Diabetes 51:2056-2065, 2002
© 2002 by the American Diabetes Association, Inc.
Glucokinase Is the Likely Mediator of Glucosensing in Both Glucose-Excited and Glucose-Inhibited Central Neurons
Ambrose A. Dunn-Meynell1,2,
Vanessa H. Routh3,
Ling Kang2,
Larry Gaspers3, and
Barry E. Levin1,2
1 Department of Veterans Affairs Medical Center, East Orange, New Jersey
2 Department of Neurosciences, New Jersey Medical School, University of Medicine and Dentistry of New Jersey, Newark, New Jersey
3 Department of Pharmacology and Physiology, New Jersey Medical School, University of Medicine and Dentistry of New Jersey, Newark, New Jersey
 |
ABSTRACT
|
|---|
Specialized neurons utilize glucose as a signaling molecule to alter their firing rate. Glucose-excited (GE) neurons increase and glucose-inhibited (GI) neurons reduce activity as ambient glucose levels rise. Glucose-induced changes in the ATP-to-ADP ratio in GE neurons modulate the activity of the ATP-sensitive K+ channel, which determines the rate of cell firing. The GI glucosensing mechanism is unknown. We postulated that glucokinase (GK), a highMichaelis constant (Km) hexokinase expressed in brain areas containing populations of GE and GI neurons, is the controlling step in glucosensing. Double-label in situ hybridization demonstrated neuron-specific GK mRNA expression in locus ceruleus norepinephrine and in hypothalamic neuropeptide Y, pro-opiomelanocortin, and -aminobutyric acid neurons, but it did not demonstrate this expression in orexin neurons. GK mRNA was also found in the area postrema/nucleus tractus solitarius region by RT-PCR. Intracarotid glucose infusions stimulated c-fos expression in the same areas that expressed GK. At 2.5 mmol/l glucose, fura-2 Ca2+ imaging of dissociated ventromedial hypothalamic nucleus neurons demonstrated GE neurons whose intracellular Ca2+ oscillations were inhibited and GI neurons whose Ca2+ oscillations were stimulated by four selective GK inhibitors. Finally, GK expression was increased in rats with impaired central glucosensing (posthypoglycemia and diet-induced obesity) but was unaffected by a 48-h fast. These data suggest a critical role for GK as a regulator of glucosensing in both GE and GI neurons in the brain.
 |
INTRODUCTION
|
|---|
Specialized neurons utilize glucose as a signaling molecule rather than as an energy substrate. Glucose-excited (GE) neurons increase, whereas glucose-inhibited (GI) neurons decrease, their firing rate as ambient glucose levels rise (13). It is unclear how GI neurons sense glucose, but GE neurons function much like the pancreatic ß-cell, which utilizes the ATP-sensitive K+ (KATP) channel to sense glucose and regulate insulin secretion (27). Although many neurons contain KATP channels, few exhibit glucosensing properties (8,9). This makes control of glycolysis a major candidate as a regulator of ATP production and KATP channel activity (6). The pancreatic form of glucokinase (GK; hexokinase IV, ATP:D-glucose 6-phosphotransferase) is selectively expressed in brain areas where glucosensing neurons reside (5,1012). GK has the physiological properties that would make it an ideal regulator of glucosensing in neurons (6,13). Previous studies examined a role for GK in hypothalamic glucosensing neurons in brain slice preparations, where presynaptic inputs could not be excluded, and under conditions outside the physiological range of brain glucose (4,5). The current studies provide new data on the neurotransmitter and peptide phenotype of neurons expressing GK, the regulatory role of GK in isolated hypothalamic GE and GI neuron activity, and the in vivo conditions associated with altered brain GK expression.
 |
RESEARCH DESIGN AND METHODS
|
|---|
Animals.
All work was approved by the institutional animal care and use committee of the East Orange VA Medical Center. Animals were housed individually on a 12:12 h light:dark schedule at 2223°C with food (Purina rat chow #5001) and water available ad libitum, except where otherwise specified. For all but the Ca2+ imaging studies, outbred adult male Sprague-Dawley rats were either purchased (Charles River) or bred from an in-house colony of rats selectively bred from the outbred Sprague-Dawley stock for their propensity to gain weight on a high-energy diet (diet-induced obesity [DIO]) or resist such weight gain (diet resistance [DR]) (14). Animals were enrolled in studies between the ages of 2 and 5 months. For the Ca2+ imaging studies, outbred male pups between the ages of 12 and 20 days were used.
Expression of c-fos in response to intracarotid glucose infusion.
Under ketamine/xylazine anesthesia, right internal carotid artery PE10 catheters were implanted, facing cephalad (15). Rats were acclimated to the infusion procedure by daily carotid infusions of 0.9% saline for 10 min at 40 µl/min. After 34 days of saline infusion, rats were infused for 1 h with either glucose (4 mg · kg-1 body wt · min-1, n = 22) or equiosmolar mannitol (4 mg · kg-1 · min-1, n = 13) to perfuse the forebrain without altering plasma glucose or insulin levels (15). At 3 h after infusion onset, pentobarbital-anesthetized rats were perfused with 4% paraformaldehyde. Brains were removed, sunk in sucrose, and sectioned at 40 µm for c-fos immunocytochemistry with rabbit anti-fos antibody and diamino benzidine, with nickel intensification as chromagen (15).
Factors influencing brain GK mRNA expression.
GK mRNA in situ hybridization was performed in three rat models with known defects in brain glucosensing:
- Rats selectively bred to express the DIO trait have defective central glucosensing (14,16). Seven ad libitumfed, selectively bred DIO male rats were compared with seven selectively bred DR rats with normal glucosensing. Their brains were removed for assessment of GK mRNA between 0800 and 1000 h.
- The outbred population of Sprague-Dawley rats contains obesity-prone (DIO-prone) and obesity-resistant (DR-prone) rats that differ in intake, body weight, and fat only when fed a diet of moderate fat and caloric density (17). DIO-prone rats have defective glucosensing (1820) and can be identified prospectively by their high 24-h urinary norepinephrine excretion, as compared with DR-prone rats (17). Of 38 chow-fed, 3-month-old male rats, the 14 with the highest norepinephrine levels, as assessed by high-performance liquid chromatography (17), were designated as DIO-prone, and the 14 with the lowest levels were designated as DR-prone. Half of each of these groups were maintained on ad libitum chow and half were fasted for 48 h. Animals were decapitated between 0800 and 1000 h.
