Diabetes 52:2996-3000, 2003
© 2003 by the American Diabetes Association, Inc.
The Human MC4R Promoter
Characterization and Role in Obesity
Cecile Lubrano-Berthelier1,
Martha Cavazos1,
Catherine Le Stunff2,
Kurt Haas1,
Astrid Shapiro1,
Sumei Zhang1,
Pierre Bougneres2, and
Christian Vaisse1
1 Department of Medicine, Division of Endocrinology and the Diabetes Center, University of California San Francisco, San Francisco, California
2 Department of Pediatric Endocrinology, Saint Vincent de Paul Hospital, University Rene Descartes, Paris, France
 |
ABSTRACT
|
|---|
Heterozygous mutations in the coding sequence of the serpentine melanocortin 4 receptor (MC4R) are the most frequent genetic cause of severe human obesity. Since haploinsufficiency has been proposed as a causal mechanism of obesity associated with these mutations, reduction in gene transcription caused by mutations in the transcriptionally essential regions of the MC4R promoter may also be a cause of severe obesity in humans. To test this hypothesis we defined the minimal promoter region of the human MC4R and evaluated the extent of genetic variation in this region compared with the coding region in two cohorts of severely obese subjects. 5'RACE followed by functional promoter analysis in multiple cell lines indicates that an 80-bp region is essential for the transcriptional activity of the MC4R promoter. Systematic screening of 431 obese children and adults for mutations in the coding sequence and the minimal core promoter of MC4R reveals that genetic variation in the transcriptionally essential region of the MC4R promoter is not a significant cause of severe obesity in humans.
Obesity is a complex multifactorial disease caused by the interaction of genetic and environmental factors (1,2). Heterozygous mutations in the coding region of the melanocortin 4 receptor (MC4R) gene are the cause of 16% of severe early-onset obesity cases (310). MC4R is a seven transmembrane G-proteincoupled receptor (GPCR) encoded by a single exon gene localized on chromosome 18q22. MC4R is expressed in the paraventricular nucleus of the hypothalamus, and its activation results in the inhibition of food intake. In mice, homozygous deletion of Mc4r results in an obese phenotype (11). In humans, several recent studies reported the screening of 2,600 subjects leading to the discovery of 46 different MC4R mutations associated with obesity, most of them leading to a functional alteration of the receptor (6,7,9,10).
Theoretically, MC4R mutations in humans could cause obesity through haploinsufficiency, a dominant-negative effect, or a combination of both (12,13). Since some heterozygous human obesitycausing MC4R alleles are null or early nonsense mutations, and since heterozygous deletion of the Mc4r in mice leads to an intermediate increase in weight between wild-type mice and mice with homozygous deletion of Mc4r (11), haploinsufficiency at the MC4R locus seems sufficient to cause obesity. Under this assumption, reduced gene transcription caused by mutations in essential regions of the MC4R promoter could also be a cause of obesity in humans. The minimal promoter of the human MC4R has not been delineated, and the search for genetic variants associated with obesity at the MC4R locus has so far been limited to coding mutations.
In this study, we report the characterization of the minimal promoter of the MC4R gene and the search for sequence variants in the MC4R promoter associated with human obesity.
 |
RESEARCH DESIGN AND METHODS
|
|---|
Human fetal brain RNA preparation and 5'RACE.
Transcriptional start site determination by 5' rapid amplification of cDNA ends (5'RACE) was performed on total human fetal brain RNA using the GeneRacer kit (Invitrogen, Carlsbad, CA). First-strand cDNA was synthesized using specific primer MC4R-BR (5' TCCACTGCAATTGAAAGCAG 3') and avian myeloblastosis virusreverse transcriptase. We amplified 5' cDNA ends with MC4R-BR or MC4R-AR primer (5' CATGGGTGAATGCAGATTCT 3'), followed by a nested PCR with MC4R-AR or MC4R-OR (5' GCAGGAGAAGTGTGCATCCCA 3'). The PCR products were subcloned in pcDNA3.1/V5-His TOPO TA vector (Invitrogen) and analyzed by enzymatic digestion using a frequent cutter restriction enzyme (HphI) to eliminate duplicate clones. We then systematically sequenced 2 clones presenting with the same restriction map (16 clones sequenced).
