Diabetes 52:1888-1896, 2003
© 2003 by the American Diabetes Association, Inc.
Impact of Aerobic Exercise Training on Age-Related Changes in Insulin Sensitivity and Muscle Oxidative Capacity
Kevin R. Short1,
Janet L. Vittone2,
Maureen L. Bigelow1,
David N. Proctor3,
Robert A. Rizza1,
Jill M. Coenen-Schimke1, and
K. Sreekumaran Nair1
1 Department of Internal Medicine, Division of Endocrinology, Mayo Clinic, Rochester, Minnesota
2 Department of General Internal Medicine, Mayo Clinic, Rochester, Minnesota
3 Department of Anesthesiology, Mayo Clinic, Rochester, Minnesota
 |
ABSTRACT
|
|---|
Insulin resistance increases and muscle oxidative capacity decreases during aging, but lifestyle changesespecially physical activitymay reverse these trends. Here we report the effect of a 16-week aerobic exercise program (n = 65) or control activity (n = 37) performed by men and women aged 2187 years on insulin sensitivity and muscle mitochondria. Insulin sensitivity, measured by intravenous glucose tolerance test, decreased with age (r = -0.32) and was related to abdominal fat content (r = -0.65). Exercise increased peak oxygen uptake (VO2peak; 10%), activity of muscle mitochondrial enzymes (citrate synthase and cytochrome c oxidase, 4576%) and mRNA levels of mitochondrial genes (COX4, ND4, both 66%) and genes involved in mitochondrial biogenesis (PGC-1 , 55%; NRF-1, 15%; TFAM, 85%). Exercise also increased muscle GLUT4 mRNA and protein (3052%) and reduced abdominal fat (5%) and plasma triglycerides (25%). None of these changes were affected by age. In contrast, insulin sensitivity improved in younger people but not in middle-aged or older groups. Thus, the muscle mitochondrial response to 4 months of aerobic exercise training was similar in all age-groups, although the older people did not have an improvement in insulin sensitivity.
The number of people with type 2 diabetes and impaired glucose tolerance is rapidly increasing (1,2). Key factors contributing to this increase in diabetes include age, obesity, and sedentary lifestyle (38). Exercise is a readily available intervention that can increase insulin action (914) and prevent the onset of diabetes (1518). An important question is whether the effects of aerobic exercise on insulin action are diminished with advancing age. A recent study reported that a vigorous 7-day exercise program increased insulin sensitivity and muscle glucose transporter (GLUT4) content by a similar amount in younger (22 years) and older (61 years) people (12). However, current health and fitness guidelines for healthy adults recommend exercising at more moderate intensities at least 3 days per week over long periods (19). Thus, the first purpose of the current study was to determine whether a 4-month program of bicycle training that could be readily followed by most elderly individuals would lead to a similar improvement in insulin sensitivity in men and women across a wide age span.
Skeletal muscle is the major site of insulin-mediated glucose disposal and is implicated in the pathogenesis of insulin resistance and diabetes (20,21). Several pieces of evidence suggest that insulin action may be related to the oxidative capacity of skeletal muscle. First, aerobic exercise training improves both insulin sensitivity and activity of oxidative enzymes in muscle (22,23). Second, people who are obese and insulin resistant or have type 2 diabetes tend to have lower activity of muscle oxidative enzymes (24,25). Third, insulin infusion preferentially stimulates the synthesis rate of mitochondrial proteins in skeletal muscle (26) and increases the mRNA abundance genes associated with mitochondria and glucose metabolism (27,28). Fourth, recent work has shown that genes for mitochondrial proteins and the primary glucose transporter in muscle, GLUT4, are regulated by common signals, including elevations in cytosolic calcium (29,30) and the transcriptional coactivator PGC-1 (peroxisome proliferator-activated receptor [PPAR]- coactivator 1 ) (31). Muscle mitochondrial function and gene expression are reduced in aging muscle, but the underlying cause and the relationship to insulin action are not yet understood (3234). The second purpose of this study, therefore, was to measure the effect of age and exercise training on the gene expression of PGC-1 , GLUT4, and mitochondrial genes and nuclear transcription factors that regulate mitochondrial genes, including PGC-1 , nuclear respiratory factor (NRF)-1, and mitochondrial transcription factor A (TFAM). We tested the hypothesis that a moderate exercise program results in equivalent improvements in insulin sensitivity, GLUT4 expression, and mitochondrial genes and function in individuals whose age ranged between 22 and 87 years.
 |
RESEARCH DESIGN AND METHODS
|
|---|
Participants.
Healthy men and women who exercised <30 min twice per week during the previous 9 months were recruited. Health status was assessed by medical history, physical exam, blood chemistries (liver enzymes, creatinine, electrolytes, and glucose), complete blood count, urinalysis, and electrocardiogram. Exclusion criteria included tobacco use, ß-blockers, diabetes or other endocrine disorders, and debilitating chronic illness. Forty-nine women and 41 men between the ages of 21 and 87 years met these criteria and were enrolled after providing written and oral consent. Characteristics of the participants are shown in Table 1. Participants gave their informed oral and written consent before any tests were performed. The Mayo Foundation Institutional Review Board approved the study.
Study protocol.
Participants were randomized to either a 16-week aerobic control or exercise program. A similar 5-day protocol was completed at baseline and again within a week of completing the training or control phases. During each study period, a weight-maintaining diet (55:30:15% carbohydrate, fat, and protein, respectively) was provided for the first 4 days. On the morning of day 4, subjects were admitted to the General Clinical Research Center (GCRC) following an overnight fast. Insulin sensitivity and body composition were then measured. The following morning (day 5) blood and muscle biopsy samples from the vastus lateralis (32,35) were obtained.
The exercise program was performed on a stationary bicycle. Training started with three sessions per week, lasting 20 min each, at an intensity eliciting 70% of maximal heart rate. Intensity, duration, and number of sessions were gradually increased so that the final month of training consisted of four sessions per week at 80% of maximal heart rate for 40 min. Exercise specialists supervised each session and recorded heart rates. Compliance with the target workloads and number of sessions was >90%. The exercise protocol was completed by 41 of 47 participants originally assigned. The control group was taught a series of flexibility exercises and encouraged to perform them at home while maintaining their regular lifestyle. Follow-up tests were available for 37 of the 43 people in the control group. Subsequently, 24 control group members opted to complete the exercise program, yielding a total of 65 people studied before and after exercise training.
