investigated 114 obese subjects (21 men and 93 women) of Scandinavian origin who were consecutively recruited to study adrenergic regulation of lipolysis in subcutaneous fat cells. The subjects were obese healthy volunteers or obese otherwise healthy subjects who were referred to our obesity unit for treatment for being overweight. None of the subjects was completely sedentary or involved in sporting activities. None had undertaken a weight-reduction diet during the 6 months before the study. Obesity was defined using World Health Organization criteria (BMI >30 kg/m2). The BMI of the subjects ranged from 30.4 to 53.4 kg/m2. None of the subjects was on regular medication. Their ages ranged from 20 to 72 years, and 12 women were menopausal. (It has recently been shown that menopause does not influence lipolysis regulation in human subcutaneous fat cells [11]). The study was approved by the ethics committee of Huddinge Hospital. The procedure was initially explained to each subject, and his or her consent was then obtained

The subjects came to the laboratory at 8:00 A.M. after an overnight fast. Height and weight were determined and a fasting venous blood sample was obtained for the determination of plasma glycerol, glucose, insulin, triglycerides, cholesterol, HDL cholesterol, and serum-free fatty acids, as previously described (12). Thereafter, a subcutaneous fat biopsy (~1–2 g) was obtained under local anesthesia from the umbilical region (13)

Fat cell experiments
The methods to perform and analyze fat cell experiments have been described in detail elsewhere (14,15). In brief, isolated fat cells were prepared and their average size, volume, and weight were determined. Diluted fat cell suspensions (2%, vol/vol) were incubated in duplicate for 2 h at 37°C in a Krebs-Henseleit phosphate buffer (pH 7.4) containing bovine albumin (20 g/l), glucose (1 mg/ml), and ascorbic acid (0.1 mg/ml). At the end of the incubation, an aliquot of the medium was removed for glycerol analysis (lipolysis index) and analysis of the amount of glycerol release related to the number of incubated fat cells

The following agents were added (at concentrations of 10-10 to 10-4 mol/l, depending on the type of agent) to the incubation medium at the start of the experiment; norepinephrine (a natural catecholamine), isoprenaline (a nonselective ß-adrenergic agonist), dobutamine (a selective ß1-adrenoceptor agonist), terbutaline (a selective ß2-adrenoceptor agonist), clonidine (a selective {alpha}2-adrenoceptor agonist), and dibutyryl cyclic AMP (dcAMP; a phosphodiesterase-resistant cyclic AMP analog). The basal condition was defined as that with no agonist present. In the clonidine experiments, adenosine deaminase (1 unit/ml) was added to the incubation medium to avoid the influence of adenosine on the antilipolytic effect of clonidine

Because human subcutaneous fat cells have functional spare {alpha}2- and ß-adrenergic receptors (16), it is possible to use classical pharmacological methods to evaluate receptor function (17). The individual concentration response curves were linearized by log-logit transformation and analyzed for pD2 (negative logarithm of half-maximum effective concentration [EC50]). Furthermore, responsiveness (glycerol release at maximum effective drug concentration) was determined from the original curves. Changes in pD2 reflect receptor events (binding and coupling to effector), whereas changes in responsiveness reflect receptor events as well as more distal and postreceptor-related events (17). The intrinsic activity of dobutamine and terbutaline was also determined according to the following formula: lipolysis at maximum effective dobutamine/terbutaline concentration minus basal lipolysis divided by lipolysis at maximum effective isoprenaline concentration minus basal lipolysis. Although the ß1- and ß2-adrenoceptor agonists used might be less selective in other systems, we have previously demonstrated the selectivity of dobutamine and terbutaline on ß-adrenoceptor-mediated lipolysis in isolated human fat cells (15). A plateau of response was reached at the highest concentrations in all cases and with all drugs. Thus, it was possible to get an accurate measure of pD2, intrinsic activity, and the responsiveness of the different drugs in each of the subjects investigated

Genotyping
DNA was prepared from frozen (-20°C) venous blood. The C825T polymorphism in the Gß3 gene was determined exactly as previously described (2). A combination of PCR and digestion of the PCR product with the restriction enzyme BseD1 (to obtain restriction fragments of various lengths) was used. The accuracy of the method was confirmed by direct sequencing (Cybergene, Stockholm, Sweden)