Alignment of human and mouse proximal promoter.
Alignments of mouse and human 5'untranslated regions (UTRs) and regions 500 bp upstream of the main transcription start site were performed and analyzed with MacVector software (Accelrys, San Diego, CA), TRANSFAC (the Transcription Factor Database), and manual searches.
Cloning of 5' flanking MC4R luciferase reporter vectors.
Fragments of the 5' region of the human MC4R gene were obtained by restriction digestion of a bacterial artificial chromosome clone isolated from a human genomic bacterial artificial chromosome library (Research Genetics; Invitrogen). Fragments were ligated upstream of the Firefly luciferase gene in the plasmid pFOXLuc1 (a gift from Michael German, University of California San Francisco [UCSF]).
Cell transfection and luciferase assays.
Mouse hypothalamic GT1-7 cells were provided by Richard Weiner (UCSF). Neuro2A, HEK293, and GT1-7 cells were transfected using Effectene reagent (Qiagen, Valencia, CA), and NIH3T3 cells were transfected with Lipofectamine Reagent (Invitrogen). Cells were cotransfected with MC4R promoter constructs and a plasmid containing the Renilla luciferase to assess for transfection efficiency. Forty-eight hours after transfection, cells were harvested and Firefly and Renilla luciferases were assessed using the Stop & Glo kit (Promega, Madison, WI). Firefly luciferase activity was normalized to Renilla luciferase activity, and results were expressed relative to the result obtained with the promoterless vector.
Human subjects and phenotypes.
Two cohorts were screened for mutations in the MC4R coding sequence and minimal promoter. The first group was comprised of 266 children (aged 12.8 ± 0.8 years) from a previously described cohort (14). The protocol was approved by Cochin Ethics Committee, and informed consent was obtained from subjects and parents.
The second population was comprised of 165 unrelated, severely obese adults (BMI 4085.3 kg/m2 [median 48.8]). This study was approved by the UCSF Committee on Human Research, and informed consent was obtained from subjects.
Mutation screening of the MC4R minimal promoter and 5'UTR.
Mutation screening was performed by direct sequencing of the coding region (9), the 5'UTR, and the minimal promoter of MC4R. This region was amplified from lymphocyte-derived genomic DNA using primers MC4R-250 (5' GCTATAGGTACCCTTGAAAACTTAAAAAGG GA 3') and MC4R PromRev1 (5' GCTATACTCGAGAATTCCAGTGTCCCCC TGA 3'). Sequencing was performed on a ABI3700 automated DNA Sequencer (Applied Biosystems, Foster City, CA) and analyzed using Sequencher software (Gene Codes, Ann Arbor, MI).
 |
RESULTS
|
|---|
Determination of the human MC4R transcriptional start site.
We determined transcriptional start sites of the MC4R gene from human fetal brain RNA by 5'RACE (Fig. 1). The nucleotide sequences of all the clones were colinear with the genomic sequence in the 5' end of the coding region of human MC4R, indicating that no introns were present in the 5'UTR. Analysis of human fetal brain by 5'RACE indicates that the MC4R gene possesses two major transcriptional start sites, at 426 and 139 bp upstream of the translation initiation codon, and multiple minor transcription start sites, ranging from 213 to 366 bp (Fig. 2). We designated the transcription start site of the longest transcript as nucleotide "+1". A TATA-like box and classical CAAT sequence (in an antisense orientation) were found at 33 and 94 bp upstream of this major transcription start site, respectively.

View larger version (93K):
[in this window]
[in a new window]
|
FIG. 1. Determination of the human MC4R transcription start site. Lanes 1 and 3: cDNA from human embryonic brain. Lanes 2 and 4: PCR negative control. Lane 5: DNA ladder. Lanes 1 and 2: The first PCR was performed using the GeneRacer 5' primer and MC4R-AR and the nested PCR with nested generacer 5' primer and MC4R-OR. Lanes 3 and 4: The first PCR was performed using the GeneRacer 5' primer and MC4R-BR and the nested PCR with nested GeneRacer 5' primer and MC4R-AR.