- A single hypoglycemic bout impairs central glucosensing because it significantly diminishes the counterregulatory response to subsequent hypoglycemia (21). Here, two groups of outbred rats were prospectively defined as DIO-prone (n = 11) versus DR-prone (n = 12) by their 24-h urine norepinephrine excretion. All rats were food deprived overnight, and then six DIO-prone and six DR-prone rats were injected by tail vein with insulin, 5 units/kg. The remaining five DIO-prone and six DR-prone rats were injected with 0.9% saline. Tail blood glucose levels fell to nadirs of
1.7 mmol/l over 3060 min in insulin-injected rats. At 70 min, 1 g/kg glucose was given intraperitoneally, and food was returned. Rats were killed 48 h after the injections.
In situ hybridization and immunocytochemistry.
Rats were decapitated and their brains were removed, frozen on dry ice, and maintained at -80°C until sectioned at 15 µm. Sense and antisense riboprobes were generated from plasmids containing inserts for mRNA of rat GK (GenBank no. M25807, bases 11422), neuropeptide Y (NPY) (no. M20373, bases 1511), Kir6.2 (no. X97041, bases 107599), GAD65 (no. M72422, bases 11966), pro-opiomelanocortin (POMC) (no. X03176.1, POMC exon 3, bases 46200; and J00759.1, POMC exon 2, bases 88742), and orexin (no. AF041241, bases 187473). Riboprobes were labeled with 35S (GK), fluorescein (GK), or digoxigenin (NPY, POMC, Kir6.2, GAD65, and orexin). Single and double in situ hybridizations were performed as previously described (12). In other conditions, double-label in situ hybridization was carried out using anti-fluorescein antibodies with fluorescent detection and anti-digoxigenin antibodies with NBT/BCIP (nitroblue tetrazolium chloride/5-brom-4-chloro-3-indolyl phosphate) visualization (9).
Double-label immunocytochemistry and in situ hybridization used techniques similar to those above (9). Slides were hybridized with 35S-labeled GK riboprobe and carried through the final wash with 0.1x sodium chloridesodium citrate at 60°C (see above). After blocking in 1% BSA, rabbit antityrosine hydroxylase (Chemicon), rabbit antineuron-specific nuclear protein (Chemicon), or rabbit antiglial fibrillary acidic protein (GFAP) (Dako) were applied at a 1:1,000 dilution. Biotinylated goat anti-rabbit antibody (Vector) was then applied at a 1:250 dilution, followed by Vectorstain peroxidase ABC kit (Vector). Peroxidase was visualized using diaminobenzidine or Vector SG reagent as chromagens. The sections were fixed in gluteraldehyde and dipped for autoradiography. Double-labeled slides were observed under bright-field illumination using differential focusing to separate silver grains and chromagen reaction. Photography at 60100x magnification was performed using light-field illumination to visualize the chromagen reaction, with a separate exposure using dark-field illumination in a different focal plane to visualize autoradiographic grains. The two images were then separately adjusted for contrast and combined digitally.
RT-PCR for GK message.
Slices were taken through the hypothalamus at the level of the paraventricular nucleus rostrally, the infundibular stalk caudally, and the optic tract laterally to include the paraventricular, arcuate (ARC), dorsomedial, and ventromedial hypothalamic (VMN) nuclei. A second sample was dissected from the caudal hindbrain at the level of the middle to caudal end of the nucleus tractus solitarius (NTS) to include the nuclear tract and the area postrema. Samples were weighed, frozen on dry ice, and homogenized. RNA was extracted using a Purescript RNA isolation kit (Gentra Systems). Samples were diluted to yield RNA extracted from 0.1 mg total tissue. They were reverse-transcribed using a Superscript first-strand synthesis kit for RT-PCR (Gibco) and then treated with DNase (Promega). PCR was performed (12) using primers for rat GK (forward GTGGTGCTTTTGAGACCCGTT, reverse TTCGATGAAGGTGATTTCGCA; corresponding to GenBank no. M25807, bases 965985 and 13051285, respectively) or cyclophilin (forward GGGGAGAAAGGATTTGGCTA, reverse ACATGCTTGCCATCCAGCC; corresponding to no. M19533, bases 166185 and 422404). The magnesium concentration was 15 mmol/l.
Calcium imaging of glucosensing neurons.
Single VMN neurons were prepared from the brains of 12- to 20-day-old outbred Sprague-Dawley rats with slight modifications of the procedures of Routh et al. (7). After decapitation, brains were rapidly removed and placed in ice-cold oxygenated (95% O2/5% CO2) perfusion buffer (in mmol/l: 2.5 KCl, 1.25 NaH2PO4, 28.0 NaHCO3, 7.0 MgCl2, 0.5 CaCl2, 7.0 glucose, 1 ascorbate, and 3 pyruvate). Coronal hypothalamic sections (350 µm) containing the VMN were cut on a vibratome and then immediately transferred to Hibernate-A medium supplemented with 0.1% (vol/vol) B-27. After shaking for 10 min at 34°C, slices were transferred to Hibernate-A medium containing papain (2 mg/ml), incubated for 30 min at 30°C, and allowed to recover for 10 min in enzyme-free solution. The VMN was punched with a 500-µm blunt needle, placed into Hibernate-A medium, and gently triturated using a fire-polished Pasteur pipette. Triturated pieces were allowed to settle for 2 min. The supernatant was removed, and the sediment was resuspended and subjected to two further triturations. The combined cells from the three triturations were resuspended, plated on poly-D-lysine (5 µg/cm2)coated glass coverslips, and maintained in a HEPES-buffered balanced salt solution (in mmol/l: 135 NaCl, 5 KCl, 1 CaCl2, 1 MgCl2, 10 HEPES, pH 7.4, and 2.5 glucose). Fluorescent imaging measurement of intracellular Ca2+ ([Ca2+]i) was carried out using fura-2, essentially as previously described (22). VMN neurons attached to coverslips were loaded with 2.5 µmol/l fura-2 acetoxymethyl ester (Molecular Probes) for 20 min in Hanks balanced salt solution (HBSS) containing 0.25% (wt/vol) fatty acidfree BSA. Cells were washed twice with HBSS to remove free fura-2 and transferred to a thermostatically regulated microscope chamber (37°C). Fura-2 fluorescence images, acquired by alternating excitation at 340 and 380 nm and emissions (420600 nm), were collected using a cooled, charge-coupled device camera. Values for [Ca2+]i were calculated from the 340/380-nm fluorescence ratio after correction for autofluorescence. Autofluorescence values were obtained at the end of each experiment by permeabilizing the neurons with digitonin (20 µg/ml) in an intracellular-like medium containing a Ca2+-EGTA buffer and 2 mmol/l ATP/Mg. The fura-2 calibration parameters were determined in vitro using a half-maximal binding (Kd) value of 224 nmol/l (23).
