Diabetes 52:642-649, 2003
© 2003 by the American Diabetes Association, Inc.
Regulation of PGC-1 Promoter Activity by Protein Kinase B and the Forkhead Transcription Factor FKHR
Hiroaki Daitoku1,
Kazuyuki Yamagata1,
Hitomi Matsuzaki1,
Mitsutoki Hatta1,2, and
Akiyoshi Fukamizu1
1 Center for Tsukuba Advanced Research Alliance, Institute of Applied Biochemistry, University of Tsukuba, Tsukuba, Japan
2 Department of Oral Pathobiology, Hokkaido University, Sapporo, Japan
 |
ABSTRACT
|
|---|
Peroxisome proliferatoractivated receptor- coactivator-1 (PGC-1) plays a major role in mediating hepatic gluconeogenesis in response to starvation, during which PGC-1 is induced by the cyclic AMP response element binding protein. Although it is observed that insulin counteracts PGC-1 transcription, the mechanism by which insulin suppresses the transcription of PGC-1 is still unclear. Here, we show that forkhead transcription factor FKHR contributes to mediating the effects of insulin on PGC-1 promoter activity. Reporter assays demonstrate that insulin suppresses the basal PGC-1 promoter activity and that coexpression of protein kinase (PK)-B mimics the effect of insulin in HepG2 cells. Insulin response sequences (IRSs) are addressed in the PGC-1 promoter as the direct target for FKHR in vivo. Coexpression of FKHR stimulates the PGC-1 promoter activity via interaction with the IRSs, while coexpression of FKHR (3A), in which the three putative PKB sites in FKHR are mutated, mainly abolishes the suppressive effect of PKB. Whereas deletion of the IRSs prevents the promoter stimulation by FKHR, that activity is still partially inhibited by insulin. These results indicate that signaling via PKB to FKHR can partly account for the effect of insulin to regulate the PGC-1 promoter activity via the IRSs.
It is established that protein kinase B (PKB) plays a critical role in various physiological events by phosphorylating numerous factors in response to insulin, IGF-I, and several growth factors (15). PKB-mediated phosphorylation is shown to modulate the function of forkhead transcription family members, such as FKHR AFX, and FKHRL1 (610). In the absence of phosphorylation, these forkhead proteins that localize to the nucleus interact with the insulin response sequence (IRS) within the promoters of multiple target genes, e.g., cell cycle regulators, a proapoptotic factor, and glucose metabolic enzymes (8,1015). Once bound to the target gene promoters via IRS, the forkhead proteins act as a potent activators of transcription. In contrast, when PKB is activated by insulin, the forkhead proteins are phosphorylated, resulting in promotion of their cytoplasmic accumulation, thus inactivating their transcriptional functions (10,16).
Several studies have shown that FKHR controls the expression of glucose metabolic enzymes such as glucose-6-phosphatase catalytic-subunit (G-6-Pase) and phosphoenolpyruvate carboxykinase (PEPCK) (1115). They are rate-limiting enzymes in homeostatic regulation of blood glucose concentration by breakdown of glycogen (glycogenolysis) and by de novo synthesis of glucose from noncarbohydrate precursors, such as lactate, pyruvate, glycerol, and alanine (gluconeogenesis). Although previous studies suggest that the PKB-mediated regulation of FKHR accounts for the effect of insulin to inhibit expression of the gluconeogenic genes, they also showed that another molecular mechanism contributes to the inhibitory effects of insulin on these genes expressions (11,13). For example, it is reported that insulin inhibits PEPCK gene transcription independently of the IRS within the PEPCK promoter, indicating that the phosphorylation of forkhead proteins by insulin is not sufficient to explain the suppressive effect of PEPCK gene expression (17). This observation suggests that FKHR induces PEPCK gene expression by an indirect transactivation mechanism through mediating the other transcription factors or coactivators.
Peroxisome proliferatoractivated receptor- (PPAR- ) coactivator-1 (PGC-1), first identified as a nuclear receptor coactivator that interacts with PPAR- , plays a key role in linking nuclear receptors to the transcriptional program of adaptive thermogenesis and oxidative metabolism (18,19,20). In addition, it is revealed that PGC-1 promotes transcription through the assembly of a complex containing histone acetyltransferase (HAT), such as cAMP response element binding protein (CREB)-p300 (CBP/p300) or steroid receptor coactivator-1 (SRC-1) (21). A recent study by Yoon et al. (22) has demonstrated that although PGC-1 mRNA is not significantly accumulated in the liver in the feeding state, PGC-1 is strongly induced in the liver in fasting mice and in three mouse models deficient for insulin action. Moreover, the overexpression of PGC-1 in hepatic cells increases glucose production and the transcription of genes encoding gluconeogenic enzymes. One of these genes PEPCK, is induced by PGC-1 cooperating with glucocorticoid receptor and the liver-enriched transcription factor hepatocyte nuclear factor (HNF)-4. On the other hand, Herzig et al. (23) has demonstrated that transgenic mice overexpressing a dominant-negative CREB in the liver exhibit fasting hypoglycemia and reduced expression of gluconeogenic enzymes. Furthermore, it has been shown that CREB binds to the target sequence (cAMP-response element [CRE]) in the PGC-1 promoter, thereby enhancing the expression of PGC-1 in response to cAMP. These findings represent a mechanism by which glucagon, which induces the livers glucose output in the starved condition, can activate an entire program of gluconeogenesis by increasing in the levels of a coactivator protein, PGC-1. In contrast, they have also shown that the treatment of insulin reduces endogenous PGC-1 mRNA in hepatoma cells (23). Although insulin is usually considered to have the exact opposite effect of hormones like glucagon, adrenaline, and glucocorticoids, which promote glucose output from the liver, the underlying mechanism of how insulin suppresses the PGC-1 expression is still unclear. Hence, we set out to elucidate a negative regulation of PGC-1 expression by insulin.