|
|

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 2. DNA sequence alignment of human and mouse MC4R promoter regions. The major transcription start sites are indicated by a "plain" arrow and defined as +1. Minor transcription start sites are indicated only for the human sequence with "open" arrows. The translation initiation codon ATG is indicated in lower case. Conserved regions between human and mouse are indicated in bold. The minimal promoter region determined in this study is indicated in italics. Potential cis-acting elements were identified using the TRANSFAC database and manual searches and are indicated as underlined. Sequences present in reverse orientation are designated with the prefix "r".
|
|
In silico analysis of the proximal human MC4R promoter region reveals the presence of E-boxes, cAMP response element binding protein, GATA and signal transducers and activators of transcription sites, homeoboxes, and a response element for the neural zinc finger family of transcription factors (Fig. 2).
Comparative genomic analysis of the mouse (15) and human MC4R promoter regions indicates that only the signal transducers and activators of transcription site, neural zinc finger response element, and CAAT box are conserved between species. In addition, this comparative analysis reveals the presence of a 30-bp sequence starting with the putative CAAT box that is 100% conserved between human and mouse (Fig. 2). This sequence is also present in the putative MC4R promoter of the rat and pig and is highly specific for the MC4R promoter, since BLAST analysis does not reveal the presence of another similar sequence in all four genomes. This sequence contains a potential binding site (AttGGTCA) for monomeric nuclear receptors, such as thyroid receptor or SF1 (steroidogenic factor 1). However, we did not observe any effect of SF1 on MC4R promoter activity (data not shown).
Characterization of the essential promoter region for MC4R gene transcription.
A series of progressive 5' deletions of the human MC4R promoter, each extending to +10 bp of 5'UTR, were tested for transcriptional activity in nonneuronal cell lines (NIH 3T3 and HEK293) and in neuronal cell lines (Neuro 2A and GT-1-7) (Fig. 3). GT1-7 cells express the MC4R (16). A 2.5-kb fragment of human MC4R promoter stimulates transcription in all of the cell lines, with the highest relative level of expression in HEK 293 cells (Fig. 3). Serial deletions from 2.5 kb to -130 bp did not diminish the promoter activity in any of the cell lines (Fig. 3), while deletion of 80 additional base pairs abolished the transcriptional activity of the promoter in NIH 3T3, Neuro 2A, and GT1-7 cells and reduced it in HEK 293 cells. Therefore, we defined the presence of a minimal core promoter between -130 and -50 bp. However, this minimal promoter does not recapitulate tissue specificity because we observed a basal transcription activity in all cell lines tested. This result suggests that the regulation of the MC4R gene expression involves at least an additional repressor elsewhere in the sequence. Because they would lead to an increase in MC4R transcription, mutations in such tissue-specific repressors are unlikely to be a cause of severe obesity in humans.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 3. Transcriptional activity of the human MC4R promoter in cell lines. Promoter fragments containing sequences extending from -2,500 to -50 (5'end) to +10 bp of the major transcription site (3'end) were ligated upstream of the firefly luciferase gene and transfected into four cell lines, mouse NIH 3T3, human HEK 293, mouse Neuro 2A, and rat GT1-7. Reporter gene activity is expressed relative to the promoterless luciferase vector in the same cell type. Transfections were performed in triplicate on at least two independent occasions, and data are shown as means ± SD.
|
|
Are MC4R promoter mutations implicated in human obesity?
To determine whether mutations in essential regulatory regions of the MC4R are a significant cause of severe obesity, we screened two populations of severely obese subjects for mutations in the coding region and in the minimal MC4R promoter defined above (Table 1). The frequency of MC4R mutations, other than known polymorphisms, was 3.6% (95% CI 0.786.49) in the adult population and 1.5% (0.042.97) in the child population. Both results are consistent with previous results obtained in this laboratory and with the literature. We detected three variants in the 5'UTR of MC4R. The -178 A/C single nucleotide polymorphism (SNP) was present at a frequency of 5.57% (3.47.73) and has been found previously at the same frequency in nonobese control populations (17). Two rare variants (A/G and G/T at 176 and 360 bp upstream of the ATG, respectively) were found in two different subjects. In contrast, no genetic variation was observed in the minimal promoter of MC4R in the 431 obese subjects of this cohort.
