Diabetes
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moates, J. M.
Right arrow Articles by Stein, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moates, J. M.
Right arrow Articles by Stein, R.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Diabetes 52:403-408, 2003
© 2003 by the American Diabetes Association, Inc.

BETA2 Activates Transcription From the Upstream Glucokinase Gene Promoter in Islet ß-Cells and Gut Endocrine Cells

J. Michael Moates1,2,3, Sarmistha Nanda1, Michelle A. Cissell4, Ming-Jer Tsai1,2, and Roland Stein4

1 Department of Medicine, Baylor College of Medicine, Houston, Texas
2 Department of Molecular & Cellular Biology, Baylor College of Medicine, Houston, Texas
3 Department of Veterans Affairs, Houston, Texas
4 Department of Molecular Physiology and Biophysics, Vanderbilt University Medical Center, Nashville, Tennessee


    ABSTRACT
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Glucokinase (GK) gene transcription initiates in the islet (ß-cell), gut, and brain from promoter sequences residing ~35 kbp upstream from those used in liver. Expression of ßGK is controlled in ß-cells by cell-enriched (i.e. pancreatic duodenal homeobox 1 [PDX-1]) and ubiquitously (i.e., Pal) distributed factors that bind to and activate from conserved sequence motifs within the upstream promoter region (termed ßGK). Here, we show that a conserved E-box element also contributes to control in the islet and gut. ßGK promoter-driven reporter gene activity was diminished by mutating the specific sequences involved in E-box-mediated basic helix-loop-helix factor activator binding in islet ß-cells and enteroendocrine cells. Gel shift assays demonstrated that the ßGK and insulin gene E-box elements formed the same cell-enriched (BETA2:E47) and generally distributed (upstream stimulatory factor [USF]) protein-DNA complexes. ßGK E-box-driven activity was stimulated in cotransfection assays performed in baby hamster kidney (BHK) cells with BETA2 and E47, but not USF. Chromatin immunoprecipitation assays performed with BETA2 antisera showed that BETA2 occupies the upstream promoter region of the endogenous ßGK gene in ß-cells. We propose that BETA2 (also termed NeuroD1) regulates ßGK promoter activity.


Glucose homeostasis in mammals appears to be maintained by a rare set of specialized cells distributed throughout the body, some of which sense glucose and respond by releasing hormones and/or neurotransmitters. Pancreatic islet ß-cells are the most thoroughly studied glucose-sensing cell type. In ß-cells, the rate-limiting step in the glucose-induced signaling pathway is catalyzed by the enzyme glucokinase (ßGK). ßGK is a member of a family of hexokinases that mediate the conversion of glucose to glucose-6-phosphate, the first step in glycolysis (1). This low-affinity hexokinase is catalytically active within physiological glucose concentrations (4–8 mmol/l) and is not inhibited by its enzymatically derived glucose-6-phosphate end product (2). These mechanistic properties distinguish ßGK from the more generally distributed low-Km hexokinases (type I–III) and are featured during the coupling of glucose metabolism to insulin secretion.

ßGK is also expressed in some gut enteroendocrine cells and neurons in the brain (37). These cells are sparsely distributed yet strategically located in parts of the body and are thought to be involved in glucose sensing. For instance, ßGK is found in the glucose-dependent insulinotropic peptide (GIP)-producing K cells in the duodenum (7). Interestingly, when K cells were engineered to express insulin under the control of the GIP gene promoter, they functioned in place of ß-cells to maintain whole-body glucose homeostasis (7). Thus, it has been proposed that ßGK may serve as the "glucose sensor" in the gut (7) and brain (8).

GK mRNA is produced from two distinct promoters that are utilized in a tissue-specific manner. The upstream promoter is involved in ßGK mRNA production in the pancreas, duodenum, pituitary, and brain, whereas the promoter ~35 kb downstream is used in liver (9). Experiments performed in transgenic mice and cultured cell lines have shown that the cis-acting elements necessary for selective expression of the upstream promoter are located within 280 bp of the transcription initiation region (3,1012). Two distinct sequence motifs have been shown to be functionally important in islet ß-cells, referred to as upstream promoter element (UPE) and Pal sites (10,13). The UPEs are A+T-rich elements that appear to be positively regulated by pancreatic duodenal homeobox 1 (PDX-1) (10,14), a homeodomain protein involved in pancreatic development and the transcription of genes essential for ß-cell function, including insulin (15) and GLUT2 (16). In contrast, the Pal motifs consist of two identical 4-bp inverted repeats separated by a single nucleotide (TGGTCACCA) (13), and the stimulatory protein(s) has not been isolated.

In addition to the UPE and Pal sites, the sequence conservation between the mouse, rat, and human ßGK genes indicated that other control sites existed within the upstream promoter region (17). Here, we show that the conserved E-box element at position -221 to -216 relative to the transcription start site is also necessary for stimulation in ß-cells and enteroendocrine cells. Gel shift and transfection experiments suggested that regulation of both the ßGK and insulin E-box was mediated by the same set of proteins, an activator consisting of basic helix-loop-helix (bHLH) proteins that are islet and neuronal cell enriched, BETA2 (also known as NeuroD1) (18), and ubiquitously distributed E47. Chromatin immunoprecipitation (ChIP) analysis also showed that BETA2 binds in vivo to the ßGK region. Because islet (19), gut (19), and brain development (20,21) were all severely affected in BETA2-null mice, BETA2 may represent a common regulator of upstream promoter-mediated expression.


