Diabetes 51:2294-2300, 2002 © 2002 by the American Diabetes Association, Inc. Vitamin D Receptor (VDR) mRNA and VDR Protein Levels in Relation to Vitamin D Status, Insulin Secretory Capacity, and VDR Genotype in Bangladeshi Asians
1 Department of Diabetes and Metabolic Medicine, Barts and the London Queen Marys School of Medicine and Dentistry, University of London, London
Associations have been reported between vitamin D receptor (VDR) gene polymorphisms, type 1 diabetes, insulin secretion, and the insulin resistance syndrome. As VDR polymorphisms have no known functional significance, these findings may implicate a variant of the VDR gene or a locus in linkage disequilibrium with the VDR. We have examined VDR mRNA and VDR protein levels in relation to VDR polymorphisms (41 Bangladeshi subjects) and analyzed insulin secretory capacity (143 Bangladeshi subjects), allowing for other known determinants. Peripheral blood mononuclear cells (PBMCs) from subjects who had been genotyped for BsmI, ApaI, TaqI, and FokI VDR restriction fragment length polymorphisms were used for both total VDR mRNA quantitation (using TaqMan) and measurement of VDR protein levels (using a specific micro-immunoassay). Stepwise multiple regression analyses were used (to P < 0.05) to analyze the data. For the insulin secretion index, the best-fit model (n = 143, P < 0.0001) gave age (P = 0.002), TaqI (P < 0.0001), and BMI (P = 0.001) as independent determinants; with the inclusion of VDR mRNA and VDR protein levels, VDR mRNA was the sole independent determinant (n = 41, P = 0.024). However, the best-fit model for VDR mRNA (P = 0.004) gave FokI (P = 0.044) and TaqI (P = 0.04) genotypes and insulin secretory capacity (P = 0.042) as independent determinants. For VDR protein levels, the best-fit model (P = 0.006) gave TaqI genotype (P = 0.005) and circulating 1,25-dihydroxyvitamin-D levels (P = 0.03) as independent determinants. In conclusion, these studies confirm an association between VDR polymorphisms and insulin secretory capacity and demonstrate the VDR genotype to be a significant determinant of VDR mRNA and VDR protein levels in PBMCs, providing functional support to previously described genetic associations with the VDR gene. Furthermore, VDR expression has been shown to be a determinant of insulin secretory capacity.
Classic actions of vitamin D include maintenance of mineral homeostasis by regulation of calcium absorption in the gut and reabsorption by the kidney, in addition to regulation of bone remodeling (1). Among many noncalcemic functions are the induction of differentiation in peripheral blood mononuclear cells (PBMCs) and antiproliferative effects in many cancers, as well as vitamin Ds immunosuppressive properties; vitamin D also acts as a necessary adjunct for insulin secretion (2). The main sources of vitamin D are ergocalciferol (D2) and cholecalciferol (D3), found in dietary sources and supplements, and cholecalciferol produced in the skin by ultraviolet radiation of 7-dehydrocholesterol. Both these compounds are hydroxylated in the liver to form 25-hydroxyvitamin D [25(OH)D], which is the major circulating metabolite precursor to the hormonally active form, 1,25-dihdroxyvitamin D [1,25(OH)2D]. Hydroxylation of 25(OH)D metabolite, stimulated by parathormone, produces the hormonally active metabolite 1,25(OH)2D, mainly in the kidney. 1,25(OH)2D is the main ligand for the vitamin D receptor (VDR), a member of the nuclear receptor superfamily of transcriptional regulators (1,3). The 25(OH)D precursor is widely used in assessment of vitamin D repletion and has a slower rate of clearance from the circulation than 1,25(OH)2D. Because the VDR is expressed in a large number of tissues, it is not surprising that ligand-activated VDR modulates the expression of many genes. The VDR gene, located on chromosome 12q, has 14 exons, 6 of which are in the 5' untranslated region (1a1f). At least 22 unique nonfunctional VDR variants have been described, most of which lead to rare syndromes associated with vitamin D-resistant rickets (4). A number of common chronic disorders of inflammatory, infective, and autoimmune etiologies, including both type 1 and type 2 diabetes and colorectal adenoma, have been shown to be associated with specific polymorphisms of the vitamin D receptor gene, although not all such associations are found consistently in different populations (518). We have initiated a study of risk factors for type 2 diabetes and ischemic heart disease (IHD) in relation to vitamin D status in healthy adult subjects from Bangladesh living in East London, U.K. This ethnic group is known to have a high prevalence of vitamin D deficiency. We have demonstrated a strong association between insulin secretion and ApaI, TaqI, and BsmI polymorphisms of the VDR gene in this study group; these findings were independent of vitamin D status (19). The FokI genotype was not examined in that study, and the reported findings were based on simple correlative tests and one-way ANOVA of the mean with VDR genotype (19). The results have recently been replicated in another ethnic group with an additional association between insulin secretory capacity and the estrogen receptor gene (20). A relationship between vitamin D status, VDR genotype, and the matrix metalloproteinase (MMP) system has also been found, with TaqI polymorphism of the VDR gene contributing to the determination of circulating tissue inhibitor of metalloproteinases 1 (TIMP1) concentration in Bangladeshi subjects (21). The purpose of the present study was twofold. The first aim was to genotype the original cohort of Bangladeshi subjects for the FokI polymorphism and reanalyze the combined data to see whether VDR genotype contributed to the determination of insulin secretion when other relevant factors (age, body build, and vitamin D status) were included in multiple regression analysis. The second aim was to quantitate both VDR mRNA and total VDR protein in freshly obtained PBMCs from a subgroup of subjects from the original cohort. This extension to the study was designed to include those with vitamin D insufficiency to determine whether either VDR mRNA or total VDR protein might vary with vitamin D status or with VDR genotype.