Because the goal of the study was to examine effects of the exercise program, participants were instructed to maintain body weight. Weight was recorded weekly, and the GCRC dietary staff provided further guidance if weight changed >2%. Only one person in the exercise group discontinued the study because of excessive weight loss.
Procedures.
A standard treadmill stress test was performed initially to assure cardiovascular health and was followed on another day with measurement of peak oxygen uptake (VO2peak) on a bicycle ergometer (36). Expired gases, heart rate, and blood pressure were continuously monitored throughout the tests (36). The posttraining assessment was made within 3 days of the completion of the last training bout.
Insulin sensitivity (SI) was determined using an intravenous glucose tolerance test (37). Posttraining tests were performed 4 or 5 days after the last exercise session (this variation was unavoidable due to scheduling availability). There were no systematic differences across sex or age in the retesting schedule. Glucose (0.3 g/kg) and insulin (0.03 units/kg) were intravenously injected at 0 and 20 min, respectively. Fifteen blood samples were obtained between 0 and 180 min. SI was calculated using minimal model analysis software (MINMOD, version 2.0).
Fat and fat-free mass were determined by dual X-ray absorptiometry (Lunar DPX-L, Madison, WI). Abdominal fat was measured using a single-slice (6-mm thickness) computed tomography scan (Imatron C-150, San Francisco, CA) at the level of the L4L5 intervertebral space. Total and subcutaneous abdominal fat areas were estimated by manual planimetry using custom software (38). Visceral fat area was calculated as the difference between total and subcutaneous fat areas.
Plasma insulin was measured with a two-site immunoenzymatic assay (Access; Beckman Instruments, Chaska, MN). Glucose was measured with a Beckman Glucose Analyzer (Beckman Instruments, Porterville, CA). Nonesterified free fatty acids (NEFAs) were measured using an enzymatic colorimetric assay (NEFA C; Wako Chemicals, Richmond, VA).
A real-time quantitative PCR system (PE Biosystems, Foster City, CA) was used to measure the abundance of selected mRNAs in muscle tissue (35). Transcripts quantified included GLUT4, NRF-1, PGC-1 , TFAM, and two subunits of mitochondrial respiratory chain proteins. The mitochondrial mRNAs were cytochrome c oxidase subunit 4 (COX4), a nuclear gene encoding part of complex IV, and NADH-dehydrogenase subunit 4 (ND4), a mitochondrial-DNA gene encoding part of complex I. RNA was extracted from skeletal muscle of individual subjects by Trizol method (Life Technologies, Gaithersburg, MD), treated with DNase (Life Technologies), and then reverse-transcribed using the TaqMan Reverse Transcription Reagents (PE Biosystems).
The following primers and probes for human genes were used: GLUT4 (designed from GenBank Accession number M20747 sequence) forward primer: CATTGGTATCATCTCT CAGTGGCT, reverse primer: AGCACCGCCAGGACATTG, probe: ACCAGCATGGCCCT TTTCCTTC; NRF-1 (GenBank accession no. XM011548) forward primer: GAGTGATG TCCGCACAGAAGAG, reverse primer: TTATAACAGTTTTTAACTATGGTCCGTAGTG, probe: TGGGTCCATGAAACCCTCTGCTT; PGC-1 (GenBank accession no. AF106698) forward primer: AGATCGCCCTACAGCCGTC, reverse primer: TCTTCAGCCTCTCGTGCTGA, probe: ATTCCTCGTAGCTGTCATACCTGGGC; TFAM (GenBank accession no. M62810) forward primer: TGTGCACCGGCTGTGG, reverse primer: TGGACAACTTGCCAAGACAGAT, probe: AGTCGACTGCGCTCCCCCTT; COX4 (GenBank accession no. XM008055) forward primer: CCTCCTGGAGCAGCCTCTC, reverse primer: TCAGCAAAGCTCTCCTTGA ACTT, probe: TGCGATACAACTCGACTTTCTCATCCAT; ND4 (GenBank accession no. NC 001807) forward primer: CCCCATTCTCCTCCTATCCC, reverse primer: TTTTTTTTTTTT-TTTTTTTTTTTTTTAAGAG, probe: CAACCCCGACATCATTACCGGGT. The probes for nuclear genes were designed to span exon boundaries to ensure no amplification of contaminating DNA. Because the mitochondrial genome does not contain introns, the reverse primer for ND4 was designed to target several of the final nucleotides specific to the gene as well as a string of the poly-A tail that is present only in the mRNA. Samples were run in triplicate and quantified by normalizing the target signal for the 28S rRNA signal in each sample.
Activities of two mitochondrial enzymes, citrate synthase and cytochrome c oxidase, were measured in muscle homogenates as previously described (32).
Abundance of GLUT4 protein in muscle was determined by Western blotting. Muscle samples were homogenized in a buffer containing 250 mmol/l sucrose, 20 mmol/l HEPES, and 1 mmol/l EDTA, pH 7.4, containing 1 µg/ml leupeptin, 10 µg/ml aprotinin, and 2 mmol/l phenylmethylsulfonyl fluoride, then centrifuged at 100,000g for 60 min. Pellets were resuspended in phosphate buffer containing 1% Triton X-100 and centrifuged at 14,000g for 20 min. The resulting supernatants, containing membrane proteins, were separated on 10% polyacrylamide gels (BioRad Laboratories, Hercules, CA). Proteins were transferred to polyvinylidene difluoride membranes and incubated overnight with a primary antibody against GLUT4 (Biogenesis, Brentwood, NH). An enhanced chemiluminescent detection system (Amersham Biosciences, Piscataway, NJ), followed by digital imaging and densitometry (ImageStation 1000; Eastman Kodak Scientific Imaging, Rochester, NY), was used to quantify the relative abundance of GLUT4 in individual samples.
Statistical analysis.
Data are reported as means ± SE. Differences between men and women and between pre- and posttesting within groups were analyzed using unpaired and paired t tests, respectively. Pearson correlation coefficients were used to measure association among selected variables. Multiple regression analysis was used to determine the relationship of age, body composition, and other variables to insulin sensitivity. P < 0.05 was considered statistically significant.
 |
RESULTS
|
|---|
Physical characteristics and body composition.