    RESEARCH DESIGN AND METHODS
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Transfection constructs.
Rat ßGK promoter sequences from -402 to +14 were cloned into the luciferase reporter vector pSVOAPL2L (13). Mutant 1 (mt1; -221 AAGGTG -216) and 2 (mt2; CATGTG) were generated in this construct using the Quick-Change mutagenesis kit (Stratagene); the mutated nucleotide is in italics, and the essential bHLH protein binding sequences are underlined. The minimal rat ßGK E-box-driven construct contains three tandem copies of rat ßGK -227 to -210 sequence cloned directly upstream of the TATA-box in the luciferase reporter vector pTATALuc (22). Each construct was verified by DNA sequencing (Baylor College of Medicine, DNA Sequencing Core Facility). Plasmid DNAs were purified using the Qiagen Maxi-Prep column (Qiagen). BETA2, E47, and upstream stimulatory factor (USF) were expressed in transfected cells from CMV-BETA2 (23), pCR3.1-E47 (22), psvUSF1 (24), and psvUSF2 (24), respectively.

Cell culture and transfections.
Monolayer cultures of ß (hamster HIT-T15 M2.2.2, mouse MIN6 and ßTC-3), baby hamster kidney (BHK), and STC-1 enteroendocrine cells were grown in Dulbecco’s modified Eagle’s Medium supplemented with 10% fetal bovine serum (FBS), 50 µg/ml streptomycin, and 50 µg/ml penicillin. RIN ß-cells were maintained in RPMI media with 10% FBS, 50 µg/ml streptomycin, and 50 µg/ml penicillin. MIN6 ß-cells were maintained as described previously (25). Cells were plated at a density of 4 x 104 cells per well in 12-well tissue culture dishes the day before transfection. Fugene reagent (5 µl; Roche Biochemicals) was used to transfect 500 ng of test DNA and 10 ng of pRL-TK DNA per well. Renilla luciferase (pRL-TK) was used as a recovery marker. Extracts were prepared 40 h after transfection and assayed for firefly and Renilla luciferase using the dual luciferase assay kit (Promega). The firefly luciferase activity from the test reporter construct was normalized to the Renilla luciferase activity from the cotransfected internal control plasmid. Each experiment was carried out at least three independent times.

Extract preparation and gel shift.
Nuclear extracts were prepared from HIT T-15 and STC-1 cells using the methods described by Shelton et al. (10). Gel shift reactions (20 µl) were incubated at 24°C for 20 min in the presence of 5 µg nuclear extract, 120 mmol/l KCl, 1 µg poly(dI-dC), 100 ng sheared salmon sperm DNA, 12.5 mmol/l HEPES (pH 7.8), 2.5 mmol/l dithiothreitol, 0.1 mmol/l EDTA, 5% glycerol, and 50,000 cpms radiolabeled double-stranded oligonucleotide probe (600 cpm/nmol). The TNT-coupled reticulocyte lysate system (Promega) was used to in vitro transcribe/translate BETA2 (23) and E47 (22); 100 ng of poly(dI-dC) was used in place of salmon sperm DNA in these binding reactions. The NH2 terminus-specific BETA2/NeuroD and E47 antisera (Santa Cruz Biotechnology) were preincubated with extract protein for 20 min before adding the probe. The DNA probe was end-labeled using [{gamma}-32P]ATP and T4 polynucleotide kinase. The completed binding assays were electrophoresed on a 6% acrylamide gel (from ICN) buffered with 250 mmol/l Tris (pH 7.6), 1.9 mmol/l glycine, and 10 mmol/l EDTA at 4°C (160 V for 3.5 h) before drying and autoradiography. The probe and competitor sequences were: rat ßGK -231/-198, -231 GGGAACTGAGCAGGTGGTAATGTCTACCA -198; rat ßGK mt1, -231 GGGAACTGAGAAGGTGGTAATGTCTACCA -198; rat ßGK mt2, -231 GGGAACTGAGCATGTGGTAATGTCTACCA -198; rat ßGK E-box-binding mutant (mtE), -231 GGGAACTGAGACTGGTGTAATGTCTACCA -198; rat insulin II, -104 CCCCTCTGGCCATCTGCTGATCC -86; U (USF consensus binding site), CACCCGGTCACGTGGCCTAGACC (Santa Cruz Biotechnology). The mutated nucleotides are in italics, and the bHLH protein binding sequences are underlined. The methylation interference analysis was performed with a rat ßGK (-231/-198 bp) probe as described previously (10). The free and bound complex bands were excised, cleaved, and resolved on 20% acrylamide gels.