All experiments began with neurons held at 2.5 mmol/l glucose (3). Neurons that showed spontaneous [Ca2+]i fluctuations in 2.5 mmol/l glucose and cessation of these fluctuations in 0.5 mmol/l glucose were defined as GE. Those without spontaneous [Ca2+]i fluctuations in 2.5 mmol/l glucose, but with spontaneous fluctuations at 0.5 mmol/l glucose, were defined as GI (3). Those neurons that exhibited no change in their spontaneous fluctuations of [Ca2+] i with alterations of extracellular glucose were designated as nonglucosensing (NG). Then, various doses of four different selective inhibitors of GK were applied. These included freshly prepared alloxan (0.110 mmol/l) (24,25), mannoheptulose (15 mmol/l) (4,5,24,26), glucosamine (510 mmol/l) (27), and N-acetylglucosamine (14 mmol/l) (28). In addition, catalase (4,000 units/ml) or dimethylthiourea (4 mmol/l) was added to GE and GI neurons in the presence of alloxan (4 mmol/l) to exclude the possibility that the inhibitory action of alloxan on GE neurons might be caused by the formation of oxygen free radicals (29). Finally, neurons were tested with either 50200 µmol/l tolbutamide or 20 nmol/l glutamate for responsiveness.
Data analysis.
In situ hybridization autoradiographic films were read by an experimentally blinded observer. Measurements were made of the areas (mm2) over which the hybridized, radiolabeled GK probe exposed the film in the paraventricular nucleus, ARC, VMN, and dorsomedial hypothalamic and medial amygdalar nuclei (30). For each brain, the three largest areas in each of these nuclei were selected. The product of area and optical densities of these areas was then averaged as arbitrary units to provide a semiquantitative estimate of the amount of GK mRNA expressed (21). Treatment effects were then analyzed by one-, two-, or three-way ANOVA with post hoc analysis by Scheffes F test.
 |
RESULTS
|
|---|
Phenotype of cells expressing GK mRNA and colocalization with glucose-induced c-fos expression.
In situ hybridization demonstrated that GK mRNA was present only in cells with neuronal phenotypes (neuron-specific nuclear protein, Kir6.2, NPY, POMC, GAD65, tyrosine hydroxylase) but not in astrocytes (GFAP) (Fig. 1). However, GK expression by oligodendroglia or microglia cannot be ruled out because these cell types were not assessed. Furthermore, lateral hypothalamic orexin neurons did not express GK mRNA (Fig. 1), even though GK mRNA is present in the lateral hypothalamus, as assessed by RT-PCR (12). Similarly, although we previously found no GK mRNA by in situ hybridization in the area postremaNTS (12), GK mRNA was demonstrable there by RT-PCR (Fig. 2).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 1. Demonstration of the cellular location of GK mRNA in the brain by double-label in situ hybridization (Kir6.2 [the K+ pore-forming unit of the KATP channel], NPY, POMC, GAD 65, and orexin) or in situ hybridization for GK mRNA combined with immunocytochemistry for neuron-specific nuclear protein (NEURON SPEC. NUC. PROT.), tyrosine hydroxylase (TH), or GFAP. In all panels, except NPY, the black grains are autoradiograms of radiolabeled GK mRNA, whereas the chromagen labeling represents the neuronal or glial phenotype. The NPY panel is a computer-assisted overlay of cells labeled for NPY (red) and GK (green) mRNA. Neuron-specific nuclear protein, GFAP, and GAD65 ( -aminobutyric acid) panels are from the VMN. NPY and POMC neurons are from the ARC. Tyrosine hydroxylase labels noradrenergic neurons in the locus ceruleus. Orexin neurons are from the lateral hypothalamic area. In all cases, arrows point to double-labeled cells expressing GK, whereas arrowheads show lateral hypothalamic orexin neurons that did not express GK mRNA. The scale bar (20 µm) holds for all panels.
|
|

View larger version (83K):
[in this window]
[in a new window]
|
FIG. 2. Gel of RT-PCR products of GK and cyclophilin cDNA extracted from microdissected pieces of the hypothalamus and NTSarea postrema (NTS/AP) as compared with a DNA ladder.
|
|
Bilateral forebrain perfusion by intracarotid glucose infusions increased c-fos expression in a number of forebrain areas (Fig. 3B, E, and H), as compared with equiosmolar mannitol control infusions (Fig. 3A, D, and G). This suggests direct or indirect activation of GE neurons. This glucose-induced c-fos expression paralleled GK expression in several brain areas. In the paraventricular nucleus, both GK (Fig. 3C) and c-fos (Fig. 3B) expression were predominantly seen in the ventral tier and the dorsal cap (not shown) of cells where autonomic efferent neurons reside (31). In the medial amygdalar nucleus, GK mRNA expression was concentrated in the postero-dorsal and postero-ventral portions (Fig. 3I), where the greatest number of c-fosexpressing cells was seen (Fig. 3H). There was some mismatch between the relative quantity and/or subnuclear localization of GK mRNA (Fig. 3F) versus c-fos (Fig. 3E) expression in the ARC, VMN, and dorsomedial nucleus. In the ARC, GK mRNA expression was relatively uniform, whereas c-fosexpressing cells were relatively sparse and more laterally placed in areas where POMC neurons are located (32). In the VMN, GK mRNA was concentrated at the ventrolateral and dorsomedial poles, whereas c-fosexpressing cells were relatively sparse and mostly located in the dorsomedial subdivision. In the dorsomedial nucleus, GK expression was relatively diffuse, whereas only a few scattered cells expressed c-fos. These mismatches may be due to the fact that both GE and GI neurons are intermixed in these areas. Although both GE and GI neurons appear to express GK (see below), only GE neurons would be activated and, therefore, express c-fos when ambient glucose levels were raised.