 |
DISCUSSION
|
|---|
We have used comparative genomic tools and classical promoter studies to begin to elucidate the essential regulatory mechanisms underlying human MC4R gene expression. The major transcriptional site, according to our 5'RACE result, is located 426 bp upstream of the start of translation, where sequence analysis indicates the presence of a consensus CAP site. The DNA sequence upstream of this site contains a CAAT box (in an antisense orientation) and a nontypical TATA box. This is in contrast to the mouse Mc4r promoter that lacks a classic TATA box (15). In addition to the mouse Mc4r promoter, the 5' flanking regions have been described for two melanocortin receptor subtypes: the human MC1R (18) and human and mouse Mc2r (19,20). Neither of these contain a TATA box nor a CAAT box. While several studies reported that most GPCR promoters are TATA-less and GC-rich (21,22), it appears that the human MC4R promoter does not share these characteristics.
Cross-species comparison reveals the presence of an identical 30-bp sequence following the putative CAAT box in the human, mouse, rat, and pig MC4R promoter. Our results confirm that this sequence is part of the minimal region that is necessary for basal MC4R promoter activity. Further characterization of trans-acting factors interacting with this cis element may lead to the discovery of novel candidate genes for human obesity.
While mutations in the MC4R gene are well established as an infrequent cause of obesity in humans (310), it is plausible that common SNPs in regulatory regions of MC4R could also contribute to obesity. Indeed, among multiple studies searching for linkage to obesity phenotypes, some have provided suggestive evidence of linkage between BMI (23) and body fat (24,25) on chromosome 18q21, flanking the MC4R region. These reports suggest that in addition to the rare severe obesitycausing variants in the MC4R coding region, common genetic variants/SNPs in the regulatory regions of the MC4R gene may be contributing to the risk of developing obesity, whereas in our study, the frequencies of mutations in the coding sequence of MC4R and of common genetic variants in the 5'UTR were concordant with previous reports, our results indicate that genetic variants in the essential/minimal region of the MC4R promoter are not a common monogenic cause of human obesity. Further epidemiologic studies are necessary to rule out any effect of the common SNPs found in the promoter on obesity-related phenotypes.
 |
ACKNOWLEDGMENTS
|
|---|
This work was supported by National Institutes of Health RO1 DK60540 and an American Diabetes Association Career Development Award (to C.V.). This study was carried out in part in the General Clinical Research Center, Moffitt/Mount Zion Hospital, UCSF, with funds provided by the National Center for Research Resources, M01 RR-00079, U.S. Public Health Service.
We thank Drs. John Kane, Raphael Merriman, James Ostroff, and Marco Patti and Karen Bagatelos, MSN, FNP, for their help in implementing the clinical study at UCSF.
Address correspondence and reprint requests to Dr. Christian Vaisse, Diabetes Center, University of California San Francisco, 513 Parnassus Ave., Box 0573, San Francisco, CA 94143-0573. E-mail: vaisse{at}medicine.ucsf.edu
Received for publication July 16, 2003
and accepted in revised form August 21, 2003
Abbreviations:
5'RACE, 5'; rapid amplification of cDNA ends; GPCR, G-proteincoupled receptor; MC4R, melanocortin 4 receptor; SNP, single nucleotide polymorphism; UCSF, University of California San Francisco; UTR, untranslated region
 |
REFERENCES
|
|---|
- Comuzzie AG, Allison DB: The search for human obesity genes.
Science280
:1374
1377,1998[Abstract/Free Full Text]
- Hill JO, Peters JC: Environmental contributions to the obesity epidemic.
Science280
:1371
1374,1998[Abstract/Free Full Text]
- Vaisse C, Clement K, Guy-Grand B, Froguel P: A frameshift mutation in human MC4R is associated with a dominant form of obesity.
Nat Genet20
:113
114,1998[Medline]
- Yeo GS, Farooqi IS, Aminian S, Halsall DJ, Stanhope RG, ORahilly S: A frameshift mutation in MC4R associated with dominantly inherited human obesity.