ChIP analysis.
MIN6 cells (~0.5–1.0 x 108) were exposed to 1% formaldehyde in Dulbecco’s modified Eagle’s medium for 5 min at 23°C, and then glycine was added to 125 mmol/l. Cells were washed with cold PBS, pelleted, and incubated in 0.6 ml of 1% SDS, 10 mmol/l EDTA, 50 mmol/l Tris-HCl (pH 8.1), and 1 mmol/l phenylmethylsulfonyl fluoride (PMSF) for 10 min on ice. The lysed samples were transferred to tubes containing 250-mg glass beads (≤106 mm diameter) and treated at setting 4 with a Virsonic 100 sonicator (Virtis) for 12 10-s pulses at 4°C to fragment the chromatin. Then, 100-µl aliquots were incubated with 0.9 ml dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mmol/l EDTA, 16.7 mmol/l Tris-HCl, pH 8.1, 167 mmol/l NaCl, 1 mmol/l PMSF, and 0.1% protease inhibitor cocktail for mammalian cells; Sigma) and 60 µl of 50% protein G-Sepharose (blocked with 1 mg/ml BSA and 1 mg/ml sonicated salmon sperm DNA) for 1 h at 4°C. After removal of the Sepharose beads by centrifugation, 5 µg anti-BETA2 (NeuroD1) polyclonal IgG (Santa Cruz Biotechnology), 10 µg normal goat polyclonal IgG (Santa Cruz Biotechnology), or no antibody was added to the supernatant, and the reaction was incubated for 1 h at 4°C. Next, 60 µl of 50% protein G-Sepharose was added, and the reaction was incubated at 4°C for 3 h. The Sepharose beads were collected by centrifugation and washed extensively. The formaldehyde-induced cross-linking was reversed by incubating the beads overnight at 65°C with 0.5 ml elution buffer (1% SDS and 0.1 mol/l NaHCO3) and 20 µl of 5 mol/l NaCl. The immunoprecipitated DNA was purified by standard methods and resuspended in 105 µl of nuclease-free water (Promega). PCR analysis was performed using Ready-to-Go PCR beads (Amersham Pharmacia Biotech) with 15 pmol of each primer and 10 µl of immunoprecipitated DNA per reaction. The cycling parameters were 1 cycle of 95°C (2 min) and 28 cycles of 95°C (30 s), 61°C (30 s), and 72°C (30 s). The primers used for amplification were: mouse ßGK, -256 GTGATAGGCACCAAGGCACTGAC and -1 CGGTGCTTCTGTTCCAACCAGG; and phosphoenolpyruvate carboxykinase (PEPCK), 5'-GAGTGACACCTCACAGCTGTGG and 5'- GGCAGGCCTTTGGATCATAGCC. The correctness of the PCR products was confirmed by sequencing. Amplified products were electrophoresed through a 1.4% agarose gel in Tris-acetate-EDTA buffer and visualized by ethidium bromide staining.


    RESULTS
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The conserved E-box in the upstream ßGK promoter is important for activation.
The region spanning the UPE and Pal control sites between -280 to +14 bp of the upstream rat ßGK promoter has been shown to be sufficient to drive ß-cell-selective expression (10,13). To understand the role of the conserved E-box element at -221 to -216 bp in ßGK expression, single-point mutants were constructed that should either disrupt (mt1) or have little effect (mt2) on the binding of the bHLH family of proteins that regulate E-box activity (Fig. 1B) (26). Their effect on activation was compared with the Pal-1 site mutant (-170/-161) and the wild-type -402/+14 luciferase construct in transfected ßGK-expressing islet ß-cell (HIT T-15, MIN6, ßTC3, and RIN) and enteroendocrine (STC-1) cell lines. The expression pattern of the mutant constructs was essentially the same between lines. The results showed that the predicted dysfunctional -221 bp mutation within the bHLH factor contact site reduced ßGK promoter-driven activity by 55, 45, 49, 48, and 35% in HIT T-15, MIN6, ßTC3, RIN, and STC-1 cells, respectively, whereas the nonessential site mutation at -219 bp had little or no effect (Fig. 1C) in the tested cell lines. The loss in E-box activity was comparable to the Pal-1 site mutant in HIT-15 (Fig. 1C) and STC-1 (data not shown) cells. These results strongly suggested that bHLH factor(s) binding to the conserved E-box element at -221 to -216 bp was involved in ßGK promoter activity within the islet and intestine.



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 1. The conserved E-box contributes in ßGK promoter activity. A: The relative position of the UPE (-214/-210, -131/-126, and -102/-97), Pal (-168/-160 and -90/-82), and E (-221/-216) elements common to the mouse, rat, and human ßGK genes (rat promoter shown). B: The conserved sequences within the E-box region. The invariant nucleotides required for bHLH activator binding are underlined; the site of mt1 (C to A) and mt2 (G to T) is shown. C: HIT T-15, MIN6, ßTC3, RIN, and STC-1 cells were cotransfected with wild-type (wt) or mutant (mt1 or mt2) versions of the -402/+14 bp luciferase expression plasmid, which is driven by rat ßGK promoter sequences, and a Renilla luciferase (pRL-TK) internal control. pSVO represents the promoter-less vector. The normalized percent mutant -402/+14 bp luciferase activity ± SD is presented relative to the wild type.