The baseline physical characteristics of the participants are given in Table 1, and univariate correlations between these variables and age are listed in Table 2. Although BMI was similar among age-groups, fat-free mass decreased with age and total body fat and abdominal fat increased with age. Subcutaneous abdominal fat also tended to increase with age, but this change was more variable. Exercise resulted in statistically significant reductions in body weight (0.7%), BMI (0.7%), abdominal fat (5.3%), and waist circumference (1.9%) (Table 3). The loss of abdominal fat occurred equally in the visceral and subcutaneous compartments. Except for a small but significant increase in waist size (Table 3), the physical characteristics of the control group did not change during the study.
View this table:
[in this window]
[in a new window]
|
TABLE 3 Aerobic capacity, body composition, blood variables, and insulin sensitivity before and after control or exercise training periods
|
|
Aerobic capacity.
At baseline, VO2peak declined linearly with age from a mean of 50.0 ± 1.0 ml · kg-1 FFM · min-1 in 20- to 30-year-olds to 19.7 ± 1.1 in those 70 years (r = 0.82, P < 0.001). The rate of decline was 7.5% per decade. There was no change in VO2peak in control subjects (Table 3), whereas the exercise program increased VO2peak by 9.5% (P < 0.001). This response to exercise training was similar in men and women of all ages.
Insulin sensitivity.
SI declined 8% per decade in both men and women (P < 0.01). When plotted against age, however, the residual errors for SI were not uniform for either men or women. For this reason, linear modeling of SI was performed after log transformation. The transformed SI was 16% higher in women (P < 0.05) but did not prevent the pooled data from both sexes from being fit by a single line, since the difference was not affected by age (Fig. 1). Univariate correlations between SI (after log transformation) and other variables are listed in Table 2. SI was more closely related to abdominal fat and fasting insulin levels than age (Fig. 1). Like SI, insulin values were also log transformed because of nonuniform distribution.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 1. Relationship between SI and age, adiposity, and insulin levels. The variance in SI and insulin was not evenly distributed, so data are shown after log transformation. SI declined with age (A) but was more closely related to total abdominal fat (B), visceral fat (C), and fasting insulin (D) levels. Regression lines are shown for pooled data from men ( ) and women (), except in C, where the solid line is for women and the dotted line is for men. P < 0.01 for all correlation coefficients shown.
|
|
Multiple regression analyses were used to determine the effects of age, adiposity, and other parameters on SI at baseline. Men and women were analyzed separately. Using step-wise (step-up) regression, only two variables with significant individual contributions were entered into the model for men, namely total abdominal fat area and triglycerides. This model had a multiple R2 of 0.57 and an adjusted R2 of 0.54. When a step-down approach was used for men, total abdominal fat and insulin were retained in the model (multiple R2 = 0.55, adjusted R2 = 0.51). In women, both the step-up and step-down models had a single variable, total abdominal fat area, with a multiple R2 of 0.39 and adjusted R2 of 0.37. Combining men and women in the regression analysis yielded a model with total abdominal fat and insulin as predictors (multiple R2 = 0.48, adjusted R2 = 0.47). Age made a significant contribution to these models only if total abdominal fat and/or insulin were intentionally left out (data not shown).
Exercise training increased insulin sensitivity by an average of 26% (Table 3). However, the response to training (absolute change) was inversely related to age in men and women (Fig. 2). When separated into younger (20-39 years), middle-aged (4059 years), and older ( 60 years) groups, the posttraining SI increased 72% for younger (5.77 ± 0.73 vs. 9.92 ± 1.36; P < 0.001) and 20% for middle-aged (5.42 ± 0.68 vs. 6.52 ± 0.82; P = 0.11) and decreased 5% for older (3.90 ± 0.44 vs. 3.71 ± 0.53; P = 0.42) people. The response of SI to training was not related to changes in VO2peak, body composition, muscle metabolic parameters, or any other variables, besides age. When the SI values in the exercise group were expressed as a percentage change from baseline, the negative relationship with age remained statistically significant in women but not in men (Fig. 2). This difference between men and women was due to the strong influence of three men over 40 years of age who began the study with low SI values and had small absolute changes that represented high percentage changes. When considered separately, the percentage change in SI in exercising young men (41 ± 19% for n = 6; P = 0.08 vs. zero) was less than that of young women (116 ± 27% for n = 9; P < 0.01 vs. zero) but stands in contrast to the middle-aged and older groups who showed no trends toward a positive change in SI. Thus, the age-dependent increase in SI after training appears to be present in men and women when considered as either absolute or percentage change.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 2. Relationship between age and the post-exercise change in SI. The absolute increment in SI in exercisers was inversely related to age (top panel, regression line for entire group). The relationship was significant (P < 0.01) for both women (r = 0.53) and men (r = 0.34) when considered separately. The percent change in SI (lower panel, regression line for entire group) was also inversely related to age, but when considered separately, the effect was significant in women (r = 0.61, P < 0.01) but not in men (r = 0.16, P > 0.05). SI units in the top panel are x10-5 · min-1 · pmol-1 · l-1.
|
|
GLUT4.
GLUT4 mRNA levels did not differ with age among the participants (Fig. 3). After the exercise training program, GLUT4 mRNA levels were elevated by 52% (Table 3), and no effect of either age or sex on the response to exercise was evident. GLUT4 protein levels were measured on a subset of younger (n = 9) and older (n = 11) persons because of limited availability of muscle samples. GLUT4 protein abundance (in arbitrary units) was not significantly different between the younger (5.71 ± 0.41 AU) and older (4.67 ± 0.49 AU) group at baseline. In younger and older exercisers, protein levels were increased 2040% to 6.83 ± 0.72 and 6.64 ± 0.62 AU, respectively (P < 0.02), with no difference between age groups.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 3. Effect of age on abundance of mRNA for selected genes in skeletal muscle. Measurements were performed on 78 people during the baseline phase of the study. Regression lines are given for COX4 and ND4, which declined significantly with age. The other genes shown did not change with age. Values are given in arbitrary units (AU) after normalization to 28S rRNA.
|
|
Mitochondrial enzyme activities and gene transcripts.
At baseline, activity of COX declined with age (5% per decade) (Table 2). Citrate synthase activity declined with age in women (4% per decade) (Table 2) but not in men. The exercise program increased COX and citrate synthase activities by 87 and 46%, respectively (Table 3). Enzyme changes with training were not related to either age or sex.