View larger version (129K):
[in this window]
[in a new window]
|
FIG. 3. Overlapping distribution of c-fos expression after 1 h of intracarotid glucose infusions (4 mg · kg-1 · min-1) (B, E, and H) versus equiosmolar mannitol control infusions (A, D, and G), as compared with GK mRNA (film autoradiographs) (C, F, and I) in the paraventricular nucleus (PVN), ARC, VMN, and the dorsomedial hypothalamic (DMN), medial posteroventral (MePV), and medial posterodorsal (MePD) amygdalar nuclei. OT, optic tract; 3rd, third ventricle. All scale bars are 250 µm.
|
|
Three broad categories of VMN neurons were identified by their changes in [Ca2+]i oscillations in response to altered ambient glucose concentrations. GE neurons increased [Ca2+]i oscillations when glucose levels were raised to 2.5 mmol/l, and they reduced oscillations at 0.5 mmol/l (Fig. 4A, C, D, E, F, J, K, and L). GI neurons decreased [Ca2+]i oscillations when glucose levels were raised to 2.5 mmol/l and increased them when glucose was reduced to 0.5 mmol/l (Fig. 4B and G). NG neurons were of two types. Most were inactive at either 0.5 mmol/l or 2.5 mmol/l glucose (Fig. 4H and I), whereas some showed spontaneous [Ca2+]i oscillations at either concentration (data not shown). Neither type of NG neuron altered its [Ca2+]i oscillations when glucose concentrations changed. Of 109 VMN neurons evaluated, 21 (19.3%) were GE, 15 (13.8%) were GI, and 73 (67.0%) were NG. All GE neurons responded to the sulfonylurea tolbutamide by increasing [Ca2+]i oscillations. However, 1030% of both GI and NG neurons also responded to 50200 µmol/l tolbutamide by increasing their [Ca2+]i oscillations (Fig. 4B and H) (3).

View larger version (82K):
[in this window]
[in a new window]
|
FIG. 4. Calcium imaging data from dissociated VMN neurons. A: GE neuron shows spiking [Ca2+]i oscillations at 2.5 mmol/l glucose (G), which cease at 0.5 mmol/l and are reinstated back in 2.5 mmol/l glucose. The addition of 200 µmol/l tolbutamide (Tolbut) with cells in 0.5 mmol/l glucose increases [Ca2+] i oscillations. B: GI neuron with many [Ca2+]i oscillations at 0.5 mmol/l glucose but none at 2.5 mmol/l glucose. The addition of 200 µmol/l tolbutamide increases the peak height of oscillations slightly above the level seen at 0.5 mmol/l glucose. C: GE neuron shows markedly reduced [Ca2+] i oscillations with the addition of 3 mmol/l alloxan at 2.5 mmol/l glucose. There is a rapid increase in oscillations after the addition of 20 nmol/l glutamate (Glut) in the continued presence of 3 mmol/l alloxan (Al3). D: GE neuron in which [Ca2+]i oscillations are inhibited by 4 mmol/l alloxan (Al4) and reinstated by 100 and 200 µmol/l tolbutamide. E: GE neuron in which [Ca2+]i oscillations are inhibited in the presence of both 4 mmol/l alloxan and 4,000 units/ml catalase (Cat). F: GE neuron in which [Ca2+]i oscillations are inhibited in the presence of 4 mmol/l alloxan. The addition of 4 mmol/l dimethylthiourea (DT) in the presence of alloxan does not reverse the alloxan inhibition. G: GI neuron in which [Ca2+]i oscillations are inhibited at 2.5 mmol/l glucose but stimulated by 4 mmol/l alloxan. There was no effect of 50 or 200 µmol/l tolbutamide in this cell. H: NG neuron in which [Ca2+]i oscillations are stimulated by neither alterations in glucose concentration (0.5 or 2.5 mmol/l) nor addition of 4 mmol/l alloxan. Oscillations are stimulated by the addition of both 50 and 200 µmol/l tolbutamide in the continued presence of alloxan and 2.5 mmol/l glucose. I: NG neuron that is unresponsive to changes in glucose or addition of 4 mmol/l alloxan but in which [Ca2+]i oscillations are increased by the addition of 20 nmol/l glutamate. J: GE neuron in which [Ca2+]i oscillations are inhibited by glucosamine (GS). K: GE neuron in which [Ca2+]i oscillations are inhibited by increasing doses of N-acetylglucosamine (NAG). L: GE neuron in which [Ca2+] i oscillations are inhibited by 4 mmol/l but not 2 mmol/l mannoheptulose (Man). Vertical arrows indicate the point at which reagents were added and horizontal lines represent the continuous presence of the indicated reagents.
|
|
Four inhibitors of GK activity were assessed in these neurons (Table 1). A "response" in GE neurons held at 2.5 mmol/l glucose was defined as abolition of [Ca2+]i oscillations in the presence of the inhibitor. A "response" in GI neurons held at 2.5 mmol/l glucose was defined as an increase in [Ca2+]i oscillations in the presence of the inhibitor. The majority of the trials were carried out with alloxan, which had an half-maximal inhibitory concentration (IC50) of 3 mmol/l for inhibition of [Ca2+]i oscillations in GE neurons between 0.1 and 10 mmol/l. Overall, 71% of GE and 72% of GI neurons responded to alloxan (Table 1; Fig. 4C, D, E, F, and G). In GE neurons, the alloxan effect was reversed by glutamate (Fig. 4C), tolbutamide (Fig. 4D), or a glucose concentration approximately twofold greater than that of alloxan (data not shown). In addition, alloxans effect was unaltered in either GE or GI neurons by the addition of the free radical scavengers catalase (4,000 units/ml) (Fig. 4E) or dimethylthiourea (4 mmol/l) (Fig. 4F; data not shown for GI neurons). NG neurons were unaffected by alloxan and could still be stimulated by either tolbutamide (Fig. 4H) or glutamate (Fig. 4I). Glucosamine (510 mmol/l) (Table 1; Fig. 6J), N-acetylglucosamine (14 mmol/l) (Table 1; Fig. 4K), and mannoheptulose (15 mmol/l) (Table 1; Fig. 4L) inhibited [Ca2+] i oscillations in GE neurons and increased [Ca2+]i oscillations in GI neurons held at 2.5 mmol/l glucose. The four GK inhibitors reduced [Ca2+]i oscillations in 29100% of GE neurons and increased them in 72100% of GI neurons (Table 1). Although the number of neurons examined with glucosamine, N-acetylglucosamine, and mannoheptulose was relatively small, glucosamine was the most effective inhibitor, and N-acetylglucosamine was the least effective in GE neurons. On the other hand, alloxan was least effective in GI neurons, yet it still stimulated [Ca2+]i oscillations in 72% of them (Table 1).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 6. Semiquantitative expression (area x optical density [OD] in arbitrary units) of GK mRNA by film in situ hybridization in outbred DIO- and DR-prone rats at 48 h after a single bout of insulin-induced hypoglycemia (A) or after 48 h of food deprivation (B). Data are means ± SE (n = 58 rats per group). Bars with dissimilar superscript letters differ from each other at P 0.05. DMN, dorsomedial nucleus; PVN, paraventricular nucleus; MAN, medial amygdalar nucleus.
|
|
In vivo regulation of GK mRNA expression.