 
BETA2:E47 and USF bind in vitro to the ßGK E-box.
The insulin E-box element is activated by a ß-cell-enriched activator complex composed of BETA2 and E47 that contributes in cell-selective transcription (23,27). To characterize the factor(s) that bind to the ßGK E-box element, gel mobility shift assays were performed with HIT T-15 nuclear extracts and probes to both the ßGK and insulin E-box. Two major protein-DNA complexes (termed a and b) were shared between these elements (Fig. 2A). Competition assays performed with the unlabeled wild type and a consensus mtE indicated that each complex contained a bHLH binding factor(s) (Fig. 2A). The a complex was only detected in ßGK-expressing HIT T-15 and STC-1 nuclear extracts, whereas the b complex was also found in nuclear extracts prepared from nonexpressing cells (data not shown).



View larger version (64K):
[in this window]
[in a new window]
 
FIG. 2. BETA2:E47 and USF1 bind in vitro to the ßGK E-box. A: ßGK (lanes 1–4) and insulin (INS; lanes 5–8) E-box binding reactions were conducted with HIT-T15 nuclear extract either alone (–) or in the presence of a 10-fold molar excess to probe of the wild-type ßGK (lanes 2 and 6), insulin (lanes 3 and 7), or mutant ßGK mtE (lanes 4 and 8) competitor. The a and b complexes described in the text are labeled. B: BETA2 (lane 2) and E47 (lane 4) antisera was preincubated with HIT-T15 nuclear extract before initiation of the ßGK DNA-binding reaction. The arrow denotes the position of the super-shifted complex. Lanes 1 and 3 represent binding reactions conducted in the absence of antisera (–), and lanes 4 and 6 represent binding reactions in the presence of preimmune serum (PI). C: HIT-T15 nuclear extract binding to the ßGK probe was conducted in absence (–) or presence of USF1 (U1) or USF2 (U2) antisera, and a 10-fold molar excess of the consensus USF binding site (U) competitor.

 
The bHLH factor complexes that bind in gel shift assays to the insulin E-box contain the cell-enriched BETA2 transcription factor (i.e. as BETA2:E47) and the ubiquitously distributed USF (27,28). To determine whether these proteins were involved in binding to the ßGK E-box, a super-shift assay was performed with antibodies against BETA2, E47, and the two isoforms of USF (i.e. USF1 and USF2). The addition of antibodies to BETA2 or E47 to the binding reactions specifically disrupted the a complex, and a higher super-shifted complex was detected in each lane (Fig. 2B). In contrast, the preimmune serum had no effect on complex formation. In addition, antibodies raised against USF1, but not USF2, selectively disrupted the b complex (compare U1 with U2 in Fig. 2C). An unlabeled USF E-box consensus binding site competitor also specifically eliminated b complex binding (Fig. 2C). These same complexes were detected in gel shift assays performed with MIN6 and ßTC-3 nuclear extracts (data not shown). These results demonstrated that the two E-box element complexes contained BETA2:E47 (a complex) and USF-1 (b complex).

Methylation interference analysis was performed on the BETA2:E47 complex to identify the nucleotide contact sites within the ßGK E-box element. The core CA and TG nucleotides were found to be the primary contact sites, although variant nucleotides were also contacted (Fig. 3A). A similar in vitro binding pattern for BETA2:E47 has also been found with the E-box motifs of rat insulin I (29), rat insulin II (27), pro-opiomelanocortin (POMC) (30), and secretin (31) genes. Interestingly, both the -221 and -219 bp were strong contact sites (Fig. 3B), although only the -221-bp mutation (i.e. mt1) within the invariant bHLH factor binding core affected E-box element activity in transfection (Fig. 1C) and competition assays (Fig. 3C).



View larger version (57K):
[in this window]
[in a new window]
 
FIG. 3. BETA2:E47 has multiple nucleotide contact sites within the ßGK E-box. A: Partially methylated radiolabeled probes corresponding to the top or bottom strand of the -231/-198 bp ßGK fragment was used in preparative gel shift assays. DNA present in the a complex is shown. •, the residues, which, if methylated, strongly interfere with binding; {circ}, contact residues with a lesser effect. B: Summary of the BETA2:E47 nucleotide contacts within the ßGK E-box. C: Binding reactions were conducted with the ßGK E-box probe using HIT T-15 and STC-1 nuclear extracts in the presence of a 10-fold molar excess of unlabeled wild-type (wt), mt1, or mt2 competitor to probe.

 
BETA2:E47 selectively activates the ßGK E-box.
To determine whether BETA2:E47 or USF1 could directly activate ßGK E-box-mediated activation, we analyzed the effect of each upon expression of pßGKEboxTATALuc, a reporter plasmid that contains three copies of the ßGK E-box inserted directly upstream of the promoter region in the pTATALuc reporter gene. pßGKEboxTATALuc was transfected into BHK cells either alone or in the presence of the BETA2, E47, USF1, or USF2 expression plasmids. ßGK E-box-mediated expression was stimulated by E47 alone but more effectively by E47 and BETA2 (Fig. 4A). These factors did not affect the activity of the insert-less vector pTATALuc (Fig. 4B). Furthermore, activation was not observed with BETA2, USF1, or USF2 alone (Fig. 4). Because BETA2 and E47 only appear to be found together in cells (23), these results strongly suggest the ßGK E-box activity is mediated by this cell-enriched activator complex.