Protein isolation and immunodetection
Because the amount of adipose tissue available was limited and priority was given to lipolysis experiments, cells for subsequent protein analysis could be saved only from a limited number of subjects. Aliquots (300 µl) of packed cells were lysed in protein lysis buffer (1% Triton X-100, Tris-HCl [pH 7.6], 150 mmol/l NaCl) supplemented with protease inhibitors (1 mmol/l phenylmethylsulfonyl fluoride and Complete [Boehringer Mannheim, Mannheim, Germany]), and homogenized using a microtome. The homogenate was centrifuged at 14,000 rpm for 30 min, and the infranatant was removed and saved. All steps were performed at 4°C to minimize the risk of protein degradation. The protein content in each sample was determined using a kit of reagents from Pierce Biotech (Rockford, IL). For detection of total intracellular Gß content, 100 µg total protein were directly loaded onto 12% polyacrylamide gels and separated by standard SDS-PAGE. To specifically detect Gß3, 100 µg total protein were immunoprecipitated overnight at 4°C in the presence of anti-Gß3 antibody (1:200; Santa Cruz Biotechnology, Santa Cruz, CA). Samples were then incubated with protein-A-Sepharose beads (Pharmacia, Uppsala, Sweden), washed, boiled, and loaded in parallel with the samples for total Gß content. To control for differences in gel migration, exposure time, antibody incubation, and so on, all samples were run on the same gels and transferred to the same polyvinylidine fluoride membranes (Amersham, Little Chalfont, U.K.). Blots were blocked for 1 h at room temperature in Tris-buffered saline with 0.1% Tween-20 and 5% non-fat dried milk. This was followed by an overnight incubation at 4°C in the presence of antibodies against all isoforms of Gß (Santa Cruz Biotechnology). To confirm antibody specificity, positive controls provided by the manufacturer were included in all experiments. Secondary antibodies conjugated to horseradish peroxidase were obtained from Sigma (St Louis, MO) ({alpha}-rabbit 1:4,000). Antigen-antibody complexes were detected by chemiluminescence using a kit of reagents for enhanced chemiluminescence (Amersham) and blots were exposed to high-performance chemiluminescence film (Amersham). Films were scanned and the optical density (OD) of each specific band was analyzed using the program Image (National Institutes of Health, Bethesda, MD) and expressed as OD · mm-2 · 100 µg-1 total protein. Additional proteins were measured on the same samples as were used for Gß using antibodies (all from Santa Cruz Biotechnology) directed toward the following: {alpha}2A-adrenoceptor, ß2-adrenoceptor, G{alpha}i, and G{alpha}s

Assessment of mRNA expression
RT-PCR for Gß3 and Gß3-s mRNA transcripts was attempted as follows. For an individual reaction, 15 pmol oligo d(T) primer or a specific 3' Gß3 primer (either GAAGCAGATCAGCTCCTGGT or CCTCCTCAGTTCCAGATTTTGAGGA) was added to the RT mix, containing 1x reaction buffer (Promega), 6.5 mmol/l dNTPs, 1 mmol/l MnCl2, and 5 units rtTh RT (Promega) enzyme. The enzymatic reaction consisted of incubation at 25°C for 10 min, followed by incubations of 3 min at 60°C, 15 min at 72°C, and 5 min at 99°C. This cDNA synthesis procedure is standard in our laboratory. Then 4 µl of the reverse transcribed sample were used for the subsequent PCR reactions. An individual reaction comprised 45 pmol 5' primer, 45 pmol 3' primer, 2.5 units Thermophylus aquaticus (Taq) polymerase, 1 polymerase reaction buffer (Gibco), and 0.2 mmol/l dNTPs. MgCl2 was added at a range of concentrations (1–4 mmol/l). The PCR reaction proceeded according to two different protocols, either with a stepwise increase in annealing temperature from 37 to 72°C or by a stepwise reduction in temperature per cycle from 64 to 50°C. Positive controls (using oligonucleotides specific for either leptin or uncoupling protein 2) were used in parallel to control for cDNA quality and PCR efficiency. To detect the product, 5–10 µl of the PCR reaction were loaded onto a 2% agarose/Tris-acetate-EDTA (TAE) gel containing 0.5 µg/ml EtBr and run at 100 V for 1–2 h in 1x TAE buffer