GK mRNA was examined by in situ hybridization in three models of defective central glucosensing. First, selectively bred DIO rats had a selective, 44% increase in GK mRNA expression in the ARC as compared with DR rats (P = 0.001) (Fig. 5A). Second, outbred DIO-prone rats had a generalized increase in GK mRNA expression across all five areas assessed (F [4,109] = 3.26, P = 0.014) (Fig. 5B). By post hoc analysis, this increase, as compared with DR-prone rats, was significant in the ARC (124%; P = 0.001), dorsomedial hypothalamic (68%; P = 0.01), and medial amygdalar (82%; P = 0.01) nuclei. Third, rats studied at 48 h after a prior bout of hypoglycemia had a generalized increase in GK mRNA expression across all regions compared with saline-treated rats (F [1,63] = 8.83, P = 0.004) (Fig. 6A). These increases reached post hoc statistical significance in the VMN (F [1,18] = 9.39, P = 0.001) of both DR-prone (37% higher) and DIO-prone (26% higher) rats subjected to hypoglycemia and in the medial amygdalar nucleus (F [1,18] = 20.41, P = 0.0001) for both DR-prone (82% higher) and DIO-prone (60% higher) phenotypes. On the other hand, there were no differences in GK expression, regardless of DR- or DIO-prone phenotype, associated with a 48-h fast (Fig. 6B).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 5. Semiquantitative (area x optical density [OD] in arbitrary units) expression of GK mRNA by film in situ hybridization in selectively bred DIO versus DR rats (A) and outbred DIO- versus DR-prone rats (B). Data are means ± SE (n = 58 rats per group). Bars with dissimilar superscript letters differ from each other at P 0.05. DMN, dorsomedial nucleus; PVN, paraventricular nucleus; MAN, medial amygdalar nucleus.
|
|
 |
DISCUSSION
|
|---|
The current studies tested the hypothesis that GK is a critical mediator of glucosensing in neurons. We previously showed that GK mRNA is selectively expressed in brain areas containing mixed populations of both GE and GI neurons. A notable exception was the NTS, where in situ hybridization showed no signal (12). But RT-PCR here shows GK mRNA to be present in that area. In addition, we show that GK mRNA is expressed in a variety of neuropeptide and transmitter neurons involved in glucose- and metabolic-sensing brain areas. Also, the subnuclear distribution of GK mRNA within selected brain nuclei overlaps significantly with in vivo glucose-activated c-fos expression. We also show for the first time that four different GK inhibitors decrease spontaneous [Ca2+] i oscillations in isolated VMN GE neurons and increase oscillations in GI neurons held at physiologically relevant glucose concentrations. Finally, we present the novel finding that brain GK mRNA expression is increased in three different in vivo models in which there is defective central glucosensing, but it was unaffected by a 48-h fast. All of these findings point to a role for GK as the likely mediator of neuronal glucosensing.
GE neurons are similar to pancreatic ß-cells in many ways. Both appear to utilize GK to regulate the ATP-to-ADP ratio (46,12). When glucose metabolism increases this ratio, the KATP channel (composed of the Kir6.2 K+ pore-forming unit and a sulfonylurea receptor) (33) is inactivated. This depolarizes the neuron, accompanied by Ca2+ influx through a voltage-activated Ca2+ channel (33). Sulfonylurea receptor occupancy also inactivates the channel and depolarizes the cell (33). The KATP channel is ubiquitous in neurons throughout the brain and is thus necessary, but not sufficient, to be the sole regulator of GE neuron glucosensing (8,9). Similarly, glucose transport is probably not a key regulator of neuronal glucosensing because the predominant neuronal transporter, GLUT-3, is ubiquitous and saturated at physiological brain glucose concentrations (34). Other brain glucose transporters (GLUT-1, -2, -4, and -8) have either inappropriate anatomic or cell type localizations (3538).
As in the pancreatic ß-cell, (6), our data show that GK is the likely rate-limiting step in glucosensing in both GE and GI neurons. As compared with hexokinase I, which has a ubiquitous neuronal distribution, low Michaelis constant (Km), and end product inhibition (39, 40), GK has the proper kinetics, lack of end product inhibition, and selective distribution required for this role (6,11,12). GK is expressed in brain areas in which GE neurons have been identified electrophysiologically (1,35) and where intracarotid glucose stimulates c-fos expression. GK is also expressed in areas where GI neurons reside (3, 41) and where hypoglycemia induces c-fos expression (42). Using high-stringency conditions, we previously found no GK expression by in situ hybridization in lateral hypothalamus or the area postremaNTS (12) where glucosensing neurons reside (4345). But GK mRNA is demonstrable in both areas by RT-PCR, suggesting that in situ hybridization is not sensitive enough to demonstrate the low levels of GK mRNA present (12).
Ca2+ imaging in dissociated GE and GI VMN neurons shows that they function within the physiological range of brain glucose levels (3, 46). GE neurons decreased, and GI neurons increased, [Ca2+] i fluctuations as extracellular glucose levels fell from 2.5 to 0.5 mmol/l glucose. As shown in electrophysiological studies of VMN neurons (3), all GE neurons and some GI and NG neurons responded to sulfonylureas, suggesting that they contain the KATP channel. The relative proportion and the glucose and sulfonylurea response properties of dissociated VMN GE and GI neurons identified by Ca2+ imaging here are similar to those seen in whole-cell current-clamp studies of VMN neurons in hypothalamic slices (3). This suggests that the evoked [Ca2+] i oscillations are a reasonable surrogate for altered neuronal activity. Furthermore, the use of dissociated cells specifically excludes presynaptic inputs from producing changes in [Ca2+]i oscillations (3). The results with four different GK inhibitors suggest that glucosensing in these dissociated neurons depends on GK regulation of ATP production. GK inhibition should lower the ATP-to-ADP ratio, activate the KATP channel, and inactivate GE neurons. Similarly, lowering the ATP-to-ADP ratio by GK inhibition in quiescent GI neurons at 2.5 mmol/l glucose activated them. This might be mediated by an ATP-activated K+ channel (47), a chloride channel (3), or the Na+-K+-ATP pump (41). GK inhibition was specific to glucosensing neurons because the inhibitors had no effect on NG neurons, which presumably utilize hexokinase I to mediate glycolysis (40). Although alloxan is probably the most selective GK inhibitor (24,25), it can also produce toxicity by generation of free radicals (48). However, the doses and exposure times used here produced no toxicity. Alloxans effects were washed out by drug removal or high glucose concentrations. Cells also remained responsive to activation by glutamate and sulfonylureas, and alloxan increased activity in GI neurons. Finally, alloxans effect was unaltered by free radical scavengers. In GE neurons, alloxan half-maximally inhibited Ca2+ influx at 3 mmol/l, whereas the IC50 in ß-cells is 25 µmol/l (25,49). This reduced potency suggests that glucosensing neurons lack GLUT-2, which is the preferred glucose transporter for alloxan in the ß-cell (50). Finally, the heterogeneous responses to the GK inhibitors might reflect variations in GK activity, similar to what is seen in pancreatic ß-cells (51).