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 4. BETA2:E47 activates ßGK E-box dependent expression. The ßGK E-Box-TATA-Luc (lanes 1–4 and 7–10) and TATA-Luc reporters (lanes 5, 6, 11, and 12) were cotransfected into BHK cells with expression vectors encoding for E47, BETA2, USF1, and USF2, as indicated. Values are expressed as the normalized fold induction ± SD relative to the reporter gene alone.

 
BETA2 binds within the upstream ßGK promoter region in vivo.
The ChIP assay is a powerful tool for analyzing transcription factor binding in vivo (32,33). To directly address whether BETA2 binds to the upstream promoter of the endogenous ßGK gene, formaldehyde cross-linked chromatin from ßGK-expressing MIN6 ß-cells was treated with BETA2 polyclonal IgG or goat polyclonal IgG. The DNA brought down by this treatment was PCR amplified with ßGK and PEPCK promoter-specific primers. The antibody to BETA2 was capable of immunoprecipitating upstream ßGK promoter sequences, whereas goat polyclonal IgG or the control without IgG could not (Fig. 5). However, the BETA2 IgG did not immunoprecipitate transcription control sequences from the PEPCK gene, which is not transcribed in ß-cells. These results demonstrate that BETA2 occupies the ßGK promoter region of the endogenous ßGK gene in ß-cells. The same conclusion was drawn in ChIP experiments performed in ßTC-3 cells (data not shown). Together with the gel shift and transfection data described above, these results demonstrate that BETA2 regulates ßGK promoter-mediated transcription.



View larger version (48K):
[in this window]
[in a new window]
 
FIG. 5. BETA2 binds to the ßGK promoter region in vivo. Cross-linked chromatin from MIN6 cells was incubated with a polyclonal antibody raised to BETA2. The BETA2-immunoprecipitated DNA was analyzed by PCR for ßGK and PEPCK promoter region sequences (lane 3). As controls, PCRs were run on total-input chromatin (lane 2), with no DNA (lane 1), with DNA obtained after precipitating with goat IgG (lane 4), or with no antisera (lane 5).

 

    DISCUSSION
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
ßGK plays a critical role in adult islet ß-cell function by catalyzing the rate-limiting step of glucose-induced insulin release (34). ßGK mRNA transcription in the islet, gut, pituitary, and brain is controlled by sequences in the upstream promoter region (10,11,13). Experiments performed in transgenic mice have shown that tissue-specific expression is mediated by cis-acting elements found between -280 and +14 bp (3). Here, we show that a bHLH protein complex containing BETA2 and E47 regulates activation in islet ß-cell and gut enteroendocrine cells from the conserved E-box element at -221/-216 bp.

Our initial strategy involved testing within a GK gene promoter construct spanning -402 to +14 bp, the effect of site-directed mutants within the potential E-box element at -221 to -216 bp. Under these circumstances, a mutant that blocked bHLH protein binding reduced activation by ~50% in HIT T-15, ßTC-3, MIN6, and RIN ß-cell lines, whereas no effect was observed in a mutant that did not influence binding. In contrast, a previous study found that there was only an 18% decrease in activation in a 5'-flanking deletion mutant that removed this E-box region (10). Most likely, sequences within the vector minimized the control features of the GK E-box in this study.

Both BETA2:E47 and USF-1 were shown to bind specifically to the ßGK E-box probe in gel shift assays (Fig. 2). To test their role in activation, the ability of BETA2, E47, USF-1, and USF-2 to stimulate ßGK E-box-driven reporter expression was analyzed in BHK cells. E47 and BETA2 stimulated activity, in contrast to either of the USF proteins (Fig. 4). Because the USF proteins independently bind to their DNA regulatory target (35), their inability to activate indicates that they are not involved in ßGK E-box control in vivo. Most significantly, BETA2 was shown to specifically bind to a region spanning the E-box within the endogenous ßGK promoter, using the ChIP assay (Fig. 5). These data strongly suggest that BETA2:E47 specifically binds to and activates the upstream ßGK promoter in the islet and gut. BETA2:E47 has also been shown to control insulin (23), glucagon (islet ß-cells) (36), secretin (gut enteroendocrine cells) (31,37), and POMC (pituitary corticotropes) (38) gene expression in ßGK-producing cell types.

In addition to its role as a transcriptional activator, BETA2 plays a significant role in the development of the pancreas, brain, and other gut endocrine cells. Targeted deletion of BETA2 in mice, for instance, results in compromised formation of islet cells (23), hippocampal and cerebellar neurons (39), and both secretin- and cholecystokinin-expressing enteroendocrine cells (37). Although ßGK expression has not been fully analyzed in BETA2-null mice, the overlapping expression pattern of BETA2 with ßGK-producing cells in affected tissues implies a potential role of BETA2 in controlling ßGK gene transcription.