Transcript levels of COX4 and ND4 followed similar patterns to one another, as they both declined significantly with age (Fig. 3) and increased 6567% with aerobic exercise training (Table 4). These responses to training were not affected by either age or sex. The abundance of mRNAs encoding PCG-1 , NRF-1, and TFAM was unrelated to age at baseline (Fig. 4). Exercise training increased PGC-1 , NRF-1, and TFAM transcript levels by 55, 15, and 85%, respectively, but there was no interaction between age and the training response (Table 4). PGC-1 mRNA levels at baseline were positively associated (P < 0.01) with abundance of NRF-1 (r = 0.67), TFAM (r = 0.53), GLUT4 (r = 0.46), and COX4 (r = 0.40) mRNA. The change in PGC-1 mRNA after training was associated with the change in NRF-1 (r = 0.40, P < 0.01), but not with the changes in TFAM, GLUT4, or COX4.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 4. Effect of the aerobic training program on mRNA abundance of selected genes in skeletal muscle. Exercise caused an increase in the level of each of these mRNAs (averages given in Table 4). This figure demonstrates that the responses to training did not differ with age or sex. Values are given as the absolute difference between the pre- and posttraining measurements, in arbitrary units (AU) after normalization to 28S rRNA.
|
|
Plasma lipids, glucose, and insulin.
Total cholesterol increased from 4.24 ± 0.18 mmol/l in 20- to 30-year-olds to 5.54 ± 0.27 in people over 70 years (P < 0.025), whereas HDL and LDL cholesterol levels did not change with age (Table 2). Cholesterol levels were not significantly altered by exercise training (Table 3). Triglyceride (134 ± 15 mg/dl, 2030 years; 160 ± 15, 70 years) and nonesterified fatty acid (485 ± 34 µmol/l, 2030 years; 587 ± 27, 70 years) levels both increased with age (Table 2). Exercise training lowered fasting plasma triglycerides 23% and nonesterified fatty acids 6% (Table 3). Age and sex did not affect these responses.
Fasting glucose levels increased 2% per decade in men and women, whereas insulin increased 13% per decade in women but did not change with age in men (Table 2). Fasting glucose and insulin were positively related (P < 0.01) to abdominal fat (r = 0.56 and 0.65, respectively). Men had higher (P < 0.01) plasma glucose (5%) and insulin (16%) than women. Overall, exercise training did not alter fasting glucose or insulin concentrations (Table 3). When separated into three age-groups, however, fasting insulin levels were significantly reduced from pre- to postexercise in middle-aged people (age 4059 years, 36 ± 3 vs. 31 ± 3 pmol/l; P = 0.020) and showed a tendency to decline in older people ( 60 years, 44 ± 5 vs. 35 ± 3 pmol/l; P = 0.098). Fasting insulin did not change in younger exercisers (2039 years old, 32 ± 5 vs. 37 ± 7 pmol/l; P = 0.40). Fasting glucose levels were unchanged in any age-group.
 |
DISCUSSION
|
|---|
This study examined the effect of a 4-month moderate-intensity aerobic exercise program on insulin sensitivity and muscle mitochondrial biogenesis in people between the ages of 22 and 87 years. In agreement with previous reports, insulin sensitivity declined with age (58) but improved with exercise training (914). A key finding of the current study is that the increment in insulin sensitivity due to exercise training was present in younger people but not in middle-age and older groups. Several potential factors that might explain the age-dependent change in insulin action with exercise were examined. Abdominal adiposity (which was the best correlate with insulin sensitivity at baseline) and plasma triglycerides were decreased by exercise. In skeletal muscle, glucose transporter mRNA and protein levels were increased, and mitochondrial biogenesis was evident from increased activity of mitochondrial enzymes and higher levels of mitochondrial protein mRNAs. These changes occurred in men and women across the age span. Thus, insulin sensitivity was the only variable that demonstrated an age-dependent response to exercise training.
Insulin-mediated glucose transport in muscle depends on the content and function of GLUT4 (21). Work by Houmard et al. (6) suggested that the age-related decline in insulin action might be due in part to a lower abundance of GLUT4 protein in muscle. Subsequently, it was reported that short-term vigorous training elevated GLUT4 protein content and insulin sensitivity in young and old people (12). In the current study, we found that muscle GLUT4 mRNA and protein levels did not change with age in previously untrained people. Exercise training resulted in increased muscle content of GLUT4 mRNA and protein, but this increment did not differ with age. Thus, in the present study, muscle GLUT4 abundance does not explain the age-related decline in insulin sensitivity or the age-dependent response to exercise training. One possibility is that despite normal GLUT4 content in older muscle, the insulin-mediated trafficking of GLUT4 to the sarcolemma or its inherent function is somehow impaired (20,21). At present, the interaction of age and exercise status on GLUT4 trafficking and transport function is unknown. This is an important question that should be addressed in future work.
The activity of oxidative enzymes is reduced in skeletal muscle from older people (32,34,39) and can contribute to reductions in VO2peak and the ability to sustain muscular activity. In turn, this could potentially contribute to insulin resistance by limiting the ability to metabolize glucose. There is evidence that people with type 2 diabetes or insulin resistance have lower activity of oxidative enzymes and reduced aerobic capacity (24,25,40). In the present study, VO2peak and activity of mitochondrial enzymes were positively related to SI at baseline. Despite this relationship, muscle mitochondrial variables did not contribute significantly to the multivariate model for SI after the inclusion of abdominal fat. We found that aerobic exercise training increased the glucose transport capacity (higher GLUT4) and mitochondrial content of skeletal muscle as previously reported (22,23). However, these changes were not related to the change in SI. These findings suggest that insulin action and mitochondrial biogenesis may respond to common regulatory events, such as exercise, but that the two pathways are not directly related.