Here, we show that FKHR participates in stimulation and insulin inhibition of the gene for PGC-1. FKHR-stimulated PGC-1 promoter activity or/and PGC-1 basal promoter activity is negatively modulated in PKB-dependent phosphorylation in HepG2 cells. We also identify the functional IRSs in the PGC-1 promoter as cis-acting elements for FKHR binding in vivo and in vitro. Furthermore, we find that activated PKB counteracts the induced PGC-1 promoter activity by FKHR wild-type but not by FKHR (3A) mutant deficient for PKB phosphorylation. These results suggest that PKB-mediated FKHR transinactivation in the PGC-1 gene confers the suppressive effect of insulin on PGC-1 expression.
 |
RESEARCH DESIGN AND METHODS
|
|---|
Cell culture, transfections, and reporter gene assays.
HepG2 cells were cultured in Dulbeccos modified Eagles medium (DMEM) supplemented with 10% fetal bovine serum (FBS). Transfections were performed by the calcium phosphate method. pRSV-ß-galactosidase plasmid was included in each transfection experiment to control for the efficiency of transfection. To ensure equal DNA amounts, empty plasmids were added in each transfection. After transfection, cells were incubated in DMEM supplemented with 10% FBS for 24 h. Thereafter, the medium was replaced with serum-free DMEM containing 0.1% BSA and incubation was continued for 18 h. When necessary, insulin or wortmannin were added. The luciferase activity was measured with AutoLumat (Berthold) and normalized for ß-galactocidase activity in the same sample.
Cloning and plasmids.
pcDNA3-FLAG-FKHR was generated by RT-PCRbased cloning of mouse FKHR cDNA into pcDNA3-FLAG vector as described previously (24). The putative PKB phosphorylation sites at Thr-24, Ser-253, and Ser-316 were mutated to Ala by PCR mutagenesis. A genomic clone encompassing human PGC-1 promoter extended from -992 to +90 bp relative to the transcription initiation site was subcloned into the BglII site of the promoterless pRL-basic luciferase reporter gene vector to generate PGC-1promoter luc. The deletion mutants, various PGC-1 promoter ( IRS)-luc and ( CRE)-luc reporter plasmids, were generated by PCR mutagenesis. Constitutively active or dominant-negative PKB expression plasmids were obtained from Upstate Biotechnology.
Generation of anti-FKHR antibody.
A rabbit polyclonal antibody specific for mouse FKHR was raised against the bacterially expressed GST-FKHR (541652 a.a.) fusion protein. The purified protein was injected into a rabbit and boosted five times. Serum from immunized rabbits was affinity purified by use of the antigen (Tanpaku Seisei Kougyou, Gunma, Japan).
Chromatin immunoprecipitation assay.
Cells were grown to 95% confluence in DMEM supplemented with 10% FBS. Thereafter, medium was replaced with serum-free DMEM containing 0.1% BSA and incubation was continued for 18 h. Following the treatment with 100 nmol/l insulin for 30 min or not, cells were washed twice with PBS and cross-linked with 1% formaldehyde at 37°C for 10 min. Cells then were rinsed with ice-cold PBS twice and collected into PBS containing protease inhibitors and centrifuged for 4 min. Cells were resuspended in SDS lysis buffer (1% SDS, 10 mmol/l EDTA, 50 mmol/l Tris-HCl, pH 8.1 and protease inhibitors) and incubated for 10 min on ice. The lysate was sonicated four times for 10 s each (MISONIX, microson) followed by centrifugation for 10 min. Supernatants were collected and diluted in chromatin immunoprecipitation (ChIP) dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mmol/l EDTA, 167 mmol/l NaCl, 16.7 mmol/l Tris-HCl, pH 8.1, and protease inhibitors) followed by preclean with 30 µg sheared salmon sperm DNA, 5 µg normal rabbit IgG, and 60 µl protein G-Sepharose-50% slurry for 2 h at 4°C. Immunoprecipitation was performed overnight at 4°C with anti-FKHR-C3 antibody. After immunoprecipitation, 60 µl protein G-Sepharose-50% slurry and 20 µg salmon sperm DNA were added and the incubation was continued for another 1 h. Precipitates were washed sequentially for 5 min each in low salt (0.1% SDS, 1% Triton X-100, 2 mmol/l EDTA, 20 mmol/l Tris-HCl, pH 8.1, and 150 mmol/l NaCl), high salt (0.1% SDS, 1% Triton X-100, 2 mmol/l EDTA, 20 mmol/l Tris-HCl, pH 8.1, and 500 mmol/l NaCl), and LiCl wash buffer (0.25 mol/l LiCl, 1% NP-40, 1% deoxycholate, 1 mmol/l EDTA, and 10 mmol/l Tris-HCl, pH 8.1). Precipitates were then washed twice with TE buffer and eluted twice with 1% SDS and 0.1 mol/l NaHCO3. Eluates were pooled and heated at 65°C for at least 4 h to reverse the formaldehyde cross-linking. Following the addition of Protease K and incubated for 1 h at 45°C, DNA fragments were purified by phenol/chloroform extraction and ethanol precipitation. Precipitated DNA fragments were analyzed by PCR amplification using primers detected against the human PGC-1 promoter region or the ß-actin coding region as negative control. The PCR products were analyzed by electrophoresis using 0.7% agarose gel and visualized with ethidium bromide staining.