Drugs and chemicals
BSA (fraction V) was obtained from Sigma (St Louis, MO), (-)-isoprenaline hydrochloride from Hässle (Mölndal, Sweden), terbutaline sulfate from Draco (Lund, Sweden), dobutamine hydrochloride from Lilly (Indianapolis, IN), clonidine from Boehringer-Ingelheim (Ingelheim, Germany), Taq polymerase from Perkin-Elmer/Cetus (Emeryville, CA), and the restriction enzyme BseD1 from New England Biolabs (Beverly, MA)

Statistical analysis
Analyses of phenotypic values included descriptive statistics (mean + SD by genotype or box plot) and were performed by ANOVA and post hoc test or ANCOVA adjusted for sex and, when stated, age and BMI. In some cases, {chi}2 and Student’s unpaired t tests were performed. A 5% significance level was used for hypothesis testing. The statistical software program used was Stat View (SAS Institute, Cary, NC)


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Allelic frequencies
We found 8 subjects who carried the T variant in the homozygous form; 45 subjects were heterozygous. The remaining 61 subjects were homozygous for the C allele. The observed genotype frequency was similar to that previously reported in other Caucasian populations (4) and is in Hardy-Weinberg equilibrium. The sex distribution (Table 1) did not differ significantly among genotypes, although there was a trend toward an increased number of males in the small TT group (P = 0.10). Therefore, all subsequent statistical analyses were corrected for sex using ANCOVA


View this table:
[in this window]
[in a new window]
 
TABLE 1 Clinical characteristics of the C825T polymorphism in the Gß3 gene

 
Clinical findings
The clinical data for comparison among genotypes is shown in Table 1. No significant differences among TT, CT, and CC carriers were seen for age, BMI, fasting plasma levels of glucose, insulin, catecholamines, lipids, or fat cell volume. On the other hand, fasting circulating levels of glycerol and free fatty acids were significantly reduced by half in the TT group, but there were no apparent differences between CC and CT carriers

pD2 for lipolysis of selective adrenergic agonists
Mean concentration-response curves for the selective agonists are shown for illustrative purposes in Fig. 1. For terbutaline 2 selective), dobutamine (ß1 selective), and clonidine ({alpha}2 selective), the mean curves of TT carriers were shifted to the right of those for CC carriers. The pD2 values according to genotype for the whole cohort are shown in Fig. 2. A significant relationship between the polymorphism and pD2 for all selective agonists was observed. For terbutaline (P = 0.02) and clonidine (P = 0.004), the T homozygotes had ~1 log unit lower mean pD2 values than the C homozygotes. Heterozygotes had intermediate values. This represents a 10-fold difference in EC50 between T and C homozygotes. For dobutamine (P = 0.007), the T homozygotes had ~0.5 log unit lower mean pD2 values than C homozygous or heterozygous subjects, which represented about a sevenfold difference in EC50. Because pD2 appeared to be reduced in both CT and TT carriers, T heterozygotes and homozygotes were also combined into one group. The pD2 values for CT/TT carriers and CC carriers are shown in Table 2. For all three ligands, the pD2 values were ~0.5 log unit higher among CC than CT/TT carriers. This difference was statistically significant (P from 0.007 to 0.019) and was observed in the whole (a correction for sex was made) as well as in the female subgroup. The analysis of data presented in Table 2 was not influenced in an important way if either BMI or age was included as a covariable in the statistical analysis



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 1. Mean concentration response curves for clonidine (A), dobutamine (B), and terbutaline (C) in C825C ({circ}) and T825T (•) subjects.

 


View larger version (19K):
[in this window]
[in a new window]
 
FIG. 2. Box plot of pD2 values for lipolysis induced by terbutaline (A), dobutamine (B), and clonidine (C) in CC carriers ({square}), CT carriers (), and TT carriers () of the C825T gene polymorphism in the Gß3 gene. Values on y-axes are the pD2 values. (For further details see RESEARCH DESIGN AND METHODS.) Values were compared by ANOVA with sex as a cofactor.