We have considered other factors that may explain the age-dependent exercise response in insulin sensitivity. First, compared to the current study, training programs that improved insulin sensitivity in older people typically had more intense or frequent sessions (12,13) or were longer (612 months) (9,11,13). In one study, 63-year-old people engaged in low-intensity exercise (e.g., walking) showed no change in insulin action after 6 months, but improved after an additional 6 months of more intensive exercise (9). Thus, older people may require more intensive or longer exercise training programs to improve SI, whereas other factors, such as mitochondrial function, are more readily altered. A second possibility is that the effect of exercise on SI response is more rapidly lost in older people. Timing of the posttraining measurements of SI could be important. In most studies, SI was measured 1417 h after the last exercise session (9,11,12), whereas we waited 96120 h to examine chronic training adaptations instead of acute exercise effects. Although there was some variation in the timing of our follow-up tests ( 24 h), there was no systematic difference in the time interval across age or sex, nor was there an effect on the magnitude in SI improvement. In well-trained athletes, SI declines within 614 days if regular exercise is not maintained (14,41,42). Future work will need to examine how SI changes in the first 7 days after completing a training program with comparisons made between younger and older people. A third explanation is that inherent aging processes may blunt the adaptability of SI even if regular vigorous exercise is performed. It was recently shown that SI is lower in both older sedentary and endurance-trained people versus younger people with similar respective exercise status (43). Further, as we and others have found (7,8,44), the age effect on SI disappeared in sedentary subjects after controlling for body fatness (43). In contrast, after controlling for body fat, SI was still 33% lower in older athletes (43). Insulin sensitivity in the older runners was equal to or greater than that in sedentary groups, indicating a clear benefit of maintaining a long-term vigorous exercise training program (43). Nevertheless, the lower SI in older versus younger runners suggests that the capacity to improve insulin action with exercise may be somehow limited in older people.
Exercise training resulted in an average reduction in body weight of 0.6 kg, which appears to have come mainly from abdominal fat stores. This reduction was similar in visceral and subcutaneous abdominal fat depots and did not vary with age. Thus, despite the close correlation between abdominal fat and SI at baseline, the magnitude of the improvement in SI after exercise training was not related to the amount of fat lost. In overweight men, exercise training and weight loss are attributed with distinct effects on glucose metabolism that are additive when combined (45). We encouraged participants to maintain their diet and body weight in this study, so it is possible that a weight-loss component would have resulted in greater gains in insulin sensitivity in the exercise group (45,46).
Fasting insulin and glucose showed little or no change with exercise training and were therefore unrelated to changes in SI. Exercise-induced improvements in SI in the absence of a change in fasting insulin or glucose have been noted before (12,47). When reductions in fasting insulin occur in response to exercise training, a common cofactor is weight loss, specifically fat loss (9,11,13,45). Fasting insulin levels are positively associated with body fat (r = 0.65 in the present study at baseline). The exercise group had a 5% reduction in abdominal fat, but a larger decrease may be required to substantially affect fasting insulin levels.
At baseline we found that SI decreased with age, consistent with other reports (58). This decline appears to result from an increase in abdominal fat rather than age per se. Earlier reports found a relationship between SI and anthropometric measures like waist circumference or BMI (7,8,44). In the current study, SI was more closely related to visceral than subcutaneous fat, but SI was most closely related to total abdominal fat area, in agreement with the findings of Goodpaster et al. (48). A consensus has not been reached on whether visceral or subcutaneous fat regions are more important for conferring insulin resistance (4850).
The decline with age in activity of mitochondrial enzymes indicates that muscle oxidative capacity is reduced (32,34,39). Previous work suggested that mitochondrial functional decline might be related to lower synthesis rate of mitochondrial proteins (32). The current results now indicate that protein synthesis in older muscle may be limited by template availability, since mRNA levels for both nuclear-encoded (COX4) and mitochondrial-encoded (ND4) respiratory chain proteins decreased with age. We tested whether these changes were related to parallel reductions in transcription factors that regulate mitochondrial genes upstream. PGC-1 has generated interest because it acts with transcription factors like NRF-1 to control expression of genes of oxidative metabolism, including TFAM (51,52). TFAM is the signal through which the nucleus regulates mitochondrial DNA transcription and replication (53). The mRNA level of PGC-1 was positively associated at baseline with that of GLUT4, NRF-1, and TFAM, supporting the evidence that PGC-1 is a key regulator of energy-utilizing pathways. However, PGC-1 , NRF-1, and TFAM transcript abundance did not change with age. This implies that the reduction in COX4 and ND4 mRNA with age must be regulated at other control points such as mRNA stability or transcription factor activity, or perhaps by other transcription factors. Oxidative damage to DNA has been shown to increase with age (54) and could limit the expression of specific mitochondrial genes in the presence of normal levels of transcription factors. We are aware of only one other study that has examined age effects on mitochondrial-related transcription factors in human muscle (55). In contrast to our findings, mRNA levels of TFAM and NRF-1 were reported to be higher in a group of elderly (7188 years) than in younger (2133 years) people (55). However, the muscle samples in that study were obtained from only four to seven people per group who were undergoing orthopedic surgery. The clinical state, anesthesia, or any treatments could modulate the mRNA level of these transcription factors, and the data may not be applicable to healthy populations.
The exercise training program resulted in an enhancement of mitochondrial biogenesis, as shown by several markers. There were no interactions between age and the training response of the mitochondrial measurements. Improvements in VO2peak and oxidative enzymes in response to aerobic exercise have been previously shown in older people (56,57). Earlier studies also showed that vigorous training results in higher muscle mRNA content of TFAM and other mitochondrial genes in young men (58,59). The present study is the first to show that aerobic training stimulates expression of mitochondrial genes and transcription factors in muscle from older and younger people. The potency of the training effect on muscle oxidative pathways is shown by the fact that all of the changes in muscle that were measured were clearly evident 56 days after the last training session. Collectively, these findings demonstrate that despite age-related functional decline, skeletal muscle capacity for mitochondrial biogenesis remains high in older muscle when faced with the metabolic demands of regular exercise. Exercise-induced increases in muscle oxidative enzymes are consistent with higher ATP production capacity (56) and may lead to greater ability to utilize glucose. However, the present data demonstrate that changes in muscle mitochondrial function and insulin-mediated glucose disposal are not closely related.
In conclusion, 4 months of moderate-intensity aerobic exercise performed by previously sedentary men and women improved insulin sensitivity in young people but not in middle-aged and older groups. This unique finding could not be explained by loss of body fat or increased expression of glucose transporter protein in skeletal muscle, since exercise training had an equivalent effect on these parameters in people of all ages. Muscle mitochondrial enzyme activity declined with age and improved with exercise training regardless of age. The exercise-induced increase in muscle oxidative capacity was closely related to the availability of the mRNA abundance of mitochondrial proteins. These findings suggest that the ability of aerobic exercise to enhance muscle mitochondrial function is not age-limited, whereas improvement in insulin sensitivity is impaired in older people. This observation will need to be considered in the design of exercise programs aimed at preventing or delaying diabetes in older people.
 |
ACKNOWLEDGMENTS
|
|---|
Funding was provided by Public Health Service Award RO1AG09531, Mayo Foundation, and the Dole-Murdock Professorship (K.S.N.), National Research Service Award T32-DK07352 and the Mayo-Thompson Fellowship (K.R.S.), and GCRC Grant MO1-RR00585.