Because the E-box, Pal, and UPE elements appear to be maintained within the upstream transcription unit of all mammalian ßGK genes (17), the conserved sequences within this region are likely to contain the binding sites for the other key factors required in transcriptional activation. Indeed, our experimental results suggest that selective transcription from the ßGK promoter results from BETA2 cooperating with other factor(s) having a more cell-restricted expression pattern. It is likely that control is mediated through functional interactions with the PDX-1 homeodomain protein that binds to the three A+T-rich UPE elements of ßGK (10,40). PDX-1 contributes in transcription of other ß-cell-enriched genes, including insulin (15,41), islet amyloid polypeptide (4244), and GLUT2 (16). In the insulin gene, activation by BETA2:E47 and PDX-1 is mediated by the p300/CBP (CREB binding protein) coactivator (45), a mechanism that also may be utilized in the ßGK promoter.

Dysfunctional mutations in the coding region of GK are linked to a form of diabetes, termed maturity-onset diabetes of the young-type 2 (MODY-2) (46). Although GK was the first MODY locus discovered, the genetic basis for several other MODY subtypes were identified as transcription factors, including PDX-1 (47). Heterozygous mutations in PDX-1 in mice results in glucose intolerance (48). The inability to provide insulin in sufficient amounts to meet the body’s needs is also found in a form of type 2 diabetes caused by mutations in BETA2 (49). Our results indicate that conditions that effect the level or function of a factor involved in GK gene expression, like BETA2 and/or PDX-1, could also compromise ß-cell function.


    ACKNOWLEDGMENTS
 
This work was supported by the Veterans Administration (Research Career Development and MERIT Review Award to J.M.M.) and the National Institutes of Health (NIH RO1 DK55091 to R.S.) and partially by the Vanderbilt University Diabetes Research and Training Center Molecular Biology Core Laboratory (Public Health Service grant P60 DK20593 from the National Institutes of Health) and an National Institutes of Health grant to M.-J.T.

We are grateful to Lisa Kelly and Dr. Hsiang-Po Huang for expert technical assistance and to Dr. Michele Sawadogo (University of Texas M.D. Anderson Cancer Center) for providing the USF expression vectors.


    FOOTNOTES
 
J.M.M. is currently affiliated with the University of Alabama at Birmingham and the VA Medical Center, Birmingham, Alabama.

Address correspondence and reprint requests to J. Michael Moates, Rm. 706, BDB, the University of Alabama at Birmingham, Birmingham, AL 35294-0012. E-mail: mmoates{at}endo.dom.uab.edu.

Received for publication 26 June 2002 and accepted in revised form 31 October 2002.

ChIP, chromatin immunoprecipitation; FBS, fetal bovine serum; GIP, glucose-dependent insulinotropic peptide; GK, glucokinase; bHLH, basic helix-loop-helix; MODY, maturity-onset diabetes of the young; mtE, E-box-binding mutant; PDX-1, pancreatic duodenal homeobox 1; PMSF, phenylmethylsulfonyl fluoride; POMC, pro-opiomelanocortin; UPE, upstream promoter element; USF, upstream stimulatory factor.