 

View this table:
[in this window]
[in a new window]
 
TABLE 2 pD2 for lipolytic action of selective adrenergic agonists in isolated human fat cells set in relation to the T allele of the C825T polymorphism in the Gß3 gene

 
Responsiveness for lipolysis
Data on the maximum action of the lipolysis agents (responsiveness) are shown in Table 3. There was no significant difference among TT, CT, and CC carriers with regard to basal, lipolysis, adenosine deaminase-induced lipolysis, or maximally stimulated lipolysis by dcAMP. However, clonidine lipolysis was maximally inhibited to a significantly lower rate in CC than in TT or CT carriers. Furthermore, maximum isoprenaline-, terbutaline-, dobutamine-, or norepinephrine-induced lipolysis rates were significantly reduced in TT carriers by almost half (P from <0.01 to 0.02). On the other hand, CC and CT carriers had similar responsiveness for the different ß-adrenergic agonists as well as for norepinephrine


View this table:
[in this window]
[in a new window]
 
TABLE 3 Lipolysis in human fat cells by set in relation to the C825T polymorphism in the Gß3 gene

 
Intrinsic activity for lipolysis of selective ß-adrenergic agonists
We also investigated if terbutaline and dobutamine were full or partial agonists in the different genotype groups by measuring their lipolytic effect in relation to the nonselective full agonist isoprenaline. This intrinsic activity for terbutaline was 0.86 + 0.11, 0.88 + 0.21, and 0.84 + 0.14 in CC, CT, and TT carriers, respectively (P = 0.43). Corresponding values for dobutamine were 0.83 + 0.15, 0.83 + 0.23, and 0.75 + 0.15 (P = 0.49). The intrinsic activity values for the two agents did not differ among TT, CT, and CC carriers. In other words, terbutaline and dobutamine were to the same extent almost full agonists in all genotypes

Protein determination
To assess the amount of Gß3 protein in isolated adipocytes, we measured the protein content of Gß3 in frozen cell samples from four TT homozygotes, four CT heterozygotes, and seven CC homozygotes. Because of the relative scarcity of TT subjects, the four samples included were the only ones remaining. In contrast, the CT and CC samples were picked at random for analysis. First, 100 µg isolated protein was either loaded directly onto polyacrylamide gels or immunoprecipitated overnight with a commercially available antibody against Gß3. Both samples were separated by standard SDS-PAGE on the same gels and transferred to membranes for Western blotting. Gß proteins were then detected with an antibody that recognizes all forms of Gß. Total Gß protein content was not different in samples from the different genotypes (Fig. 3A, left). In contrast, Gß3 protein content was markedly reduced in carriers of the T allele (Fig. 3A, right). Densitometric scanning and quantification demonstrated a statistically significant 80% reduction of Gß3 content in T compared to C homozygotes (157 + 78 vs. 824 + 272 OD · mm-2 · 100 µg-1 total protein, respectively; P = 0.02) (Fig. 3B). CT heterozygotes displayed an intermediate 57% reduction of Gß3 expression (351 + 129 OD · mm-2 · 100 µg-1 total protein). Combining the data from all T allele carriers revealed a significant difference in Gß3 protein content as compared to CC subjects (824 + 272 vs. 254 + 79 OD · mm-2 · 100 µg-1 total protein for CC and CT/TT carriers, respectively;P = 0.015). We could not observe any expression of the previously described Gß3-s protein in any of the samples. This could have been because of a low or absent expression of this splice variant in human adipocytes



View larger version (41K):
[in this window]
[in a new window]
 
FIG. 3. Gß protein content as measured by Western blot in fat cell of CT, CC, or TT carriers of the C825T polymorphism in the Gß3 gene. A: Total Gß content (left) and Gß3 content (right) in individual subjects. B: Box plot values of densitometric setting of right graph in A. The latter values were compared by ANOVA. IP, immunoprecipitation; WB, antibody for Western blot; Gß3-s, expected position of the spliced variant of Gß3.

 
To determine whether the reduced protein expression of Gß3 in TT carriers was specific, we ran additional Western blots on the same adipose samples described above (Fig. 4). Although the levels differed among subjects, the protein amount of {alpha}2A-adrenoceptor, ß2-adrenoceptor, G{alpha}i, or G{alpha}s was not influenced in a significant way by the C825T polymorphism (OD values not shown)



View larger version (49K):
[in this window]
[in a new window]
 
FIG. 4. Protein content (Western blot) of {alpha}2A-adrenoceptor ({alpha}2A-AR), ß2-adrenoceptor (ß2-AR), G{alpha}s, and G{alpha}i in adipose tissue of CC, CT, and TT carriers of the C825T polymorphism in the Gß3 gene. The subjects are the same as in Fig. 3.