Many of the neurons that express GK mRNA are involved in energy homeostasis and respond to a variety of metabolic signals from the periphery, such as leptin and insulin. This suggests that they are actually "metabolic sensors" (2). This includes ARC NPY (52) and POMC (53), as well as -aminobutyric acid (54) and locus ceruleus noradrenergic neurons (55). ARC NPY neurons appear to be GI (52) and POMC neurons GE (56), and both contain GK mRNA. This is compatible with our findings that both GI and GE neurons utilize GK for glucosensing. Metabolic perturbations might also affect neuronal glucosensing by altering the expression of GK. Although brain and pancreatic GK are homologous (5,11), pancreatic GK was reduced by fasting (57), whereas brain GK mRNA was not. However, brain GK expression was increased in animals with defective central glucosensing. The increased hypothalamic GK expression seen 48 h after hypoglycemia might be a compensatory response to hypoglycemia-induced neuronal damage and consequent defective central glucosensing produced by prior hypoglycemia (21). It might also play a pathogenic role in the development of hypoglycemia-associated autonomic failure. Similarly, the increased brain GK expression in both outbred DIO-prone and selectively bred DIO rats might be a compensatory response to their multiple defects in central glucosensing (3, 16,1820,58).
In conclusion, GK appears to be the rate-limiting step controlling glucosensing in both GE and GI neurons. It is expressed in neurons with known glucosensing and metabolic sensing properties. Inhibition of GK activity alters the kinetics of [Ca2+]i oscillations in both GE and GI VMN neurons, suggesting that GK activity is critical to their functioning as glucosensors. GK expression is also specifically upregulated in rat models that are known to have defective central glucosensing, but it is unaffected by a state of negative energy balance induced by fasting. Taken together, these data suggest that manipulation of brain GK might afford a means to alter central glucosensing.
 |
ACKNOWLEDGMENTS
|
|---|
This work was funded by the Research Service of the Veterans Administration and the National Institute of Diabetes and Digestive and Kidney Diseases (DK-53181, to A.A.D.-M., B.E.L., and L.K.) and an American Diabetes Association Career Development Award and NRSA-1F32NS10335-01 (to V.H.R.).
The authors thank Antoinette Moralishvilli, Charlie Salter, Guofeng Zhou, and Odeal Gordon for technical assistance.
 |
FOOTNOTES
|
|---|
Address correspondence and reprint requests to Barry E. Levin, MD, Neurology Service (127C), VA Medical Center, 385 Tremont Ave., East Orange, NJ 07018-1095. E-mail: levin{at}umdnj.edu.
Received for publication 14 March 2002 and accepted in revised form 18 April 2002.
ARC, arcuate nucleus; [Ca2+]i, intracellular Ca2+; DIO, diet-induced obesity; DR, diet resistance; GE, glucose-excited; GFAP, glial fibrillary acidic protein; GI, glucose-inhibited; GK, glucokinase; HBSS, Hanks balanced salt solution; IC50, half-maximal inhibitory concentration; KATP channel, ATP-sensitive K+ channel; NG, nonglucosensing; NPY, neuropeptide Y; NTS, nucleus tractus solitarius; POMC, pro-opiomelanocortin; VMN, ventromedial hypothalamic nucleus.
 |
REFERENCES
|
|---|
-
Oomura Y, Ono T, Ooyama H, Wayner MJ: Glucose and osmosensitive neurons of the rat hypothalamus. Nature 222:282284, 1969[Medline]
-
Levin BE, Dunn-Meynell AA, Routh VH: Brain glucose sensing and body energy homeostasis: role in obesity and diabetes. Am J Physiol 276:R1223R1231, 1999[Abstract/Free Full Text]
-
Song Z, Levin BE, McArdle JJ, Bakhos N, Routh VH: Convergence of pre- and postsynaptic influences on glucosensing neurons in the ventromedial hypothalamic nucleus. Diabetes 50:26732681, 2001[Abstract/Free Full Text]
-
Ashford MLJ, Boden PR, Treherne JM: Glucose-induced excitation of hypothalamic neurones is mediated by ATP-sensitive K+ channels. Pflugers Arch 415:479483, 1990[Medline]
-
Yang X, Kow L-M, Funabashi T, Mobbs CV: Hypothalamic glucose sensor: similarities to and differences from pancreatic ß-cell mechanisms. Diabetes 48:17631772, 1999[Abstract]
-
Matschinsky FM, Ellerman JE: Metabolism of glucose in the islets of Langerhans. J Biol Chem 243:27302736, 1968[Abstract/Free Full Text]
-
Routh VH, McArdle JJ, Levin BE: Phosphorylation modulates the activity of the ATP-sensitive K+ channel in the ventromedial hypothalamic nucleus. Brain Res 778:107119, 1997[Medline]
-
Karschin C, Ecke C, Ashcroft FM, Karschin A: Overlapping distribution of KATP channel-forming unit Kir6.2 subunit and the sulfonylurea receptor SUR1 in rodent brain. FEBS Lett 401:5964, 1997[Medline]
-
Dunn-Meynell AA, Rawson NE, Levin BE: Distribution and phenotype of neurons containing the ATP-sensitive K+ channel in rat brain. Brain Res 814:4154, 1998[Medline]
-
Jetton TL, Liang Y, Pettepher CC, Zimmerman EC, Cox FG, Horvath K, Matschinsky FM, Magnuson MA: Analysis of upstream glucokinase promoter activity in transgenic mice and identification of glucokinase in rare neuroendocrine cells in the brain and gut. J Biol Chem 269:36413654, 1994[Abstract/Free Full Text]
-
Roncero I, Alvarez E, Vazques P, Blazquez E: Functional glucokinase isoforms are expressed in rat brain. J Neurochem 74:18481857, 2000[Medline]
-
Lynch RM, Tompkins LS, Brooks HL, Dunn-Meynell AA, Levin BE: Localization of glucokinase gene expression in the rat brain. Diabetes 49:693700, 2000[Abstract]
-
Magnuson MA: Glucokinase gene structure: functional implications of molecular genetic studies. Diabetes 39:523527, 1990[Abstract]
-