This study cohort consisted of 143 apparently healthy Bangladeshi adults (subjects with previously diagnosed diabetes were excluded), screened as having a fasting or a postprandial capillary glucose within the upper range of normoglycemia by previously defined criteria (19). These subjects have been extensively phenotyped for risk factors for type 2 diabetes including insulin secretion index (calculated from basal and 30-min glucose and insulin levels during an oral glucose tolerance test [OGTT] [22]). Glucose tolerance was normal in 75.4% of subjects and impaired in 16.4%; 8.2% of subjects were found to have diabetes by 1985 World Health Organization criteria current at the time of initial recruitment (23). DNA from the study subjects was digested with FokI, and fragments were separated by standard agarose-gel electrophoresis; FokI genotypes were designated by the lowercase letter f for presence of the cutting site and by the uppercase F for its absence; ApaI, TaqI, and BsmI genotyping was available from the original study (19). Forty-one subjects, aged 3165 years (mean age ± SD, 48.32 ± 9.9), from the original cohort gave informed consent to provision of a further blood sample for the present study, as approved by the District Ethical Committee. Of these, 39% were men and 61% were women. A total of 12.2% had developed diabetes and 4.9% proven IHD since the original study. The data on VDR genotype from the original and current studies was combined for analysis (see below). Serum 25(OH)D concentration was measured by radioimmunoassay (IDS Immunodiagnostics) (intra- and interassay coefficients of variation 8.8% and 10.8%, respectively); levels of 25(OH)D <20 ng/ml defined vitamin D insufficiency (24). 1,25-Dihdroxyvitamin D was measured by specific radioimmunoassay after immunoextraction [Gamma-B 1,25(OH)D RIA kit; IDS] and measured both bioactive forms of calcitriol (1,25-dihydroxyvitamin-D2 and -D3) equally well; intra- and interassay coefficients of variation were <8% and <10%, respectively. The reference range for normal adults is 48110 pmol/l. PBMCs were isolated from freshly heparinized venous blood using standard RPMI solutions and Ficoll-Hypaque gradient (Pharmacia, Uppsala, Sweden) separation. The cells were resuspended at 1 x 106 cells/ml in cold PBS and counted in Neubauer chambers. Aliquots containing 107 cells were used in both the VDR mRNA and VDR protein studies. Total cellular RNA was extracted from 107 PBMCs using the RNeasy mini RNA isolation kit (Qiagen, Crawley, UK), according to the manufacturers recommendations, and quantified using a GeneQuant RNA/DNA Calculator (Pharmacia Biotech) with storage at -70°C. Forward (ATCTGCATCGTCTCCCCAGAT) and reverse (AGCGGATGTACGTCTGCAGTG) oligonucleotide primers and a TaqMan probe (TGATTGAGGCCATCCAGGACCGC) were designed for the VDR gene (accession no. AC004466) using Primer Express software (PE-Applied Biosystems, Warrington, U.K.). The RT-PCR assays were carried out with an ABI Prism 7700-sequence detector as described (25) and were analyzed using sequence detector software (version 1.6.3). Absolute mRNA copy numbers were determined from a VDR-specific standard curve obtained by serially diluting a single-stranded sense oligonucleotide specifying the 98-bp VDR amplicon. Absolute mRNA levels were expressed as VDR mRNA copy numbers per microgram of total RNA (25). Total 1,25-dihydroxyvitamin-D3 receptor protein (VDR protein) concentrations in PBMC homogenates were measured by specific micro enzyme-linked immunosorbent assay against standard curves (correlation coefficient, 0.999) for purified human VDR protein; intra-assay coefficient of variation was <6.6% (26). Results from two samples with results below the limit of sensitivity were expressed as being at that limit (1 µg/mg of total extract protein).