The authors are grateful for the valuable technical support provided by Jane Kahl; Dawn Morse; Rebecca Kurup; Karen Townsend; the GCRC nurses, dieticians, and support staff; and the staff of the Healthy Living Center. We also thank the volunteers who completed the protocol.
Address correspondence and reprint requests to K. Sreekumaran Nair, PhD, Endocrinology Research Unit, 5194 Joseph, Mayo Clinic, 200 First St. SW, Rochester, MN 55905. E-mail: nair.sree{at}mayo.edu
Received for publication October 31, 2002
Revision received May 1, 2003.
and accepted in revised form May 1, 2003
Abbreviations:
GCRC, General Clinical Research Center; NRF, nuclear respiratory factor; PGC-1 , PPAR- coactivator 1 ; PPAR, peroxisome proliferatoractivated receptor; TFAM, mitochondrial transcription factor A; VO2peak, peak oxygen uptake; SI, insulin sensitivity
 |
REFERENCES
|
|---|
- Mokdad AH, Ford ES, Bowman BA, Dietz WH, Vinicor F, Bales VS, Marks JS: Prevalence of obesity, diabetes, and obesity-related health risk factors, 2001.
JAMA289
:76
79,2002
- Ford ES, Giles WH, Dietz WH: Prevalence of the metabolic syndrome among US adults: findings from the Third National Health and Nutrition Examination Survey.
JAMA287
:356
359,2002[Abstract/Free Full Text]
- Crespo CJ, Keteylan SJ, Heath GW, Sempos CT: Leisure-time physical activity among US adults.
Arch Intern Med156
:93
98,1996[Abstract]
- Mokdad AH, Bowman BA, Ford ES, Vinicor F, Marks JS, Koplan JP: The continuing epidemics of obesity and diabetes in the United States.
JAMA286
:1195
1200,2001[Abstract/Free Full Text]
- Shimokata H, Muller DC, Fleg JL, Sorkin J, Ziemba AW, Andres R: Age as independent determinant of glucose tolerance.
Diabetes40
:44
51,1991[Abstract]
- Houmard JA, Weidner MD, Dolan PL, Leggett-Frazier N, Gavigan KE, Hickey MS, Tyndall GL, Zheng D, Alshami A, Dohm GL: Skeletal muscle GLUT4 protein concentration and aging in humans.
Diabetes44
:555
560,1995[Abstract]
- Khort WM, Kirwin JP, Staten MA, Bourey RE, King DS, Holloszy JO: Insulin resistance in aging is related to abdominal obesity.
Diabetes42
:273
281,1993[Abstract]
- Coon PJ, Rogus EM, Drinkwater D, Muller DC, Goldberg AP: Role of body fat distribution in the decline in insulin sensitivity and glucose tolerance with age.
J Clin Endocrinol Metab75
:1125
1132,1992[Abstract]
- Seals DR, Hagberg JM, Hurley BF, Ehsani AA, Holloszy JO: Effects of endurance training on glucose tolerance and plasma lipid levels in older men and women.
JAMA252
:645
649,1984[Abstract]
- Hughes VA, Fiatrone MA, Fielding RA, Kahn BB, Ferrara CM, Shepherd P, Fisher EC, Wolfe RR, Elahi D, Evans WJ: Exercise increases muscle GLUT-4 levels and insulin action in subjects with impaired glucose tolerance.
Am J Physiol264
:E855
E862,1993
- Kirwin JP, Khort WM, Wojta DM, Bourey RE, Holloszy JO: Endurance exercise training reduces glucose-stimulated insulin levels in 60- to 70-year old men and women.
J Gerontol48
:M84
M90,1993[Medline]
- Cox JH, Cortright RN, Dohm GL, Houmard JA: Effect of aging on response to exercise training in humans: skeletal muscle GLUT-4 and insulin sensitivity.
J Appl Physiol86
:2019
2025,1999[Abstract/Free Full Text]
- Kahn SE, Larson VG, Beard JC, Cain KC, Fellingham GW, Schwartz RS, Veith RC, Stratton JR, Cerqueira MD, Abrass IB: Effect of exercise on insulin action, glucose tolerance, and insulin secretion in aging.
Am J Physiol258
:E937
E943,1990
- Houmard JA, Tyndall GL, Midyette JB, Hickey MS, Dolan PL, Gavigan KE, Weidner MD, Dohm GL: Effect of reduced training and training cessation on insulin action and muscle GLUT4.
J Appl Physiol81
:1162
1168,1996[Abstract/Free Full Text]
- Tuomilehto J, Lindstrom J, Eriksson JG, Valle TT, Hamalainen H, Ilanne-Parikka P, Keinanen-Kiukaanniemi S, Laakso M, Louheranta A, Rastas M, Salminen V, Uusitupa M: Prevention of type 2 diabetes mellitus by changes in lifestyle among subjects with impaired glucose tolerance.
N Engl J Med344
:1343
1350,2001[Abstract/Free Full Text]
- Hu FB, Manson JE, Meir JS, Colditz G, Liu S, Solomon CG, Willet WC: Diet, lifestyle, and the risk of type 2 diabetes mellitus in women.
N Engl J Med345
:790
797,2001[Abstract/Free Full Text]
- Eriksson KF, Lindgarde F: Prevention of type 2 (non-insulin-dependent) diabetes mellitus by diet and physical exercise: the 6-year Malmo feasibility study.
Diabetologia34
:891
898,1991[Medline]
- Diabetes Prevention Program Research Group: Reduction in the incidence of type 2 diabetes with lifestyle intervention or metformin.
N Engl J Med346
:393
403,2002[Abstract/Free Full Text]
- American College of Sports Medicine: The recommended quantity and quality of exercise for developing and maintaining cardiorespiratory and muscular fitness, and flexibility in healthy adults.
Med Sci Sports Exer30
:975
991,1998[Medline]
- Zierath JR, He L, Guma A, Wahlstrom E, Klip A, Wallberg-Henriksson H: Insulin action on glucose transport and plasma membrane GLUT4 content in skeletal muscle from patients with NIDDM.