Avidin-biotin conjugate DNA precipitation assay.
The following double stranded oligonucleotides were used, all biotinylated at the 3'-end of the sense strand, IRS1: AGTGTGTTGGTATTTTTCCCTCAGTTC, IRS2: ACATACAGGCTATTTTG-TTGATTAAAC, and IRS3: GCCACTTGCTTGTTTTGGAAGGAAAAT. The consensus insulin response sequences are italicized. 3xIRS consisted of three copies of the IRS derived from the IGFBP-1 promoter, while 3xIRS mut carried substitutions in IRS core residues of 3xIRS. An avidin-biotin conjugate DNA precipitation (ABCD) assay was performed by incubating cell extracts derived from HepG2 cells with double-stranded DNA immobilized on streptavidin agarose in binding buffer (20 mmol/l HEPES [pH 7.5], 150 mmol/l KCl, 0.5% Triton X-100, 0.5 mmol/l EDTA, 20 g/ml poly [dI-dC], and protease inhibitors). After 20 min of incubation at 4°C, the beads were washed four times with the same buffer and proteins were resolved by SDS-PAGE, followed by electrotransfer onto polyvinylidine fluoride membrane and probed with the anti-FKHR antibody. Chemiluminescent detection relied on horseradish peroxidaseconjugated secondary antibodies.
 |
RESULTS
|
|---|
Insulin inhibits basal PGC-1 promoter activity via PKB-dependent pathway.
A recent study has shown that insulin reduces endogenous PGC-1 mRNA in FAO hepatoma cells (23). This observation raises the question of how insulin modulates PGC-1 expression. To reveal the molecular mechanism whereby insulin suppresses PGC-1 expression, a promoter sequence of the human PGC-1 gene was isolated and inserted into a promoterless luciferase reporter gene plasmid. Because we found that a fragment of the human PGC-1 promoter from -992 to +90, relative to the transcription start site, contains three consensus IRSs, we hypothesized that a trans-factor(s) modulated by insulin signaling binds to IRSs and regulates the PGC-1 promoter activity.
To investigate the effect of insulin on PGC-1 promoter, we conducted a series of transient transfection assays in HepG2 cells. First, the reporter plasmid containing the human PGC-1 promoter (PGC-1 promoter luc) was transfected into HepG2 cells, following treatment with or without 10% FBS or 100 nmol/l insulin. Serum stimulation substantially suppressed PGC-1 promoter activity, and particularly, insulin treatment was far more effective in reducing it by 50% than incubation with serum-free medium (Fig. 1A). This is in agreement with previous data in which insulin suppresses PGC-1 gene transcription in intact hepatoma cells (23), and thus we considered that the PGC-1 promoter luciferase (luc) reporter plasmid included the abilities to mimic the inhibitory effect of insulin on PGC-1 expression. Next, because expression of active PKB is sufficient to mimic insulins inhibitory effects on transcription through IRS-containing promoters (2527), we tested whether the basal PGC-1 promoter activity is regulated by coexpression of a constitutively active (CA) or a dominant negative (DN) mutants of PKB. Figure 1B shows that transfected PKB (CA) mutant represses basal PGC-1 promoter activity to the same extent as insulin treatment (Fig. 1A), whereas no inhibition was detected with PKB (DN) mutant, suggesting that the inhibitory effect of insulin on the PGC-1 promoter are mediated by PKB. Furthermore, to confirm that the effect of insulin actually involves the PKB pathway, we investigated whether the insulin-inhibited PGC-1 promoter activity is recovered by coexpression of a PKB (DN). As expected, overexpressed PKB (DN) counteracted the inhibitory effect of insulin on the PGC-1 promoter (Fig. 1C). These results indicated that the PKB pathway acts downstream of insulin receptor signaling to modulate PGC-1 gene transcription in HepG2 cells.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 1. Insulin inhibits basal PGC-1 promoter activity via PKB pathway. A: HepG2 cells were transfected with 100 ng human PGC-1 promoter luc plasmid containing promoter sequence from -992 to +90 (PGC-1 promoter luc). Following transfection, cells were incubated in the absence or presence of 10% FBS for 18 h and treated with or without 100 nmol/l insulin. B: HepG2 cells were transfected with 100 ng PGC-1 promoter luc together with 50 ng empty vector, constitutively active mutant PKB (CA), or catalytically inactive mutant PKB (DN) expression plasmids. Following transfection, cells were serum-starved for 18 h. C: HepG2 cells were transfected with 20 ng PGC-1 promoter luc together with 20 ng empty vector or PKB (DN) expression plasmid. Following transfection, cells were treated with 100 nmol/l insulin for 18 h. The results are presented as relative luc activities compared with the activity in serum-starved condition (A and C) or the activity after the coexpression of the empty vector (B), which was set as 100%.
|
|
Insulin inhibits FKHR-stimulated PGC-1 promoter activity.