Nat Genet20
:111
112,1998[Medline]
- Hinney A, Schmidt A, Nottebom K, Heibult O, Becker I, Ziegler A, Gerber G, Sina M, Gorg T, Mayer H, Siegfried W, Fichter M, Remschmidt H, Hebebrand J: Several mutations in the melanocortin-4 receptor gene including a nonsense and a frameshift mutation associated with dominantly inherited obesity in humans.
J Clin Endocrinol Metab84
:1483
1486,1999[Abstract/Free Full Text]
- Gu W, Tu Z, Kleyn PW, Kissebah A, Duprat L, Lee J, Chin W, Maruti S, Deng N, Fisher SL, Franco LS, Burn P, Yagaloff KA, Nathan J, Heymsfield S, Albu J, Pi-Sunyer FX, Allison DB: Identification and functional analysis of novel human melanocortin-4 receptor variants.
Diabetes48
:635
639,1999[Abstract]
- Vaisse C, Clement K, Durand E, Hercberg S, Guy-Grand B, Froguel P: Melanocortin-4 receptor mutations are a frequent and heterogeneous cause of morbid obesity.
J Clin Invest106
:253
262,2000[Medline]
- Dubern B, Clement K, Pelloux V, Froguel P, Girardet J, Guy-Grand B, Tounian P: Mutational analysis of melanocortin-4 receptor, agouti-related protein, and alpha-melanocyte-stimulating hormone genes in severely obese children.
J Pediatr139
:204
209,2001[Medline]
- Lubrano-Berthelier C, Durand E, Dubern B, Shapiro A, Dazin P, Weill J, Ferron C, Froguel P, Vaisse C: Intracellular retention is a common characteristic of childhood obesity-associated MC4R mutations.
Hum Mol Genet12
:145
153,2003[Abstract/Free Full Text]
- Farooqi IS, Keogh JM, Yeo GS, Lank EJ, Cheetham T, ORahilly S: Clinical spectrum of obesity and mutations in the melanocortin 4 receptor gene.
N Engl J Med348
:1085
1095,2003[Abstract/Free Full Text]
- Huszar D, Lynch CA, Fairchild-Huntress V, Dunmore JH, Fang Q, Berkemeier LR, Gu W, Kesterson RA, Boston BA, Cone RD, Smith FJ, Campfield LA, Burn P, Lee F: Targeted disruption of the melanocortin-4 receptor results in obesity in mice.
Cell88
:131
141,1997[Medline]
- Ho G, MacKenzie RG: Functional characterization of mutations in melanocortin-4 receptor associated wih human obesity.
J Biol Chem274
:35816
35822,1999[Abstract/Free Full Text]
- Yeo GS, Lank EJ, Farooqi IS, Keogh J, Challis BG, ORahilly S: Mutations in the human melanocortin-4 receptor gene associated with severe familial obesity disrupts receptor function through multiple molecular mechanisms.
Hum Mol Genet12
:561
574,2003[Abstract/Free Full Text]
- Le Stunff C, Fallin D, Schork NJ, Bougneres P: The insulin gene VNTR is associated with fasting insulin levels and development of juvenile obesity.
Nat Genet26
:444
446,2000[Medline]
- Dumont LM, Wu CS, Aschkenasi CJ, Elmquist JK, Lowell BB, Mountjoy KG: Mouse melanocortin-4 receptor gene 5'-flanking region imparts cell specific expression in vitro.
Mol Cell Endocrinol184
:173
185,2001[Medline]
- Khong K, Kurtz SE, Sykes RL, Cone RD: Expression of functional melanocortin-4 receptor in the hypothalamic GT11 cell line.
Neuroendocrinology74
:193
201,2001[Medline]
- Jacobson P, Ukkola O, Rankinen T, Snyder EE, Leon AS, Rao DC, Skinner JS, Wilmore JH, Lonn L, Cowan GS Jr, Sjostrom L, Bouchard C: Melanocortin 4 receptor sequence variations are seldom a cause of human obesity: the Swedish Obese Subjects, the HERITAGE Family Study, and a Memphis cohort.
J Clin Endocrinol Metab87
:4442
4446,2002[Abstract/Free Full Text]
- Moro O, Ideta R, Ifuku O: Characterization of the promoter region of the human melanocortin-1 receptor (MC1R) gene.