Diabetologia39
:1180
1189,1996[Medline]
- Garvey WT, Maianu L, Zhu JH, Brechtel-Hook G, Wallace P, Baron AD: Evidence for defects in the trafficking and translocation of GLUT4 glucose transporters in skeletal muscle as a cause of human insulin resistance.
J Clin Invest101
:2377
2386,1998[Medline]
- Ryder JW, Chibalin AV, Zierath JR: Intracellular mechanisms underlying increases in glucose uptake in response to insulin or exercise in skeletal muscle.
Acta Physiol Scand171
:249
257,2001[Medline]
- Holloszy JO, Coyle EF: Adaptations of skeletal muscle to endurance exercise and their metabolic consequences.
J Appl Physiol56
:831
838,1984[Abstract/Free Full Text]
- Simoneau JA, Veerkamp JH, Turcotte LP, Kelley DE: Markers of capacity to utilize fatty acids in human skeletal muscle: relation to insulin resistance and obesity and effects of weight loss.
FASEB J13
:2051
2060,1999[Abstract/Free Full Text]
- Simoneau JA, Kelley DE: Altered glycolytic and oxidative capacities of skeletal muscle contribute to insulin resistance in NIDDM.
J Appl Physiol83
:166
171,1997[Abstract/Free Full Text]
- Boirie Y, Short KR, Ahlman B, Charlton M, Nair KS: Tissue-specific regulation of mitochondrial and sarcoplasmic protein synthesis rates by insulin.
Diabetes56
:2652
2658,2001
- Huang X, Eriksson KF, Vaag A, Lehtovirta M, Hansson M, Laurila E, Kanninen T, Olesen BT, Kurucz I, Koranyi L, Groop L: Insulin-regulated mitochondrial gene expression is associated with glucose flux in human skeletal muscle.
Diabetes48
:1508
1514,1999[Abstract]
- Pendergrass M, Koval J, Vogt C, Yki-Jarvinen H, Iozzo P, Pipek R, Ardehali H, Printz R, Granner D, DeFronzo RA, Mandarino LJ: Insulin-induced hexokinase II expression is reduced in obesity and NIDDM.
Diabetes47
:387
394,1998[Abstract]
- Ojuka EO, Jones TE, Nolte LA, Chen M, Wamhoff BR, Sturek M, Holloszy JO: Regulation of GLUT4 biogenesis in muscle: evidence for involvement of AMPK and Ca2+.
Am J Physiol282
:E1008
E1013,2002
- Freyssenet D, DiCarlo M, Hood DA: Calcium-dependent regulation of cytochrome c gene expression in skeletal muscle cells: identification of a protein kinase C-dependent pathway.
J Biol Chem274
:9305
9311,1999[Abstract/Free Full Text]
- Michael LF, Wu Z, Cheatham RB, Puigserver P, Adelmant G, Lehman JL, Kelly DP, Spiegelman BM: Restoration of insulin-sensitive glucose transporter (GLUT4) gene expression in muscle cells by the transcriptional coactivator PGC-1.
Proc Natl Acad Sci U S A98
:3820
3825,2001[Abstract/Free Full Text]
- Rooyackers OE, Adey DB, Ades PA, Nair KS: Effect of age on in vivo rates of mitochondrial protein synthesis in human skeletal muscle.
Proc Natl Acad Sci U S A93
:15364
15369,1996[Abstract/Free Full Text]
- Barazzoni R, Short KR, Nair KS: Effects of aging on mitochondrial DNA copy number and cytochrome c oxidase gene expression in rat skeletal muscle, liver, and heart.
J Biol Chem275
:3343
3347,2000[Abstract/Free Full Text]
- Papa S: Mitochondrial oxidative phosphorylation changes in the life span. Molecular aspects and pathophysiological implications.
Biochim Biophys Acta1276
:87
105,1996[Medline]
- Balagopal P, Schimke JC, Ades P, Adey D, Nair KS: Age effect on transcript levels and synthesis rate of MHC and response to resistance exercise.
Am J Physiol Endocrinol Metab280
:E203
E208,2001[Abstract/Free Full Text]
- Proctor DN, Beck KC: Delay time adjustments to minimize errors in breath-by-breath measurements of VO2 during exercise.
J Appl Physiol81
:2495
2499,1996[Abstract/Free Full Text]
- Avagadro A, Bristow JD, Bier DM, Cobelli C, Toffolo G: Stable-label intravenous glucose tolerance test minimal model.
Diabetes38
:1048
1055,1989[Abstract]
- Jensen MD, Kanaley JA, Reed JE, Sheedy PF: Measurement of abdominal and visceral fat with computed tomography and dual-energy x-ray absorptiometry.
Am J Clin Nutr61
:274
278,1995[Abstract/Free Full Text]
- Houmard JA, Weidner ML, Gavigan KE, Tyndall GL, Hickey MS, Alshami A: Fiber type and citrate synthase activity in the human gastrocnemius and vastus lateralis with aging.
J Appl Physiol85
:1337
1341,1998[Abstract/Free Full Text]
- Regensteiner JG, Bauer TA, Reusch JEB, Brandenburg SL, Sippel JM, Vogelsong AM, Smith S, Wolfel EE, Eckel RH, Hiatt WR: Abnormal oxygen uptake kinetic responses in women with type II diabetes mellitus.
J Appl Physiol85
:310
317,1998[Abstract/Free Full Text]
- Rogers MA, King DS, Hagberg JM, Ehsani AA, Holloszy JO: Effect of 10 days of physical inactivity on glucose tolerance in master athletes.
J Appl Physiol68
:1833
1837,1990[Abstract/Free Full Text]
- Vukovich MD, Arciero PJ, Kohrt WM, Racette SB, Hansen PA, Holloszy JO: Changes in insulin action and GLUT-4 with 6 days of inactivity in endurance runners.
J Appl Physiol80
:240
244,1996[Abstract/Free Full Text]
- Clevenger CM, Jones PP, Tanaka H, Seals DR, DeSouza CA: Decline in insulin action with age in endurance-trained humans.
J Appl Physiol93
:2105
2111,2002[Abstract/Free Full Text]
- Weidner MD, Gavigan KE, Tyndall GL, Hickey MS, McCammon MR, Houmard JA: Which anthropometric indices of regional adiposity are related to the insulin resistance of aging?