It has been shown that PKB phosphorylates the Forkhead transcription factor FKHR, and consequently represses its ability of transactivaton, probably by disturbing the nuclear import of FKHR (2830). To study a potential role of FKHR in regulating PGC-1 promoter activity, HepG2 cells were cotransfected with the PGC-1 promoter luc and an FKHR expression plasmid. Under a condition of serum-starvation, transfected FKHR in HepG2 cells stimulated PGC-1 promoter activity in a dose-dependent manner, indicating that the transactivation of PGC-1 gene is indeed mediated by FKHR (Fig. 2A). Furthermore, to examine the effects of insulin on FKHR-induced PGC-1 promoter activity, HepG2 cells were cotransfected with the PGC-1 promoter luc and FKHR expression plasmids and then incubated in serum-free medium with or without insulin treatment (Fig. 2B). Compared with the control insulin-free condition, insulin was able to suppress FKHR-stimulated PGC-1 promoter activity by 50% and to a similar extent for inhibiting basal activity (Fig. 2B). These results suggest that insulin inhibits induction of PGC-1 gene by specifically interfering with FKHR activity.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2. FKHR activates PGC-1 promoter activity (A), and the FKHR-stimulated PGC-1 promoter activity is inhibited by insulin treatment (B). A: HepG2 cells were transfected with 100 ng PGC-1 promoter luc together with 10, 20, and 50 ng FKHR expression plasmids. Following transfection, cells were serum-starved for 18 h. The results are presented as arbitrary units. B: HepG2 cells were transfected with 100 ng PGC-1 promoter luc together with or without 20 ng FKHR expression plasmids. Following transfection, cells were serum-starved for 18 h in the presence or absence of 100 nmol/l insulin. The results are presented as arbitrary units.
|
|
Insulin inhibits the binding of FKHR to PGC-1 promoter in vivo.
In response to insulin, PKB-mediated phosphorylation is shown to modulate the function of FKHR, which directly binds to the IRS in several gene promoters in vitro (7,1013,24). We have identified the three consensus IRSs in the PGC-1 promoter: IRS1, IRS2, and IRS3 (Fig. 3A). To investigate whether the PGC-1 promoter is a direct target for FKHR in vivo, we performed ChIP assays in the presence or absence of insulin treatment. HepG2 cells were serum-starved for 18 h followed by treatment with or without insulin, and then soluble chromatin was prepared from cultured cells after cross-linking. For immunoprecipitation of FKHR-bound genomic DNA fragments, a specific antibody against FKHR was used and the immunoprecipitated DNAs were analyzed by PCR using the specific pairs of primers spanning the IRSs (Fig. 3A). Figure 3B shows that the PGC-1 promoter was efficiently recovered from immunoprecipitates of FKHR but not of control normal rabbit IgG. No PCR product was obtained from normal rabbit IgG or FKHR immunoprecipitates using control ß-actin primers. In addition, FKHR recruitment to the PGC-1 promoter was significantly decreased after insulin treatment. These data show that endogenous FKHR can bind to the chromatinized PGC-1 promoter in the serum-starved condition in HepG2 cells.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 3. Endogenous FKHR binds the PGC-1 gene regulatory region. A: A schematic representation of the human PGC-1 gene regulatory region. The presence of putative IRSs and a consensus CRE are shown by solid or oval boxes, respectively. Arrows indicate a primer pair used for amplifying corresponding the DNA fragment. The numbers are the positions upstream to the PGC-1 gene transcription start site (+1). B: Chromatin immunoprecipitation assays of FKHR occupancy on the human PGC-1 promoter region. HepG2 cells were serum-starved and treated with or without 100 nmol/l insulin. Soluble chromatin was immunoprecipitated with antibodies against FKHR or normal rabbit IgG as a negative control. Precipitated DNA fragments were analyzed by PCR amplification using primers against the human PGC-1 promoter region described in A or the ß-actin coding region as a negative control.
|
|
FKHR binds to PGC-1 promoter IRSs in vitro.
Because the PGC-1 promoter is identified as an in vivo target for FKHR, we next determined whether FKHR could interact with three putative IRSs within the PGC-1 promoter in vitro. To this end, we performed an ABCD assay using biotin conjugate, double-stranded oligonucleotides that contains consensus insulin response sequences termed IRS1, IRS2, or IRS3 (Fig. 4A). Whole cell lysates extracted from intact HepG2 cells were mixed with each oligonucleotide immobilized on streptavidin agarose. As shown in Fig. 4B, endogenous FKHR strongly binds to IRS2 and IRS3, but weakly to IRS1 probe. In the control experiment, a biotinylated 3xIRS, which consists of the three copies of IRS derived from the IGFBP-1 promoter sequence, precipitated FKHR efficiently, whereas, a mutated IRS (3xIRS mut) did not. These findings indicate that FKHR binds to all putative IRSs in the PGC-1 promoter in vitro.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 4. FKHR binds all putative IRSs and potentiates PGC-1 promoter activity. A: The biotinylated oligonucleotides used in an ABCD assay are shown. Black boxes depict putative IRSs, termed IRS1, IRS2, and IRS3, respectively. B: The ABCD assay was performed using a double-stranded IRS1, IRS2, IRS3, 3xIRS mut, and 3xIRS with whole cell extract from nontransfected HepG2 cells. The 3xIRS and 3xIRS mut were three copies of the wild-type or mutated IRS derived from the IGFBP-1 promoter sequence, respectively. After washing the beads, proteins were detected by Western blot analysis. The input lane represents 5% of the total volume of whole cell extracts used for the binding assay. C: Effects of deletion of the IRSs on FKHR-induced PGC-1 promoter activity. HepG2 cells were transfected with 100 ng of PGC-1 promoter luc, various IRS-, or CRE-deleted mutants described in left panel, together with or without 50 ng FKHR expression plasmid. Following transfection, cells were serum-starved for 18 h. The results are presented as fold activation compared with the relative luc activities after the coexpression of the empty vector control, which was set as 1.
|
|
IRS elements are required for both the FKHR-induced and the basal PGC-1 promoter activity.