Levin BE, Dunn-Meynell AA, Balkan B, Keesey RE: Selective breeding for diet-induced obesity and resistance in Sprague-Dawley rats. Am J Physiol 273:R725R730, 1997[Abstract/Free Full Text]
-
Dunn-Meynell AA, Govek E, Levin BE: Intracarotid glucose infusions selectively increase Fos-like immunoreactivity in paraventricular, ventromedial and dorsomedial nuclei neurons. Brain Res 748:100106, 1997[Medline]
-
Routh VH, Levin BE, McArdle JJ: Defective ATP-sensitive K+ (KATP) channel in ventromedial hypothalamic nucleus (VMN) of obesity-prone (DIO) rats. FASEB J 12:A864, 1998
-
Levin BE: Sympathetic activity, age, sucrose preference and diet-induced obesity. Obes Res 1:281287, 1993[Medline]
-
Levin BE: Intracarotid glucose-induced norepinephrine response and the development of diet-induced obesity. Int J Obesity 16:451457, 1992[Medline]
-
Levin BE, Brown KL, Dunn-Meynell AA: Differential effects of diet and obesity on high and low affinity sulfonylurea binding sites in the rat brain. Brain Res 739:293300, 1996[Medline]
-
Levin BE, Dunn-Meynell AA: In vivo and in vitro regulation of [3H]glyburide binding to brain sulfonylurea receptors in obesity-prone and resistant rats by glucose. Brain Res 776:146153, 1997[Medline]
-
Tkacs NC, Dunn-Meynell AA, Levin BE: Presumed apoptosis and reduced arcuate nucleus neuropeptide Y and pro-opiomelanocortin mRNA in non-coma hypoglycemia. Diabetes 49:820826, 2000[Abstract]
-
Morgan AJ, Thomas AP: Single cell and subcellular measurement of intracellular Ca2+ concentration ([Ca2+]i): Methods Mol Biol 114:93123, 1999[Medline]
-
Grynkiewicz G, Poenie M, Tsien RY: A new generation of Ca2+ indicators with greatly improved fluorescence properties. J Biol Chem 260:34403450, 1985[Abstract/Free Full Text]
-
Lenzen S, Tiedge M, Panten U: Glucokinase in pancreatic B-cells and its inhibition by alloxan. Acta Endocrinol 115:2129, 1987
-
Meglasson MD, Burch PT, Berner DK, Najafi H, Matschinsky FM: Identification of glucokinase as an alloxan-sensitive glucose sensor of the pancreatic ß-cell. Diabetes 35:11631173, 1986[Abstract]
-
Sweet IR, Li G, Najafi H, Berner D, Matschinsky FM: Effect of a glucokinase inhibitor on energy production and insulin release in pancreatic islets. Am J Physiol 271:E606E625, 1996[Abstract/Free Full Text]
-
Fujimoto K, Sakata T, Shiraishi T, Kurata K, Terada K, Etou H: Anorexia induced in rat by D-glucosamine deoxidized at C-1. Am J Physiol 251:R481R491, 1986
-
Moukil MA, Veiga-da-Cunha M, Van Schaftingen E: Study of the regulatory properties of glucokinase by site-directed mutagenesis: conversion of glucokinase to an enzyme with high affinity for glucose. Diabetes 49:195201, 2000[Abstract]
-
Kwan CY, Beazley JS: Mechanism of inhibition by alloxan of ATP-driven calcium transport by vascular smooth muscle microsomes. J Bioenerg Biomembr 20:517531, 1988[Medline]
-
Levin BE, Dunn-Meynell AA: Dysregulation of arcuate nucleus preproneuropeptide Y mRNA in diet-induced obese rats. Am J Physiol 272:R1365R1370, 1997[Abstract/Free Full Text]
-
Sawchenko PE, Swanson LW: Immunohistochemical identification of neurons in the paraventricular nucleus of the hypothalamus that project to the medulla or to the spinal cord in the rat. J Comp Neurol 205:260272, 1982[Medline]
-
Baskin DG, Breininger JF, Schwartz MW: Leptin receptor mRNA identifies a subpopulation of neuropeptide Y neurons activated by fasting in rat hypothalamus. Diabetes 48:828833, 1999[Abstract]
-
Aguilar-Bryan L, Clement JP 4th, Gonzalez G, Kunjilwar K, Babenko A, Bryan J: Toward understanding the assembly and structure of KATP channels. Physiol Rev 78:227245, 1998[Abstract/Free Full Text]
-
Vannucci SJ, Clark RR, Koehler-Stec E, Li K, Smith CB, Davies P, Maher F, Simpson IA: Glucose transporter expression in brain: relationship to cerebral glucose utilization. Dev Neurosci 20:369379, 1998[Medline]
-
Leloup C, Arluison M, Lepetit N, Cartier N, Marfaing-Jallat P, Ferre P, Penicaud L: Glucose transporter 2 (GLUT 2): expression in specific brain nuclei. Brain Res 638:221226, 1994[Medline]
-
Apelt J, Mehlhorn G, Schliebs R: Insulin-sensitive GLUT4 glucose transporters are colocalized with GLUT3-expressing cells and demonstrate a chemically distinct neuron-specific localization in rat brain. J Neurosci Res 57:693705, 1999[Medline]
-
Kobayashi M, Nikami H, Morimatsu M, Saito M: Expression and localization of insulin-regulatable glucose transporter (GLUT4) in rat brain. Neurosci Lett 213:103106, 1996[Medline]
-
Reagan LP, Gorovits N, Hoskin EK, Alves SE, Katz EB, Grillo CA, Piroli GG, McEwen BS, Charron MJ: Localization and regulation of GLUTx1 glucose transporter in the hippocampus of streptozotocin diabetic rats. Proc Natl Acad Sci U S A 98:28202825, 2001[Abstract/Free Full Text]
-
Garner JA, Linse KD, Polk RK: Type I brain hexokinase: axonal transport and membrane associations within central nervous system presynaptic terminals. J Neurochem 67:845856, 1996[Medline]
-
Liu F, Dong Q, Myers AM, Fromm HJ: Expression of human brain hexokinase in Escherichia coli: purification and characterization of the expressed enzyme. Biochem Biophys Res Comm 177:305311, 1991[Medline]
-
Oomura Y, Ooyama H, Sugimori M, Nakamura T, Yamada Y: Glucose inhibition of the glucose-sensitive neurone in the rat lateral hypothalamus. Nature 247:284286, 1974[Medline]
-
Niimi M, Sato M, Tamaki M, Wada Y, Takahara J, Kawanishi K: Induction of Fos protein in the rat hypothalamus elicited by insulin-induced hypoglycemia. Neurosci Res 23:361364, 1995[Medline]
-
Muroya S, Uramura K, Sakurai T, Takigawa M, Yada T: Lowering glucose concentrations increases cytosolic Ca2+ in orexin neurons of the rat lateral hypothalamus. Neurosci Lett 309:165168, 2001[Medline]