    REFERENCES
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Printz RL, Magnuson MA, Granner DK: Mammalian glucokinase. Annu Rev Nutr13 :463 –496,1993[Medline]
  2. Matschinsky FM: Glucokinase as glucose sensor and metabolic signal generator in pancreatic beta-cells and hepatocytes. Diabetes39 :647 –652,1990[Abstract]
  3. Jetton TL, Liang Y, Pettepher CC, Zimmerman EC, Cox FG, Horvath K, Matchinsky FM, Magnuson MA: Analysis of upstream glucokinase promoter activity in transgenic mice and identification of glucokinase in rare neuroendocrine cells in the brain and gut. J Biol Chem269 :3641 –3654,1994[Abstract/Free Full Text]
  4. Maekawa F, Toyoda Y, Torii N, Miwa I, Thompson RC, Foster DL, Tsukahara S, Tsukamura H, Maeda K: Localization of glucokinase-like immunoreactivity in the rat lower brain stem: for possible location of brain glucose-sensing mechanisms. Endocrinology141 :375 –384,2000[Abstract/Free Full Text]
  5. Roncero I, Alvarez E, Vazquez P, Blazquez E: Functional glucokinase isoforms are expressed in rat brain. J Neurochem74 :1848 –1857,2000[Medline]
  6. Lynch RM, Tompkins LS, Brooks HL, Dunn-Meynell AA, Levin BE: Localization of glucokinase gene expression in the rat brain. Diabetes49 :693 –700,2000[Abstract]
  7. Cheung AT, Dayanandan B, Lewis JT, Korbutt GS, Rajotte RV, Bryer-Ash M, Boylan MO, Wolfe MM, Kieffer TJ: Glucose-dependent insulin release from genetically engineered K cells. Science290 :1959 –1962,2000[Abstract/Free Full Text]
  8. Schuit FC, Huypens P, Heimberg H, Pipeleers DG: Glucose sensing in pancreatic ß-cells: a model for the study of other glucose-regulated cells in gut, pancreas, and hypothalamus. Diabetes50 :1 –11,2001[Abstract/Free Full Text]
  9. Magnuson MA: Glucokinase gene structure: functional implications of molecular genetic studies. Diabetes39 :523 –527,1990[Abstract]
  10. Shelton KD, Franklin A, Khoor A, Beechem J, Magnuson MA: Multiple elements in the upstream glucokinase promoter are necessary for transcription in insulinoma cells. Mol Cell Biol12 :4578 –4589,1992[Abstract/Free Full Text]
  11. Jetton TL, Moates JM, Lindner J, Wright CV, Magnuson MA: Targeted oncogenesis of hormone-negative pancreatic islet progenitor cells. Proc Natl Acad Sci U S A95 :8654 –8659,1998[Abstract/Free Full Text]
  12. Leibiger IB, Walther R, Pett U, Leibiger B: Positive and negative regulatory elements are involved in transcriptional control of the rat glucokinase gene in the insulin producing cell line HIT M2.2.2. FEBS Lett337 :161 –166,1994[Medline]
  13. Moates JM, Shelton KD, Magnuson MA: Characterization of the Pal motifs in the upstream glucokinase promoter: binding of a cell type-specific protein complex correlates with transcriptional activation. Mol Endocrinol10 :723 –731,1996[Abstract]
  14. Leibiger B, Walther R, Leibiger IB: The role of the proximal CTAAT-box of the rat glucokinase upstream promoter in transcriptional control in insulin-producing cells. Biol Chen Hoppe Seyler375 :93 –98,1994
  15. Ohlsson H, Karlsson K, Edlund T: IPF-1, a homeodomain-containing transactivator of the insulin gene. EMBO J12 :4251 –4259,1993[Medline]
  16. Waeber G, Thompson N, Nicod P, Bonny C: Transcriptional activation of the GLUT2 gene by the IPF-1/STF-1/IDX-1 homeobox factor. Mol Endocrinol10 :1327 –1334,1996[Abstract]
  17. Postic C, Niswender KD, Decaux JF, Parsa R, Shelton KD, Gouhot B, Pettepher CC, Granner DK, Girard J, Magnuson MA: Cloning and characterization of the mouse glucokinase gene locus and identification of distal liver-specific DNase I hypersensitive sites. Genomics29 :740 –750,1995[Medline]
  18. Lee JE, Hollenberg SM, Snider L, Turner DL, Lipnick N, Weintraub H: Conversion of Xenopus ectoderm into neurons by NeuroD, a basic helix- loop-helix protein. Science268 :836 –844.,1995[Abstract/Free Full Text]
  19. Naya FJ, Huang HP, Qiu Y, Mutoh H, DeMayo FJ, Leiter AB, Tsai MJ: Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine differentiation in BETA2/neuroD-deficient mice. Genes Dev11 :2323 –2334,1997[Abstract/Free Full Text]
  20. Liu M, Pleasure SJ, Collins AE, Noebels JL, Naya FJ, Tsai MJ, Lowenstein DH: Loss of BETA2/NeuroD leads to malformation of the dentate gyrus and epilepsy. Proc Natl Acad Sci U S A97 :865 –870,2000 (published erratum appears in Proc Natl Acad Sci U S A 97:5679, 2000)[Abstract/Free Full Text]
  21. Kim WY, Fritzsch B, Serls A, Bakel LA, Huang EJ, Reichardt LF, Barth DS, Lee JE: NeuroD-null mice are deaf due to a severe loss of the inner ear sensory neurons during development. Development128 :417 –426,2001[Abstract]
  22. Huang HP, Liu M, El-Hodiri HM, Chu K, Jamrich M, Tsai MJ: Regulation of the pancreatic islet-specific gene BETA2 (neuroD) by neurogenin 3. Mol Cell Biol20 :3292 –3307,2000[Abstract/Free Full Text]
  23. Naya FJ, Stellrecht CMM, Tsai MJ: Tissue-specific regulation of the insulin gene by a novel basic helix-loop-helix transcription factor. Gen and Dev9 :1009 –10019,1995
  24. Luo X, Sawadogo M: Functional domains of the transcription factor USF2: atypical nuclear localization signals and context-dependent transcriptional activation domains. Mol Cell Biol16 :1367 –1375,1996[Abstract]
  25. Miyazaki J, Araki K, Yamato E, Ikegami H, Asano T, Shibasaki Y, Oka Y, Yamamura K: Establishment of a pancreatic beta cell line that retains glucose-inducible insulin secretion: special reference to expression of glucose transporter isoforms. Endocrinology127 :126 –132,1990[Abstract]