Furthermore, to confirm the FKHR response region in the PGC-1 promoter, we performed the reporter assay using a series of putative IRS- and CRE-deleted promoter constructs. Respective IRSs located from -976 to -970 (IRS1), -586 to -580 (IRS2), and -354 to -348 (IRS3) are depicted in Fig. 3A, and the transcriptional activities of these constructs were tested in the presence or absence of the FKHR expression plasmid. Compared with intact PGC-1 promoter luc, the deletion of each IRS1, IRS2, or IRS3 reduced the FKHR-mediated activation by 30%, whereas no substantial activation was observed using the IRS1/2/3 promoter, which lacks all the IRSs (Fig. 4C). Remarkably, this construct reduced basal promoter activity by 40% (data not shown), indicating that the three IRSs are required for maintaining the basal promoter activity in HepG2 cells. In contrast, the deletion of CRE (from -132 to -125) in the PGC-1 promoter had no influence on the extent of fold activation by FKHR compared with the intact PGC-1 promoter activity. Taken together, these results demonstrate that the three consensus IRSs, characterized in the PGC-1 promoter (-992 to +90), are required for both the basal and FKHR-stimulated reporter activity.
Phosphorylation of FKHR accounts for inhibitory effect of insulin on PGC-1 promoter activity.
To determine whether PKB-dependent phosphorylation of FKHR is critical for the PGC-1 gene suppression, we used a FKHR (3A) mutant, which is mutated at the three PKB phosphorylation sites (T24, S253, and S316) to alanines. This mutant is known to be resistant to the inhibitory effect by phosphorylation, resulting in the promotion of nuclear retention and of access to the target sequences (710,28,29). Cotransfection assays showed that FKHR (3A) possessed the activity to induce the PGC-1 gene transcription about twofold more than wild-type FKHR, whereas that activity was not suppressed by coexpression of PKB (CA) compared with the suppression of basal or FKHR wild-typestimulated activity (Fig. 5A). Consistent with the cotransfection assays, insulin was not able to inhibit FKHR (3A)-stimulated PGC-1 promoter activity (data not shown). These results indicate that phosphorylation of putative PKB sites in FKHR is required for PKB-dependent suppression of FKHR-stimulated PGC-1 promoter activity.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 5. Insulin inhibits PGC-1 promoter activity via IRSs. A: HepG2 cells were transfected with 100 ng PGC-1 promoter luc together with 20 ng empty vector, FKHR wild-type, or FKHR (3A) expression plasmids with or without 10 ng PKB (CA) expression plasmid. Following transfection, cells were serum-starved for 18 h. The results are presented as relative activities compared with that in cotransfection of empty vector (lane 1), which was set as 100%. B: HepG2 cells were transfected with 20 ng PGC-1 promoter luc, or all IRS-deleted mutant (PGC-1 IRS1/2/3 promoter luc) plasmids. Following transfection, cells were serum-starved for 18 h in the presence or absence of 100 nmol/l insulin and 200 nmol/l wortmannin, which was added 30 min before insulin. The results are presented as relative activities compared with that in transfection of PGC-1 promoter luc in the absence of insulin or wortmannin (lane 1), which was set as 100%.
|
|
Furthermore, to examine whether the three IRSs in the PGC-1 promoter are sufficient for the inhibitory effect of insulin, HepG2 cells were transfected with intact or IRS1/2/3 PGC-1 promoter luc and then incubated with insulin and the phosphatidylinositol (PI)-3 kinase inhibitor, wortmannin, as indicated in Fig. 5B. In the intact promoter, treatment with wortmannin abolished the inhibitory effect of insulin, revealing the involvement of PI3 kinase in the insulin-mediated PGC-1 inhibition. In contrast, although the inhibitory effect of insulin on the PGC-1 promoter was not completely diminished by eliminating all three IRSs, no substantial inhibition was observed by insulin and wortmannin treatments in the IRS1/2/3 PGC-1 promoter (Fig. 5B). Remarkably, this construct reduced basal promoter activity by 50%, indicating that the three IRSs are required for maintaining the basal promoter activity in HepG2 cells. The attenuated inhibition in IRS1/2/3 PGC-1 promoter implies that FKHR partially confers the inhibitory effect of insulin via the IRSs in the PGC-1 promoter.