-
Mizuno Y, Oomura Y: Glucose responding neurons in the nucleus tractus solitarius of the rat, in vitro study. Brain Res 307:109116, 1984[Medline]
-
Dallaporta M, Perrin J, Orsini JC: Involvement of adenosine triphosphate-sensitive K+ channels in glucose-sensing in the rat solitary tract nucleus. Neurosci Lett 278:7780, 2000[Medline]
-
Silver IA, Erecinska M: Extracellular glucose concentrations in mammalian brain: continuous monitoring of changes during increased neuronal activity and upon limitation in oxygen supply in normo-, hypo-, and hyperglycemic animals. J Neurosci 14:50685076, 1994[Abstract]
-
Rowe ICM, Treherne JM, Ashford MLJ: Activation by intracellular ATP of a potassium channel in neurones from rat basomedial hypothalamus. J Physiol 490:97113, 1996[Medline]
-
Munday R, Ludwig K, Lenzen S: The relationship between the physicochemical properties and the biological effects of alloxan and several N-alkyl substituted alloxan derivatives. J Endocrinol 139:153163, 1993[Abstract]
-
Lenzen S, Brand FH, Panten U: Structural requirements of alloxan and ninhydrin for glucokinase inhibition and of glucose for protection against inhibition. Br J Pharmacol 95:851859, 1988[Medline]
-
De Vos A, Heimberg H, Quartier E, Huypens P, Bouwens L, Pipeleers D, Schuit F: Human and rat beta cells differ in glucose transporter but not in glucokinase gene expression. J Clin Invest 96:24892495, 1995[Medline]
-
Heimberg H, De Vos A, Vandercammen A, Van Schaftingen E, Pipeleers D, Schuit F: Heterogeneity in glucose sensitivity among pancreatic beta-cells is correlated to differences in glucose phosphorylation rather than glucose transport. EMBO J 12:28732879, 1993[Medline]
-
Muroya S, Yada T, Shioda S, Takigawa M: Glucose-sensitive neurons in the rat arcuate nucleus contain neuropeptide Y. Neurosci Lett 264:113116, 1999[Medline]
-
Cowley MA, Smart JL, Rubinstein M, Cerdan MG, Diano S, Horvath TL, Cone RD, Low MJ: Leptin activates anorexigenic POMC neurons through a neural network in the arcuate nucleus. Nature 411:480484, 2001[Medline]
-
Amoroso S, Schmid-Antomarchi H, Fosset M, Lazdunski M: Glucose, sulfonylureas, and neurotransmitter release: role of ATP-sensitive K+ channels. Science 247:852854, 1990[Abstract/Free Full Text]
-
Illes P, Sevcik J, Finta EP, Frolich R, Nieber K, Norenberg W: Modulation of locus coeruleus neurons by extra- and intracellular adenosine 5'-triphosphate. Brain Res Bull 35:513519, 1994[Medline]
-
Ibrahim N, Smart JL, Rubenstein M, Low MJ, Kelly MJ: Mouse hypothalamic POMC neurons are modulated by KATP channel activity (Abstract). Abstr Soc Neurosci 31: 2001
-
Tiedge M, Lenzen S: Effects of glucose refeeding and glibenclamide treatment on glucokinase and GLUT2 gene expression in pancreatic B-cells and liver from rats. Biochem J 308:139144, 1995
-
Levin BE, Govek EK, Dunn-Meynell AA: Reduced glucose-induced neuronal activation in the hypothalamus of diet-induced obese rats. Brain Res 808:317319, 1998[Medline]

CiteULike Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
B. E. Levin, T. C. Becker, J.-i. Eiki, B. B. Zhang, and A. A. Dunn-Meynell
Ventromedial Hypothalamic Glucokinase Is an Important Mediator of the Counterregulatory Response to Insulin-Induced Hypoglycemia
Diabetes,
May 1, 2008;
57(5):
1371 - 1379.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Garcia-Fernandez, P. Ortega-Saenz, A. Castellano, and J. Lopez-Barneo
Mechanisms of Low-Glucose Sensitivity in Carotid Body Glomus Cells
Diabetes,
December 1, 2007;
56(12):
2893 - 2900.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Zhang, M. A. Bosch, J. E. Levine, O. K. Ronnekleiv, and M. J. Kelly
Gonadotropin-Releasing Hormone Neurons Express KATP Channels That Are Regulated by Estrogen and Responsive to Glucose and Metabolic Inhibition
J. Neurosci.,
September 19, 2007;
27(38):
10153 - 10164.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Cheng, L. Zhou, W. Zhu, A. Wang, C. Tang, O. Chan, R. S. Sherwin, and R. J. McCrimmon
Type 1 corticotropin-releasing factor receptors in the ventromedial hypothalamus promote hypoglycemia-induced hormonal counterregulation
Am J Physiol Endocrinol Metab,
September 1, 2007;
293(3):
E705 - E712.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. V. Matveyenko, M. Bohland, M. Saberi, and C. M. Donovan
Portal vein hypoglycemia is essential for full induction of hypoglycemia-associated autonomic failure with slow-onset hypoglycemia
Am J Physiol Endocrinol Metab,
September 1, 2007;
293(3):
E857 - E864.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Polakof, J. M. Miguez, and J. L. Soengas
In vitro evidences for glucosensing capacity and mechanisms in hypothalamus, hindbrain, and Brockmann bodies of rainbow trout
Am J Physiol Regulatory Integrative Comp Physiol,
September 1, 2007;
293(3):
R1410 - R1420.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Marty, M. Dallaporta, and B. Thorens
Brain Glucose Sensing, Counterregulation, and Energy Homeostasis
Physiology,
August 1, 2007;
22(4):
241 - 251.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. B. Barnes and J. L. Beverly
Nitric oxide's role in glucose homeostasis
Am J Physiol Regulatory Integrative Comp Physiol,
August 1, 2007;
293(2):
R590 - R591.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. S. Ward, W. A. Voter, and S. Karan
The effects of hypo- and hyperglycaemia on the hypoxic ventilatory response in humans
J. Physiol.,
July 15, 2007;
582(2):
859 - 869.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Acosta-Martinez and J. E. Levine
Regulation of KATP channel subunit gene expression by hyperglycemia in the mediobasal hypothal | |