Biochem Biophys Res Commun262
:452
460,1999[Medline]
- Naville D, Barjhoux L, Jaillard C, Lebrethon MC, Saez JM, Begeot M: Characterization of the transcription start site of the ACTH receptor gene: presence of an intronic sequence in the 5'-flanking region.
Mol Cell Endocrinol106
:131
135,1994[Medline]
- Cammas FM, Pullinger GD, Barker S, Clark AJ: The mouse adrenocorticotropin receptor gene: cloning and characterization of its promoter and evidence for a role for the orphan nuclear receptor steroidogenic factor 1.
Mol Endocrinol11
:867
876,1997[Abstract/Free Full Text]
- Minowa T, Minowa MT, Mouradian MM: Analysis of the promoter region of the rat D2 dopamine receptor gene.
Biochemistry31
:8389
8396,1992[Medline]
- Zhu QS, Chen K, Shih JC: Characterization of the human 5-HT2A receptor gene promoter.
J Neurosci15
:4885
4895,1995[Abstract]
- Ohman M, Oksanen L, Kaprio J, Koskenvuo M, Mustajoki P, Rissanen A, Salmi J, Kontula K, Peltonen L: Genome-wide scan of obesity in Finnish sibpairs reveals linkage to chromosome Xq24.
J Clin Endocrinol Metab85
:3183
3190,2000[Abstract/Free Full Text]
- Chagnon YC, Chen WJ, Perusse L, Chagnon M, Nadeau A, Wilkison WO, Bouchard C: Linkage and association studies between the melanocortin receptors 4 and 5 genes and obesity-related phenotypes in the Quebec Family Study.
Mol Med3
:663
673,1997[Medline]
- Norman RA, Tataranni PA, Pratley R, Thompson DB, Hanson RL, Prochazka M, Baier L, Ehm MG, Sakul H, Foroud T, Garvey WT, Burns D, Knowler WC, Bennett PH, Bogardus C, Ravussin E: Autosomal genomic scan for loci linked to obesity and energy metabolism in Pima Indians.
Am J Hum Genet62
:659
668,1998[Medline]

CiteULike Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
F. Stutzmann, K. Tan, V. Vatin, C. Dina, B. Jouret, J. Tichet, B. Balkau, N. Potoczna, F. Horber, S. O'Rahilly, et al.
Prevalence of Melanocortin-4 Receptor Deficiency in Europeans and Their Age-Dependent Penetrance in Multigenerational Pedigrees
Diabetes,
September 1, 2008;
57(9):
2511 - 2518.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Stutzmann, V. Vatin, S. Cauchi, A. Morandi, B. Jouret, O. Landt, P. Tounian, C. Levy-Marchal, R. Buzzetti, L. Pinelli, et al.
Non-synonymous polymorphisms in melanocortin-4 receptor protect against obesity: the two facets of a Janus obesity gene
Hum. Mol. Genet.,
August 1, 2007;
16(15):
1837 - 1844.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Sebag and P. M. Hinkle
Regulation of Endogenous Melanocortin-4 Receptor Expression and Signaling by Glucocorticoids
Endocrinology,
December 1, 2006;
147(12):
5948 - 5955.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Lubrano-Berthelier, B. Dubern, J.-M. Lacorte, F. Picard, A. Shapiro, S. Zhang, S. Bertrais, S. Hercberg, A. Basdevant, K. Clement, et al.
Melanocortin 4 Receptor Mutations in a Large Cohort of Severely Obese Adults: Prevalence, Functional Classification, Genotype-Phenotype Relationship, and Lack of Association with Binge Eating
J. Clin. Endocrinol. Metab.,
May 1, 2006;
91(5):
1811 - 1818.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A Blondet, J Gout, P Durand, M Begeot, and D Naville
Expression of the human melanocortin-4 receptor gene is controlled by several members of the Sp transcription factor family
J. Mol. Endocrinol.,
April 1, 2005;
34(2):
317 - 329.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Ma, P. A. Tataranni, C. Bogardus, and L. J. Baier
Melanocortin 4 Receptor Gene Variation Is Associated With Severe Obesity in Pima Indians
Diabetes,
October 1, 2004;
53(10):
2696 - 2699.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|
|