 |
DISCUSSION
|
|---|
Based on our results, we propose a model for the transcriptional regulation of the PGC-1 promoter in which both FKHR and CREB stimulate the promoter activity via each response element (Fig. 6). Glucagon is known to potentiate the cAMP signaling pathway, resulting in phosphorylation of CREB by PKA (protein kinase A), and consequently the phosphorylated CREB appears to recruit a coactivator CBP to the PGC-1 promoter through the CRE, and induce PGC-1 expression (23). In this study, we elucidated that FKHR activates the PGC-1 promoter through the three consensus IRSs identified, while insulin inhibits both basal and FKHR-stimulated PGC-1 promoter activities by PKB-dependent phosphorylation of FKHR (Figs. 15). These findings are reminiscent of a recent study analyzing transgenic mice with the cardiac-specific expression of activated PKB (31). The significant downregulation of PGC-1 is observed by overexpression of activated PKB, indicating that PKB signaling suppresses the basal PGC-1 expression in vivo.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 6. Transcriptional regulation of the PGC-1 promoter by FKHR and CREB. A schematic model for PGC-1 gene transcription mediated by FKHR and CREB through each responsive element via different hormone signals. Left: insulin activates PI3 kinase signaling pathway, which stimulates phosphorylation of FKHR by PKB, followed by nuclear exclusion and repression of PGC-1 gene transcription. Right: Glucagon activates cAMP signaling pathway, which stimulates phosphorylation of CREB by PKA, and thereby induces the expression of PGC-1.
|
|
Alternatively, we found that the PGC-1 promoter was partially suppressed by insulin (Fig. 5B) or transfected PKB (CA) (data not shown), even after deletion of the three IRSs (Fig. 5B). A possible explanation for this inhibition is that a IRS1/2/3 PGC-1 promoter construct still contains the functional CRE. A previous study demonstrated that insulin-dependent activation of the Ras pathway represses CREB activity by inducing recruitment of the S6 kinase pp90RSK to CBP (32). Therefore, binding of pp90RSK to CBP might counteract basal cAMP signal transduction, and thereby suppresses the IRS1/2/3 PGC-1 promoter activity. In addition to the PGC-1 promoter, similar observations are reported in the G-6-Pase and PEPCK genes, where disruption of IRS does not completely impair the inhibitory effect of insulin on their promoters (11,17). These findings suggest that other cis-activating elements or trans-acting factors also play roles in mediating the effect of insulin signaling.
The genes encoding limiting enzymes for gluconeogenesis are powerfully controlled at the transcriptional level by key hormones, particularly insulin, glucagon, and glucocorticoid. Although recent data have shown a critical role for PKB in insulin-dependent inhibition of hepatic gluconeogenesis, it has not been elucidated whether that component is involved in the regulation of PGC-1 expression (33). In this paper, we show that insulin can suppress PGC-1 promoter activity by mediating the function of FKHR via PKB signaling pathway. This finding provides an idea that FKHR can regulate PEPCK gene expression, not only through direct binding to that promoter, but also through indirect activation, in which the induced PGC-1 protein works as a coactivator with HNF-4 and glucocorticoid receptors in PEPCK gene transcription (22). This two-dimension model may explain a paradox that insulin inhibits PEPCK gene transcription independently of the IRS on that promoter (17).
The liver-specific insulin-receptor knockout (LIRKO) mice are unique models exhibiting dramatic insulin resistance in the liver, severe glucose intolerance, and the failure of insulin to suppress hepatic glucose production (34). This line of the mice also displays the transcriptional induction of G-6-Pase and PEPCK genes in the liver. Interestingly, recent data have shown that the expression of PGC-1 distinctively increases in the livers of the LIRKO mice (22). Although an indirect effect of insulin cannot be excluded, this in vivo observation implies that insulin is the dominant regulator of PGC-1 expression, possibly through FKHR-regulated transcription. Here, we propose a model in which FKHR is essential for maintaining basal PGC-1 expression, while CREB is necessary for stimulating further induction of PGC-1 by glucagon in the starved condition.
Our results argue for a three-stage model in the activation of PGC-1 gene by FKHR and CREB from feeding to fasting. First, in the feeding stage, glucagon secretion drops to the basal level while insulin increases to the maximal level, resulting in phosphorylation of sole FKHR by PKB. Because phosphorylated FKHR is excluded from the nucleus and unphosphorylated CREB cannot recruit CBP as a coactivator, neither of them can stimulate PGC-1 transcription. Hence, hepatic gluconeogenesis through the induced expression of PGC-1 would be almost eliminated in the feeding stage. Second, during early fasting stage (interphase), glucagon secretion gradually goes up while insulin level moderately drops, consequently increasing in the proportions of phosphorylated CREB and unphosphorylated FKHR, and then both activated transcription factors can induce PGC-1 expression. Third, under prolonged fasting stage (so called starved), glucagon secretion further increases to the maximal level while insulin decreases to the basal level, leading to CREB phosphorylation by PKA and preventing FKHR from PKB-dependent phosphorylation. Consequently, both phosphorylated CREB and unphosphorylated FKHR may synergistically induce PGC-1 expression, and hence the hepatic gluconeogenesis occurs rapidly to maintain basal blood glucose level for protecting the body against hypoglycemia.
In addition to the previous reports in which FKHR was shown to play an important role in mediating the expression of gluconeogenic genes including G-6-Pase and PEPCK, we have shown here that FKHR also regulates PGC-1 expression in the transcriptional level. This result suggests that the molecular mechanism of FKHR transcription is principally linked to regulating gluconeogenesis. Because excessive hepatic glucose production by the gluconeogenesis is known to be a major contributor to both the fasting hyperglycemia and the exaggerated postprandial hyperglycemia in diabetes (35), controlling FKHR functions in the liver could be a remarkable target for antidiabetic therapy. To conduct that strategy, however, further studies would be required to elucidate the tissue-specific physiological significance of FKHR functions.
 |
ACKNOWLEDGMENTS
|
|---|
This work was supported by grants from "Research for the Future" Program (The Japan Society for the Promotion of Science: JSPSRFTF 97L00804), Grant-in-Aid for Scientific Research (A) and Grant-in Aid for Scientific Research on Priority Areas from the Ministry of Education, Science, Sports, and Culture of Japan, The Asahi Glass Foundation and the Research Grant for Cardiovascular Disease (11C-1) from the Ministry of Health, Labor, and Welfare.