 
Gß3 mRNA expression
Attempts were made to detect Gß3 and Gß3-s mRNA transcripts in C and T allele carriers using RT-PCR. Although several different protocols were attempted, including that previously published by Siffert et al. (4) and novel modifications by the same group of investigators (W. Siffert and D. Rosskopf, personal communication), we could not detect a Gß3 mRNA transcript in adipose tissue or in a number of other tissues, including platelets. Difficulties in detecting Gß3 mRNA in native human tissues has been experienced by other investigators (D. Rosskopf, personal communication). Because previously published studies of Gß3 mRNA have been performed only in cells overexpressing the Gß3 gene (2), our results could indicate that Gß3 mRNA is either highly unstable or is expressed at very small amounts, thereby preventing a reliable detection in native human tissue


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study demonstrated significant effects of the C825T polymorphism in the Gß3 gene on the function of several different native adrenergic receptor subtypes in apparently healthy obese subjects, as assessed by lipolysis in freshly isolated subcutaneous adipocytes. Using immortalized lymphoblasts and transfected insect cells, it was previously found that the C825T polymorphism influences signaling through G{alpha}i (2). However, the Gß protein is a common pathway for both G{alpha}i- as well as G{alpha}s-coupled receptors. Therefore, if functional, a structural variation in the Gß3 gene should influence both inhibitory and stimulatory G protein-coupled receptors. For lipolysis in fat cells, we found that the T variant of Gß3 in its homozygous form was associated with a marked decrease in pD2 values for terbutaline (ß2-adrenoceptor selective), dobutamine 1-adrenoceptor selective), and clonidine ({alpha}2-adrenoceptor selective). The responsiveness for these agents and for the nonselective ß-adrenergic agonist isoprenaline was also decreased. However, the polymorphism did not influence basal lipolysis, adenosine deaminase-induced lipolysis, or dcAMP-mediated lipolysis (the latter reflects actions at the most distal step in lipolysis action the protein kinase A hormone-sensitive complex). Our lipolysis data therefore suggest that the T-to-C substitution alters the Gß3 protein in a way that decreases signaling of ß1-, ß2-, and {alpha}2-adrenoceptors for adipocyte lipolysis at some earlier steps above protein kinase A. The polymorphism may have a more marked effect on G{alpha}s- than G{alpha}i-coupling, as responsiveness for norepinephrine was decreased in adipocytes of TT carriers. Norepinephrine’s effects on lipolysis reflect the net sum of ß- and {alpha}2- adrenoceptor signaling

The findings with lipolysis were surprising, as earlier studies on immortalized lymphoblasts have shown increased signal transduction, at least for G{alpha}i-coupled receptors (2). An increased efficiency of the G{alpha}i signaling complex in lipolysis experiments is predicted to increase clonidine pD2 and/or responsiveness in human adipocytes (16). To obtain a mechanistic insight, we studied Gß3 protein content in fat cells from a subset of subjects. The total Gß content was not influenced by the polymorphism. However, the amount of Gß3 was markedly decreased in adipocytes of 825T allele carriers. Furthermore, there was no apparent presence of the proposed alternative splice variant 3-s. This finding is in contrast to earlier findings with platelets that showed a normal content of full-length Gß3 (2). We believe that this is unlikely to be attributable to methodological reasons, as we used the same antibodies as in previous studies (2). However, we cannot exclude the presence of very low levels of Gß3-s protein in fat cells of 825T carriers that were below the detection limit of the present assays. The data are also at odds with earlier functional studies on the native protein. Thus, in vivo-stimulated coronary vasoconstriction through {alpha}2-adrenoceptors (G{alpha}i-coupled) has been found to be enhanced in C825T carriers as compared to C825C carriers (18). Furthermore, stimulation of interleukin-8 receptors (G{alpha}i-coupled) induced more prominent chemotaxis in neutrophils from individuals with the TC/TT genotypes than in those with the CC genotype (19). For the moment, we have no definite explanation for the divergence in these findings, although cell type-specific effects of the polymorphism are possible. For example, the 825T variation may cause alternative splicing in some cells (immortalized lymphoblasts, platelets), but decreased translational efficiency in other cells, such as fat cells. The complexity of G protein signaling, which involves numerous receptors and G protein subunit isoforms, allows for thousands of receptor-G protein combinations and variations in signal transduction (20,21). It is also possible that the splice variant influences other pathways involving G proteins in fat cells that were not investigated here (i.e., G{alpha}q and G{alpha}o). Furthermore, the alteration in adrenoceptor signal transduction in fat cells of T825T subjects was probably attributable to a selective alteration of Gß3. The reason for this is that the protein levels of other key regulators, such as ß2-adrenoceptor, {alpha}2-adrenoceptor, G{alpha}i, and G{alpha}s were not changed in TT carriers