  26. Murre C, McCaw PS, Baltimore D: A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins. Cell56 :777 –783,1989[Medline]
  27. Shieh SY, Tsai MJ: Cell-specific and ubiquitous factors are responsible for the enhancer activity of the rat insulin II gene. J Biol Chem266 :16708 –16714,1991[Abstract/Free Full Text]
  28. Whelan J, Cordle SR, Henderson E, Weil PA, Stein R: Identification of a pancreatic beta-cell insulin gene transcription factor that binds to and appears to activate cell-type-specific expression: its possible relationship to other cellular factors that bind to a common insulin gene sequence. Mol Cell Biol10 :1564 –1572,1990[Abstract/Free Full Text]
  29. German MS, Blaner MA, Nelson C, Moss LG, Rutter WJ: Two related helix-loop-helix proteins participate in separate cell-specific complexes that bind the insulin enhancer. Mol Endocrinol5 :292 –299,1991[Medline]
  30. Therrien M, Drouin J: Cell-specific helix-loop-helix factor required for pituitary expression of the pro-opiomelanorcortin gene. Mol Cell Biol13 :2342 –2353,1993[Abstract/Free Full Text]
  31. Mutoh H, Fung BP, Naya FJ, Tsai MJ, Nishitani J, Leiter AB: The basic helix-loop-helix transcription factor BETA2/NeuroD is expressed in mammalian enteroendocrine cells and activates secretin gene expression. Proc Natl Acad Sci U S A94 :3560 –3564,1997[Abstract/Free Full Text]
  32. Orlando V, Strutt H, Paro R: Analysis of chromatin structure by in vivo formaldehyde cross-linking. Methods11 :205 –214,1997[Medline]
  33. Crane-Robinson C, Wolffe AP: Immunological analysis of chromatin: FIS and CHIPS. Trends Genet14 :477 –480,1998[Medline]
  34. Matschinsky FM: Banting Lecture 1995: a lesson in metabolic regulation inspired by the glucokinase glucose sensor paradigm. Diabetes45 :223 –241,1996[Abstract]
  35. Sawadogo M, Roeder RG: Interaction of a gene-specific transcription factor with the adenovirus major late promoter upstream of the TATA box region. Cell43 :165 –175,1985[Medline]
  36. Dumonteil E, Laser B, Constant I, Philippe J: Differential regulation of the glucagon and insulin I gene promoters by the basic helix-loop-helix transcription factors E47 and BETA2. J Biol Chem273 :19945 –19954,1998[Abstract/Free Full Text]
  37. Mutoh H, Naya FJ, Tsai MJ, Leiter AB: The basic helix-loop-helix protein BETA2 interacts with p300 to coordinate differentiation of secretin-expressing enteroendocrine cells. Genes Dev12 :820 –830,1998[Abstract/Free Full Text]
  38. Poulin G, Turgeon B, Drouin J: NeuroD1/beta2 contributes to cell-specific transcription of the proopiomelanocortin gene. Mol Cell Biol17 :6673 –6682,1997[Abstract]
  39. Miyata T, Maeda T, Lee JE: NeuroD is required for differentiation of the granule cells in the cerebellum and hippocampus. Genes Dev13 :1647 –1652,1999[Abstract/Free Full Text]
  40. Watada H, Kajimoto Y, Umayahara Y, Matsuoka T, Kaneto H, Fujitani Y, Kamada T, Kawamori R, Yamasaki Y: The human glucokinase gene ß-cell-type promoter: an essential role of insulin promoter factor I/PDX-1 in its activation in HIT-T15 cells. Diabetes45 :1478 –1488,1996[Abstract]
  41. Peshavaria M, Gamer L, Henderson E, Teitelman G, Wright CVE, Stein R: XLHbox 8, an endoderm-specific Xenopus homeodomain protein, is closely related to a mammalian insulin gene transcription factor. Mol Endocrinol8 :806 –816,1994[Abstract]
  42. Bretherton-Watt D, Gore N, Boam DS: Insulin upstream factor 1 and a novel ubiquitous factor bind to the human islet amyloid polypeptide/amylin gene promoter. Biochem J313 :495 –502,1996
  43. Carty MD, Liliquist JS, Peshavaria M, Stein R, Soeller WC: Identification of cis- and trans-active factors regulating human islet amyloid polypeptide gene expression in pancreatic beta cells. J Biol Chem272 :11986 –11993,1997[Abstract/Free Full Text]
  44. Watada H, Kajimoto Y, Kaneto H, Matsuoka T, Fujitani Y, Miyazaki J, Yamasaki Y: Involvement of the homeodomain-containing transcription factor PDX-1 in islet amyloid polypeptide gene transcription. Biochem Biophys Res Commun229 :746 –751,1996[Medline]
  45. Qiu Y, Guo M, Huang S, Stein R: Insulin gene transcription is mediated by interactions between the p300 coactivator and PDX-1, BETA2, and E47. Mol Cell Biol22 :412 –420,2002[Abstract/Free Full Text]
  46. Froguel P, Vaxillaire M, Sun F, Velho G, Zouali H, Butel MO, Lesage S, Vionnet N, Clement K, Fougerousse F, et al: Close linkage of glucokinase locus on chromosome 7p to early-onset non-insulin-dependent diabetes mellitus. Nature356 :162 –164,1992[Medline]
  47. Stoffers DA, Zinkin NT, Stanojevic V, Clarke WL, Habener JF: Pancreatic agenesis attributable to a single nucleotide deletion in the human IPF1 gene coding sequence. Nat Genet15 :106 –110,1997[Medline]
  48. Dutta S, Bonner-Weir S, Montminy M, Wright C: Regulatory factor linked to late-onset diabetes? Nature392 :30 –32,1998[Medline]
  49. Malecki MT, Jhala US, Antonellis A, Fields L, Doria A, Orban T, Saad M, Warram JH, Montminy M, Krolewski AS: Mutations in NEUROD1 are associated with the development of type 2 diabetes mellitus. Nat Genet23 :323 –328,1999[Medline]

Add to CiteULike CiteULike   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moates, J. M.
Right arrow Articles by Stein, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moates, J. M.
Right arrow Articles by Stein, R.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Diabetes Diabetes Care Clinical Diabetes Diabetes Spectrum