Int J Obes19
:325
330,1995
- Dengel DR, Pratley RE, Hagberg JM, Rogus EM, Goldberg AP: Distinct effects of aerobic exercise training and weight loss on glucose homeostasis in obese sedentary men.
J Appl Physiol81
:318
325,1996[Abstract/Free Full Text]
- Kelley DE, Goodpaster BH: Skeletal muscle triglyceride: an aspect of regional adiposity and insulin resistance.
Diabetes Care24
:933
941,2001[Abstract/Free Full Text]
- Houmard JA, Shinebarger MH, Dolan PL, Leggett-Frazier N, Bruner RK, McCammon MR, Isreal RG, Dohm GL: Exercise training increases GLUT4 concentration in previously sedentary middle-aged men.
Am J Physiol264
:E896
E901,1993
- Goodpaster BH, Thaete FL, Simoneau JA, Kelley DE: Subcutaneous abdominal fat and thigh muscle composition predict insulin sensitivity independently of visceral fat.
Diabetes46
:1579
1585,1997[Abstract]
- Abate N, Garg A, Peshock RM, Stray-Gunderson J, Adams-Huet B, Grundy SM: Relationships of generalized and regional adiposity to insulin sensitivity in men.
J Clin Invest96
:88
98,1995
- Kelley DE, Thaete FL, Troost F, Huwe T, Goodpaster BH: Subdivisions of subcutaneous abdominal adipose tissue and insulin resistance.
Am J Physiol278
:E941
E948,2000
- Scarpula RC: Nuclear activators and coactivators in mammalian mitochondrial biogenesis.
Biochim Biophys Acta1576
:1
14,2002[Medline]
- Lin J, Wu H, Tarr PT, Zhang CY, Wu Z, Boss O, Michael LF, Puigserver P, Isotani E, Olson EN, Lowell BB, Bassel-Duby R, Spiegelman BM: Transcriptional co-activator PGC-1
drives the formation of slow-twitch muscle fibers.
Nature418
:797
800,2002[Medline]
- Gordon JW, Rungi AA, Inagaki H, Hood DA: Effects of contractile activity on mitochondrial transcription factor A expression in skeletal muscle.
J Appl Physiol90
:389
396,2001[Abstract/Free Full Text]
- Hamilton ML, Van Remmen H, Drake JA, Yang H, Guo ZM, Kewitt K, Walter CA, Richardson A: Does oxidative damage to DNA increase with age?
Proc Natl Acad Sci U S A98
:10469
10474,2001[Abstract/Free Full Text]
- Lezza AMS, Pesce V, Cormio A, Fracasso F, Vecchiet J, Felzani G, Cantatore P, Gadaleta MN: Increased expression of mitochondrial transcription factor A and nuclear respiratory factor-1 in skeletal muscle from aged human subjects.
FEBS Lett501
:74
78,2001[Medline]
- Berthon P, Freyssenet D, Chatard JC, Castells J, Mujika I, Geyssant A, Guezennec CY, Denis C: Mitochondrial ATP production rate in 55 to 73-year-old men: effect of endurance training.
Acta Physiol Scand154
:269
274,1995[Medline]
- Coggan AR, Spina RJ, King DS, Rogers MA, Brown M, Nemeth PM, Holloszy JO: Skeletal muscle adaptations to endurance training in 60- to 70-yr-old men and women.
J Appl Physiol72
:1780
1786,1992[Abstract/Free Full Text]
- Bengtssson J, Gustofsson T, Widegren U, Jansson E, Sundberg CJ: Mitochondrial transcription factor A and respiratory complex IV increase in response to exercise training in humans.
Pflugers Arch443
:61
66,2001[Medline]
- Puntschart A, Claassen H, Jostarndt K, Hoppeler H, Billeter R: mRNAs of enzymes involved in energy metabolism and mtDNA are increased in endurance-trained athletes.
Am J Physiol269
:C619
C625,1995

CiteULike Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
O. H. Mortensen, P. Plomgaard, C. P. Fischer, A. K. Hansen, H. Pilegaard, and B. K. Pedersen
PGC-1beta is downregulated by training in human skeletal muscle: no effect of training twice every second day vs. once daily on expression of the PGC-1 family
J Appl Physiol,
November 1, 2007;
103(5):
1536 - 1542.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Tsang, R. Orr, P. Lam, E. Comino, and M. F. Singh
Effects of Tai Chi on glucose homeostasis and insulin sensitivity in older adults with type 2 diabetes: a randomised double-blind sham-exercise-controlled trial
Age Ageing,
October 25, 2007;
(2007)
afm127v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Tarnopolsky, S. Phillips, G. Parise, A. Varbanov, J. DeMuth, P. Stevens, A. Qu, F. Wang, and R. Isfort
Gene Expression, Fiber Type, and Strength Are Similar Between Left and Right Legs in Older Adults
J. Gerontol. A Biol. Sci. Med. Sci.,
October 1, 2007;
62(10):
1088 - 1095.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. F. E. Praet and L. J. C. van Loon
Optimizing the therapeutic benefits of exercise in Type 2 diabetes
J Appl Physiol,
October 1, 2007;
103(4):
1113 - 1120.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. X. Rong, Y. Qiu, M. K. Hansen, L. Zhu, V. Zhang, M. Xie, Y. Okamoto, M. D. Mattie, H. Higashiyama, S. Asano, et al.
Adipose Mitochondrial Biogenesis Is Suppressed in db/db and High-Fat Diet-Fed Mice and Improved by Rosiglitazone
Diabetes,
July 1, 2007;
56(7):
1751 - 1760.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. K. Heilbronn, S. K. Gan, N. Turner, L. V. Campbell, and D. J. Chisholm
Markers of Mitochondrial Biogenesis and Metabolism Are Lower in Overweight and Obese Insulin-Resistant Subjects
J. Clin. Endocrinol. Metab.,
April 1, 2007;
92(4):
1467 - 1473.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Harris, L. M. Lanningham-Foster, S. K. McCrady, and J. A. Levine
Nonexercise movement in elderly compared with young people
Am J Physiol Endocrinol Metab,
April 1, 2007;
292(4):
E1207 - E1212.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. S. Chow, L. J. Greenlund, Y. W. Asmann, K. R. Short, S. K. McCrady, J. A. Levine, and K. S. Nair
Impact of endurance training on murine spontaneous activity, muscle mitochondrial DNA abundance, gene transcripts, and function
J Appl Physiol,
March 1, 2007;
102(3):
1078 - 1089.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|