Our results suggest that the noncoding C825T polymorphism affects the production of full-length Gß3 protein, possibly by affecting transcriptional and/or translational regulation. Unfortunately, it was not possible to study such events because of the lack of sufficient amounts of adipose tissue. We tried to measure Gß3 mRNA but were not able to amplify the gene product by PCR. It is difficult to obtain quantitative measures of Gß3 mRNA in native human cells and tissues (D. Rosskopf, personal communication). So far, only data with mRNA for Gß3 have been reported for an artificial cell system (2)

Whether the Gß3 polymorphism is of pathophysiological importance for insulin resistant conditions such as obesity is controversial. An association to obesity has been demonstrated in some studies (4) but not in others (22). If, however, the 3 polymorphism is a thrifty gene variation (8), it makes sense that the 825T allele is associated with impaired catecholamine-induced lipolysis in fat cells. A number of in vivo and in vitro studies have shown that catecholamine-induced lipolysis in subcutaneous adipose tissue is decreased in several insulin-resistant conditions, such as obesity, metabolic syndrome, familial combined hyperlipidemia, and polycystic ovary syndrome (10). The present results are also in line with studies on subjects with G{alpha}s deficiency. Such subjects are obese and have resistance to the in vivo lipolytic action of catecholamines as compared to matched controls (23). Thus, a reduction in adipocyte protein content of different subunits in Gs signaling (G{alpha}s and Gß3) seems to impair lipolysis activation by catecholamines in human fat cells. The present observation of low circulating levels of fatty acids and glycerol in fasted T825T subjects further supports the role of Gß3 in regulating lipolysis in man. We have previously shown that fasting circulating levels of glycerol and free fatty acids measured in the morning closely mirror the rate of lipolysis in subcutaneous adipose tissue (24)

It should be noted that in this study, only obese subjects were investigated, so we do not know the importance of the polymorphism in a lean population. Some attempts were made to analyze the clinical effects of C825T, bearing in mind that subjects with disorders comorbid with obesity, such as diabetes, hypertension, and dyslipidemia, were not included. The polymorphism had no apparent effect on BMI, insulin sensitivity, or plasma lipids. We included men and women in the study. It is unlikely that the findings were influenced to an important extent by sex, as we made statistical corrections for sex. Furthermore, in a subgroup analysis, the genotype effect on pD2 for all selective adrenergic agonists was statistically significant in women. It remains to be established, on the other hand, if the polymorphism is also functional in fat cells of obese men. Because of the paucity of obese men, it was not possible to make a reliable evaluation of the polymorphism in the male subgroup

In conclusion, the results of this study suggest that the C825T polymorphism in the Gß3 gene influences catecholamine-induced lipolysis in vitro and lipolysis in vivo. The polymorphism may regulate the content of Gß3 protein in human fat cells and thereby cause variations in lipolysis mediated by native G{alpha}i- as well as G{alpha}s-coupled receptors. The 825T allele appears to decrease the amount of Gß3 in fat cells and thereby inhibit signaling to lipolysis through ß1-, ß2-, and {alpha}2-adrenergic receptors, and the net effect is decreased catecholamine action. This effect may be a particular feature of the Gß3 gene in adipocytes, as 825T has been reported to actually increase G{alpha}i signal transduction in other native cells, possibly as a result of increased production of an alternative spliced short form of Gß3