We thank all members of Fukamizu laboratory for their helpful discussion.
 |
FOOTNOTES
|
|---|
Address correspondence and reprint requests to Akiyoshi Fukamizu, Center for Tsukuba Advanced Research Alliance, Institute of Applied Biochemistry, University of Tsukuba, Tennoudai 1-1-1, Tsukuba, Ibaraki 305-8577, Japan. E-mail: akif{at}tara.tsukuba.ac.jp.
Received for publication 12 August 2002 and accepted in revised form 6 December 2002.
ABCD, avidin-biotin conjugate DNA precipitation; CA, constitutively active; ChIP, chromatin immunoprecipitation; CRE, cAMP-response element; CREB, cAMP response element binding protein; DMEM, Dulbeccos modified Eagles medium; DN, dominant negative; FBS, fetal bovine serum; G-6-Pase, glucose-6-phosphatase catalytic-subunit; HNF, hepatocyte nuclear factor; IRS, insulin response sequence; luc, luciferase; PEPCK, phosphoenolpyruvate carboxykinase; PK, protein kinase; PPAR- , peroxisome proliferatoractivated receptor- ; PGC-1, PPAR- coactivator-1; PI, phosphatidylinositol.
 |
REFERENCES
|
|---|
- Kandel ES, Hay N: The regulation and activities of the multifunctional serine/threonine kinase Akt/PKB.
Exp Cell Res253
:210
229,1999[Medline]
- Kido Y, Nakae J, Accili D: The insulin receptor and its cellular targets.
J Clin Endocrinol Metab86
:972
979,2001[Abstract/Free Full Text]
- Jackson JG, Kreisberg JI, Koterba AP, Yee D, Brattain MG: Phosphorylation and nuclear exclusion of the forkhead transcription factor FKHR after epidermal growth factor treatment in human breast cancer cells.
Oncogene19
:4574
4581,2000[Medline]
- Mahmud DL, G-Amlak M, Deb DK, Platanias LC, Uddin S, Wickrema A: Phosphorylation of forkhead transcription factors by erythropoietin and stem cell factor prevents acetylation and their interaction with coactivator p300 in erythroid progenitor cells.
Oncogene21
:1556
1562,2002[Medline]
- Dijkers PF, Medema RH, Pals C, Banerji L, Thomas NS, Lam EW, Burgering BM, Raaijmakers JA, Lammers JW, Koenderman L, Coffer PJ: Forkhead transcription factor FKHR-L1 modulates cytokine-dependent transcriptional regulation of p27 (KIP1).
Mol Cell Biol20
:9138
9148,2000[Abstract/Free Full Text]
- Kops GJPL, Burgering BMT: Forkhead transcription factors: new insights into protein kinase B (c-akt) signaling.
J Mol Med77
:656
665,1999[Medline]
- Tang ED, Nunez G, Barr FG, Guan K-L: Negative regulation of the forkhead transcription factor FKHR by Akt.
J Biol Chem274
:16741
16746,1999[Abstract/Free Full Text]
- Kops GJPL, de Ruiter ND, De Vries-Smits AM, Powell DR, Bos JL, Burgering BMT: Direct control of the Forkhead transcription factor AFX by protein kinase B.
Nature398
:630
634,1999[Medline]
- Biggs III WH, Meisenhelder J, Hunter T, Cavenee WK, Arden KC: Protein kinase B/Akt-mediated phosphorylation promotes nuclear exclusion of the winged helix transcription factor FKHR1.
Proc Natl Acad Sci U S A96
:7421
7426,1999[Abstract/Free Full Text]
- Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, Anderson MJ, Arden KC, Blenis J, Greenberg ME: Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor.
Cell96
:857
868,1999[Medline]
- Schmoll D, Walker KS, Alessi DR, Grempler R, Burchell A, Guo S, Walther R, Unterman TG: Regulation of glucose-6-phosphatase gene expression by protein kinase Balpha and the forkhead transcription factor FKHR: evidence for insulin response unit-dependent and -independent effects of insulin on promoter activity.
J Biol Chem275
:36324
36333,2000[Abstract/Free Full Text]
- Ayala JE, Streeper RS, Desgrosellier JS, Durham SK, Suwannichkul A, Svitek CA, Goldman JK, Barr FG, Powell DR, OBrien RM: Conservation of an insulin response unit between mouse and human glucose-6-phosphatase catalytic subunit gene promoters: transcription factor FKHR binds the insulin response sequence.
Diabetes48
:1885
1889,1999[Abstract]
- Hall, RK Yamasaki T, Kucera T, Waltner-Law M, OBrien R, Granner DK: Regulation of phosphoenolpyruvate carboxykinase and insulin-like growth factor-binding protein-1 gene expression by insulin: the role of winged helix/forkhead proteins.
J Biol Chem275
:30169
30175,2000[Abstract/Free Full Text]
- Barthel A, Schmoll D, Kruger KD, Bahrenberg G, Walther R, Roth RA, Joost HG: Differential regulation of endogenous glucose-6-phosphatase and phosphoenolpyruvate carboxykinase gene expression by the forkhead transcription factor FKHR in H4IIE-hepatoma cells.