Statistics.
Insulin secretion. The distribution of the insulin secretion index in the initial study (n = 143) was normalized by log transformation, as in our previous report (showing it to vary with ApaI, BsmI, and TaqI polymorphisms of the VDR gene) (19). Multiple regression analysis showed the significant independent determinants of the insulin secretion index at initial OGTT to be diabetic status (normal, impaired, or diabetic glucose tolerance) (P < 0.001), BMI (P < 0.001), and TaqI genotype (P < 0.001) in the best-fit model obtained (P < 0.001) (Table 1). If diabetic status was excluded from analysis, on the basis that insulin secretion index is a determinant of diabetic status, then the best-fit model (P = 0.002) gave age (P = 0.002), TaqI genotype (P = 0.001), and BMI (P = 0.011) as independent determinants of the insulin secretion index, the constant remaining significant for each of these models. Both models showed TaqI t homozygotes to be associated with the highest levels of insulin secretion (by 12%) (Table 2). In vitamin D insufficiency, the FokI polymorphism appeared as an additional independent determinant (Table 1).
Examination for linkage disequilibrium between VDR restriction fragment length polymorphisms (RFLPs) demonstrated that the ApaI, BsmI, and TaqI polymorphisms were in linkage equilibrium with FokI (P = 0.07, 1.0, and 0.15, respectively), whereas there was tight linkage disequilibrium between the ApaI, BsmI, and TaqI genotypes (P < 0.001), as previously shown (19). There was no significant deviation, using 2 tests, from Hardy-Weinberg equilibrium in this group or in the subgroup whose PBMCs were studied; furthermore, there was no evidence of the Wahlund effect for any of the four VDR genotypes.
Extension study: vitamin D axis.
Insulin secretion in the extension study.
VDR mRNA copy number.
VDR protein concentration. Ischemic heart disease, diabetes, or hypertension (or combinations of more than one of these conditions) had developed in eight extension study subjects during the years between the initial and the current studies. The distribution of the four VDR genotypes was compared (for ApaI, BsmI, TaqI, and FokI) between those with and without these problems. The prevalences of the VDR genotypes ff and tt were increased from 11.1% to 16.6% and from 6.6% to 25% in subjects with these disorders. The relative risk of these disorders (95% CI) for absence of the tt genotype was reduced to 0.15 (-0.4 to 1.1) and for the ff genotype to 0.29 (0.15 to 0.49).
We have demonstrated an association between VDR polymorphism and insulin secretory capacity and have shown that this gene is also a significant determinant of the amount of VDR mRNA and VDR protein expressed in PBMCs. A feature of those subjects re-bled for the VDR mRNA and protein studies is that all but one of the subjects was 25(OH)D insufficient, probably reflecting the fact that these subjects were restudied in the autumn and confirming the inadequacy of the British summer and diet for maintenance of vitamin D repletion in this population (28). Although 25(OH)D levels were low, normal levels of calcitriol [hormonally activated 1,25(OH)2D] were maintained and there was, therefore, no simple correlation between 25(OH)D and 1,25(OH)2D levels. We have reported insulin secretion to vary with vitamin D status and, independent of that status, to vary with VDR genotype (19,28). Several studies, including our work on MMP system activation (21), suggest that VDR genotype disease associations may be modulated by vitamin D status. Associations between VDR genotype and rickets, colorectal cancer, tuberculosis, hepatitis B, and leprosy are all more marked in subjects with vitamin D deficiency or in populations where vitamin D deficiency is common (5,16,19,21,2931). Furthermore, phytohemagglutinin-stimulated growth of PBMCs varies with FokI genotype when studied at half the maximal effective concentration of 1,25(OH)2D, whereas no such variation was found at the maximal concentration of activated vitamin D (32). Further to our previous study (19), we have now used multiple regression analysis to allow for the effects of factors known to affect insulin secretion other than VDR genotype, age, body build, and vitamin D status. We have, in the same way, included factors that are known to influence VDR mRNA formation such as insulin secretion (33) and that influence VDR expression, such as activated vitamin D. The best determinants of insulin secretion were TaqI genotype, BMI, and age, although simple analysis of variation of the mean with genotype had suggested in our initial study (19) that the strongest association was with the ApaI genotype. Because ApaI, BsmI, and TaqI polymorphisms are in tight linkage disequilibrium, the fact that our reanalysis suggests TaqI genotype to be a significant determinant of VDR mRNA formation, rather than ApaI, is not at variance with our original observations. The data are complicated by the fact that disease associations have been described with four different RFLPs, as defined by FokI, BsmI, ApaI, and TaqI, and with a mononucleotide repeat (An) in the 3' untranslated region (5,34). The BsmI and ApaI RFLPs are intronic (between exons 8 and 9), and the TaqI polymorphism is located in exon 9, but none of these changes lead to amino acid substitutions. Although it has been postulated that these RFLPs might affect VDR mRNA stability, this has not been confirmed, nor do they appear to affect ligand binding (3537). These inconsistent results on the relationship between VDR genotype and VDR expression may have several explanations. In analyzing our data on VDR expression for possible effects of VDR polymorphisms, we have allowed for factors that influence VDR expression; indeed, had we relied simply on variation of our VDR data with VDR genotype, we might have concluded that associations did not exist, adding further confusion to this field. Furthermore, several, but not all, other studies have used less precise methods of mRNA analysis on a variety of tissues (PBMCs, parathyroid, fibroblasts, and cell lines) (3744). Nonetheless, some positive results have been found in the latter studies, including variation in TaqI allele or associated haplotype-specific mRNA levels (37,39,41). In contrast to the other VDR polymorphisms, the FokI polymorphism results in the incorporation of three extra amino acids in the NH2 terminal of VDR protein, which influences transcriptional activity by modulating interaction with the transcription factor IIB (TFIIB) (43,44).