    ACKNOWLEDGMENTS
 
This study was supported by grants from the Swedish Medical Research Council, Swedish Diabetes Association, Swedish Heart and Lung Foundation, and the Foundations of Novo Nordisk, Thuring and Söderberg, and the Swedish Medical Society

The excellent technical assistance of Eva Sjölin, Kerstin Wåhlen, Britt-Marie Leijonhufvud, and Catharina Hertel is greatly appreciated. We thank Professor Stephan Rössner for help in recruiting the obese subjects


    FOOTNOTES
 
Address correspondence and reprint requests to Peter Arner, MD, Professor the Center of Metabolism and Endocrinology, Huddinge Hospital, M63, 141 86 Huddinge, Sweden. E-mail: peter.arner{at}medhs.ki.se.

Received for publication 20 November 2000 and accepted in revised form 11 January 2002

dcAMP, dibutyryl cyclic AMP; EC50, half-maximum effective concentration; OD, optical density; pD2, negative logarithm of Ec50; TAE, Tris-acetate-EDTA; Taq, Thermophylus aquaticus.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Gautman N, Downes GB, Yan K, Kisselev O: The G-protein betagamma complex. Cell Signal7 :447 –455,1998
  2. Siffert W, Rosskopf D, Siffert G, Busch S, Moritz A, Erbel R, Sharma AM, Ritz E, Wichmann HE, Jakobs KH, Horsthemke B: Association of a human G-protein beta3 subunit variant with hypertension. Nat Genet18 :45 –48,1998[Medline]
  3. Siffert W: G protein and hypertension: an alternative candidate gene approach. Kidney Int53 :1466 –1470,1998[Medline]
  4. Siffert W, Forster P, Jockel KH, Mvere DA, Brinkmann B, Naber C, Crookes R, Du P Heyns A, Epplen JT, Fridey J, Freedman BI, Muller N, Stolke D, Sharma AM, Al Moutaery K, Grosse-Wilde H, Buerbaum B, Ehrlich T, Ahmad HR, Horsthemke B, Du Toit ED, Tiilkainen A, Ge J, Wang Y, Rosskopf D, et al: Worldwide ethnic distribution of the G protein beta3 subunit 825T allele and its association with obesity in Caucasian, Chinese and Black African individuals. J Am Soc Nephrol10 :1921 –1930,1999[Abstract/Free Full Text]
  5. Hegele RA, Anderson C, Young TK, Connelly PW: G-protein beta-3 subunit gene splice variant and body fat distribution in Nunavut Inuit. Genome Res9 :912 –917,1999
  6. Rosskopf D, Frey U, Eckerhardt S, Schmidt S, Ritz E, Hoffmann S, Jaksch M, Muller N, Husing J, Siffert W, Ocke KH: Interaction of the G protein ß3 subunit T825 allele and IRS-1 arg972 variant in type 2 diabetes. Eur J Med Res30 :484 –490,2000
  7. Gutersohn A, Naber C, Muller N, Erbel R, Siffert W: G protein beta3 subunit 825TT genotype and post-pregnancy weight retention. Lancet355 :1240 –1241,2000[Medline]
  8. Siffert W: G protein beta3 subunit 825T allele, hypertension, obesity and diabetic nephropathy. Nephrol Dial Transplant15 :1298 –1306,2000[Abstract/Free Full Text]
  9. Carpene C, Bousqute-Melou A, Galitsky J, Berlan M, Lafontan M: Lipolytic effects of beta1- beta2- and beta3-adrenergic agonists in white adipose tissue of mammals. Ann N Y Acad Sci839 :186 –189,1998[Free Full Text]
  10. Large V, Arner P: Regulation of lipolysis in humans: Pathophysiological modulation in obesity, diabetes, and hyperlipidemia. Diabetes Metab24 :409 –418,1998[Medline]
  11. Mauriege P, Imbeault P, Prud’Homme D, Tremblay A, Nadeau A, Despres JP: Subcutaneous adipose tissue metabolism at menopause: importance of body fatness and regional fat distribution. J Clin Endocrinol Metab85 :2446 –2454,2000[Abstract/Free Full Text]
  12. Andersson K, Eneroth P, Arner P: Changes in circulating lipid and carbohydrate metabolites following systemic nicotine treatment in healthy men. Int J Obes Relat Metab Disord17 :675 –680,1993[Medline]