Biochem Biophys Res Commun285
:897
902,2000
1
- Nakae J, Kitamura T, Silver DL, Accili D: The forkhead transcription factor Foxo1 (Fkhr) confers insulin sensitivity onto glucose-6-phosphatase expression.
J Clin Invest108
:1359
1367,2001[Medline]
- Brownawell AM, Kops GJPL, Macara IG, Burgering BMT: Inhibition of nuclear import by protein kinase B (Akt) regulates the subcellular distribution and activity of the forkhead transcription factor AFX.
Mol Cell Biol21
:3534
3546,2001[Abstract/Free Full Text]
- Yeagley D, Guo S, Unterman T, Quinn PG: Gene- and activation-specific mechanisms for insulin inhibition of basal and glucocorticoid-induced insulin-like growth factor binding protein-1 and phosphoenolpyruvate carboxykinase transcription: roles of forkhead and insulin response sequences.
J Biol Chem276
:33705
33710,2001[Abstract/Free Full Text]
- Puigserver P, Wu Z, Park CW, Graves R, Wright M, Spiegelman BM: A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis.
Cell92
:829
839,1998[Medline]
- Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, Mootha V, Troy A, Cinti S, Lowell B, Scarpulla RC, Spiegelman BM: Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1.
Cell98
:115
124,1999[Medline]
- Puigserver P, Adelmant G, Wu Z, Fan M, Xu J, OMalley B, Spiegelman BM: Activation of PPARgamma coactivator-1 through transcription factor docking.
Science286
:1368
1371,1999[Abstract/Free Full Text]
- Knutti D, Kralli A: PGC-1, a versatile coactivator.
Trends Endocrinol Metab12
:360
365,2001[Medline]
- Yoon JC, Puigserver P, Chen G, Donovan J, Wu Z, Rhee J, Adelmant G, Stafford J, Kahn CR, Granner DK, Newgard CB, Spiegelman BM: Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1.
Nature413
:131
138,2001[Medline]
- Herzing S, Long F, Jhala US, Hedrick S, Quinn R, Bauer A, Rudolph D, Schutz G, Yoon C, Puigserver P, Spiegelman B, Montminy M: CREB regulates hepatic gluconeogenesis through the coactivator PGC-1.
Nature413
:179
183,2001[Medline]
- Hatta M, Daitoku H, Matsuzaki H, Deyama Y, Yoshimura Y, Suzuki K, Matsumoto A, Fukamizu A: Regulation of alkaline phosphatase promoter activity by forkhead transcription factor FKHR.
Int J Mol Med9
:147
152,2002[Medline]
- van Weeren PC, de Bruyn KMT, Vries-Smits AMM, van Lint J, Burgering BMT: Essential role for protein kinase B (PKB) in insulin-induced glycogen synthase kinase 3 inactivation.
J Biol Chem273
:13150
13156,1998[Abstract/Free Full Text]
- Cross DAE, Alessi DR, Cohen P, Andjelkovich M, Hemmings BA: Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B.
Nature378
:785
789,1995[Medline]
- Hajduch E, Alessi DR, Hemmings BA, Hundal HS: Constitutive activation of protein kinase B alpha by membrane targeting promotes glucose and system A amino acid transport, protein synthesis, and inactivation of glycogen synthase kinase 3 in L6 muscle cells.
Diabetes47
:1006
1013,1998[Abstract]
- Guo S, Rena G, Cichy SB, He X, Cohen P, Unterman T: Phosphorylation of serine 256 by protein kinase B disrupts transactivation by FKHR and mediates effects of insulin on insulin-like growth factor-binding protein-1 promoter activity through a conserved insulin response sequence.
J Biol Chem274
:17184
17192,1999[Abstract/Free Full Text]
- Nakae J, Park BC, Accili D: Insulin stimulates phosphorylation of the forkhead transcription factor FKHR on serine 253 through a Wortmannin-sensitive pathway.
J Biol Chem274
:15982
15985,1999[Abstract/Free Full Text]
- Rena G, Guo S, Cichy SC, Unterman, TG Cohen P: Phosphorylation of the transcription factor forkhead family member FKHR by protein kinase B.
J Biol Chem274
:17179
17183,1999[Abstract/Free Full Text]
- Cook SA, Matsui T, Li L, Rosenzweig A: Transcriptional effects of chronic Akt activation in the heart.
J Biol Chem277
:22528
22533,2002[Abstract/Free Full Text]
- Nakajima T, Fukamizu A, Takahashi J, Gage FH, Fisher T, Blenis J, Montminy MR: The signal-dependent coactivator CBP is a nuclear target for pp90RSK.
Cell86
:465
474,1996[Medline]
- Cho H, Mu J, Kim JK, Thorvaldsen JL, Chu Q, Crenshaw III EB, Kaestner KH, Bartolomei MS, Shulman GI, Birnbaum MJ: Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKBß).
Science292
:1728
1731,2001[Abstract/Free Full Text]
- Michael MD, Kulkarni RN, Postic C, Previs SF, Shulman GI, Magnuson MA, Kahn CR: Loss of insulin signaling in hepatocytes leads to severe insulin resistance and progressive hepatic dysfunction.
Mol Cell6
:87
97,2001
- Saltiel AR: New perspectives into the molecular pathogenesis and treatment of type 2 diabetes.
Cell104
:517
529,2001[Medline]

CiteULike Del.icio.us Digg Reddit Technorati What's this?
|
|
|