In those subjects with 25(OH)D insufficiency in the original study (serum levels <20 ng/ml), FokI was a determinant of insulin secretion in addition to TaqI genotype and age. This is consistent with linkage equilibrium between FokI and TaqI polymorphism (unlike the strong linkage disequilibrium that exists between the ApaI, BsmI, and TaqI polymorphisms). It is therefore of interest that we observed significant variation of VDR mRNA with the FokI polymorphism. Because PBMC production of activated vitamin D increases in vitamin D deficiency (45), FokI genotype may contribute to feedback control of expression of the 25-hydroxyvitamin D-1- We have found circulating levels of activated vitamin D [1,25(OH)2D] to contribute to VDR protein levels, confirming earlier in vitro studies in PBMCs (45,49), whereas total VDR mRNA (the amplicon used in this study amplifies all mRNA species) was a borderline determinant of VDR protein levels in the PBMCs. In contrast, the insulin secretory capacity was a predictor of PBMC mRNA but not protein. These observations are not unexpected, as the relation between mRNA and its protein will depend on several factors including the half-life of the mRNA compared to the protein and on posttranscriptional processing. Indeed, tissue expression of VDR is directed by a number of promoters and transcription initiation from exons 1a or 1d, and alternative splicing can generate at least 10 different VDR transcripts, each of which was found in all of the tissues examined by Crofts et al. (50). Furthermore, we have previously studied mouse fibroblast and intestinal cell lines and showed that the addition of calcitriol [1,25(OH)2D] increased VDR protein levels without changes in mRNA (51); similar changes have been reported in humans for healthy macrophages (49). Many VDR disease associations reported are specifically with the TaqI polymorphism or associated haplotypes. It is with the TaqI polymorphism that we have found variation in insulin secretion and in TIMP1 responses to increases in circulating MMP9 (21). The apparent variation in risk for IHD and type 2 diabetes with TaqI and FokI polymorphisms therefore warrants further investigation in larger populations. Further work is needed to define the mechanisms by which such variations in VDR synthesis lead to variation in cellular function and to determine whether such variation is abolished by adequate vitamin D repletion. The prescient suggestion, made 25 years ago, that requirements for vitamin D may vary between individuals (52) is now supported by clinical findings in tuberculosis, uremia, and colonic adenoma (16,30,53,54). It is clear that susceptibility to a wide range of disorders associated with VDR polymorphism, including type 1 and type 2 diabetes, could be reduced if adequacy of vitamin D repletion could be redefined to include those with the highest requirements (68,19,20,55). Furthermore, appropriate supplementation and maintenance in populations where vitamin D status is commonly inadequate is recommended (28,5658).
National Health Service R&D, NE Thames Region (now North Thames Region), and Diabetes U.K. (previously the British Diabetic Association) provided grant support.
Address correspondence and reprint requests to Prof. G.A. Hitman, Department of Diabetes and Metabolic Medicine, Royal London Hospital, Whitechapel, London, E1 1BB U.K. E-mail: g.a.hitman{at}qmul.ac.uk. Received for publication 18 June 2001 and accepted in revised form 10 April 2002. 25(OH)D, 25-hydroxyvitamin D; 1,25(OH)2D, 1,25-dihdroxyvitamin D; IHD, ischemic heart disease; MMP, matrix metalloproteinase; OGTT, oral glucose tolerance test; PBMC, peripheral blood mononuclear cell; RFLP, restriction fragment length polymorphism; VDR, vitamin D receptor.
This article has been cited by other articles:
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||