  13. Kolaczynski JW, Morales LM, Moore JH Jr, Considine RV, Pietrzkowski Z, Noto PF, Colberg J, Caro JF: A new technique for biopsy of human abdominal fat under local anaesthesia with lidocaine. Int J Obes Relat Metab Disord18 :161 –166,1994[Medline]
  14. Reynisdottir S, Wahrenberg H, Carlström K, Rössner S, Arner P: Catecholamine resistance in fat cells of women with upper-body obesity due to decreased expression of beta 2 adrenoceptors. Diabetologia37 :428 –435,1994[Medline]
  15. Lönnqvist F, Krief S, Strosberg D, Nyberg B, Emorine LJ, Arner P: Evidence for a functional ß3-adrenoceptor in man. Br J Pharmacol110 :929 –936,1993[Medline]
  16. Arner P, Hellmér J, Wennlund A, Östman J, Engfelt P: Adrenoceptor occupancy in isolated human fat cells and its relationship with lipolysis rate. Eur J Pharmacol146 :45 –56,1988[Medline]
  17. Kenakin T: Drugs and receptors: an overview of the current state of knowledge. Drugs40 :666 –687,1990[Medline]
  18. Baumbart D, Naber C, Haude M, Oldenburg O, Erbel R, Heusch G, Siffert W: G protein beta3 subunit 825T allele and enhanced coronary vasoconstriction on alpha(2)-adrenoceptor activation. Circ Res85 :965 –969,1999[Abstract/Free Full Text]
  19. Virchow S, Ansorge N, Rosskopf D, Rubben H, Siffert W: The G protein beta3 subunit splice variant Gbeta3-s causes enhanced chemotaxis of human neutrophils in response to interleukin-8. Naunyn Schmiedebergs Arch Pharmacol360 :27 –32,1999[Medline]
  20. Ostrom RS, Post SR, Insel PA: Stoichiometry and compartmentation in G protein-coupled receptor signalling: implications for therapeutic interventions involving Gs. J Pharmacol Exp Ther294 :407 –412,2000[Abstract/Free Full Text]
  21. Hildebrandt JD: Role of subunit diversity in signaling by heterotrimeric G proteins. Biochem Pharmacol54 :325 –339,1997[Medline]
  22. Benjafield AV, Lin RC, Dalziel B, Gosby AK, Caterson ID, Morris BJ: G-protein beta3 subunit gene splice variant in obesity and overweight. Int J Obes Relat Metab Disord25 :777 –780,2001[Medline]
  23. Carel JC, Le Stunff C, Condamine L, Mallet E, Chaussain JL, Adnot P, Garabedian M, Bougneres P: Resistance of the lipolytic action of epinephrine: a new feature of protein Gs deficiency. J Clin Endocrinol Metab84 :4127 –4131,1999[Abstract/Free Full Text]
  24. Hagström-Toft E, Bolinder J, Ungerstedt U, Arner P: A circadian rhythm in lipid mobilization which is altered in IDDM. Diabetologia40 :1070 –1078,1997[Medline]

Add to CiteULike CiteULike   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
DiabetesHome page
M. Kolak, J. Westerbacka, V. R. Velagapudi, D. Wagsater, L. Yetukuri, J. Makkonen, A. Rissanen, A.-M. Hakkinen, M. Lindell, R. Bergholm, et al.
Adipose Tissue Inflammation and Increased Ceramide Content Characterize Subjects With High Liver Fat Content Independent of Obesity
Diabetes, August 1, 2007; 56(8): 1960 - 1968.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
S. L. Kirstein and P. A. Insel
Autonomic Nervous System Pharmacogenomics: A Progress Report
Pharmacol. Rev., March 1, 2004; 56(1): 31 - 52.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
W. Siffert
Effects of the G protein {beta}3-subunit gene C825T polymorphism: should hypotheses regarding the molecular mechanisms underlying enhanced G protein activation be revised? Focus on "A splice variant of the G protein {beta}3-subunit implicated in disease states does not modulate ion channels"
Physiol Genomics, April 16, 2003; 13(2): 81 - 84.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rydén, M.
Right arrow Articles by Arner, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rydén, M.
Right arrow Articles by Arner, P.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Diabetes Diabetes Care Clinical Diabetes Diabetes Spectrum