Diabetes 53:3020-3023, 2004
© 2004 by the American Diabetes Association, Inc.
Replication of an Association Between the Lymphoid Tyrosine Phosphatase Locus (LYP/PTPN22) With Type 1 Diabetes, and Evidence for Its Role as a General Autoimmunity Locus
Deborah Smyth1,
Jason D. Cooper1,
Joanne E. Collins2,
Joanne M. Heward2,
Jayne A. Franklyn2,
Joanna M.M. Howson1,
Adrian Vella1,
Sarah Nutland1,
Helen E. Rance1,
Lisa Maier1,
Bryan J. Barratt3,
Cristian Guja4,
Constantin Ionescu-Tîrgovi te4,
David A. Savage5,
David B. Dunger6,
Barry Widmer6,
David P. Strachan7,
Susan M. Ring8,
Neil Walker1,
David G. Clayton1,
Rebecca C.J. Twells1,
Stephen C.L. Gough2, and
John A. Todd1
1 Juvenile Diabetes Research Foundation (JDRF)/Wellcome Trust (WT) Diabetes and Inflammation Laboratory, Cambridge Institute for Medical Research (CIMR), University of Cambridge, Cambridge, U.K
2 Division of Medical Sciences, University of Birmingham, Birmingham, U.K
3 AstraZeneca, Macclesfield, U.K
4 Clinic of Diabetes, Institute of Diabetes, Nutrition and Metabolic Diseases "N. Paulescu," Bucharest, Romania
5 Department of Medical Genetics, Queens University Belfast, Belfast City Hospital, Belfast, Northern Ireland
6 Department of Paediatrics, Addenbrookes Hospital, University of Cambridge, Cambridge, U.K
7 Department of Public Health Sciences, St. Georges Hospital Medical School, London, U.K
8 Avon Longitudinal Study of Parents and Children (ALSPAC), University of Bristol, Bristol, U.K
 |
ABSTRACT
|
|---|
In the genetic analysis of common, multifactorial diseases, such as type 1 diabetes, true positive irrefutable linkage and association results have been rare to date. Recently, it has been reported that a single nucleotide polymorphism (SNP), 1858C>T, in the gene PTPN22, encoding Arg620Trp in the lymphoid protein tyrosine phosphatase (LYP), which has been shown to be a negative regulator of T-cell activation, is associated with an increased risk of type 1 diabetes. Here, we have replicated these findings in 1,388 type 1 diabetic families and in a collection of 1,599 case and 1,718 control subjects, confirming the association of the PTPN22 locus with type 1 diabetes (family-based relative risk (RR) 1.67 [95% CI 1.461.91], and case-control odds ratio (OR) 1.78 [95% CI 1.542.06]; overall P = 6.02 x 1027). We also report evidence for an association of Trp620 with another autoimmune disorder, Graves disease, in 1,734 case and control subjects (P = 6.24 x 104; OR 1.43 [95% CI 1.171.76]). Taken together, these results indicate a more general association of the PTPN22 locus with autoimmune disease.
Type 1 diabetes is a multigenic autoimmune disease with three loci identified so far, the HLA class II genes (1), the insulin gene on chromosome 11p15 (2,3), and the CTLA4 locus on 2q33 (4,5), all of which are involved in T-cell activation, homeostasis, and repertoire formation. Very recently, evidence for a fourth locus has been reported (6), PTPN22 on chromosome 1p13, which encodes a lymphoid protein tyrosine kinase (LYP) that is important in negative control of T-cell activation and in T-cell development (7,8). A nonsynonymous single nucleotide polymorphism (SNP) at nucleotide 1858 in codon 620 (Arg620Trp) in PTPN22 was associated with type 1 diabetes in North American and Sardinian collections (6). The disease-associated variant Trp620 may alter the binding of LYP to the cytoplasmic tyrosine kinase (6,9), which regulates the T-cell receptorsignaling kinases, T-cellspecific protein tyrosine kinase (LCK) and FYN (8,9).
Evidence for this association was based on two independent case-control collections from North America (294 case and 395 control subjects, P = 5.99 x 104, odds ratio [OR] for allele T = 1.83 [95% CI 1.282.60]) and Sardinia (174 case and 214 control subjects, P = 0.047, OR for allele T = 2.31 [0.935.82]). Because irrefutable results are rare in complex diseases (10,11,12), we sought to confirm the PTPN22/LYP Arg620Trp/1858C>T SNP association in several independent populations. We genotyped the SNP in 791 U.K., 336 U.S., and 261 Romanian multiplex and simplex type 1 diabetic families (13), providing 1,946 parent-child trio genotypes, and in 1,573 type 1 diabetic case subjects and 1,718 control subjects from the U.K. We confirmed the association in the family (P = 5.62 x 1014, relative risk [RR] for allele T = 1.67 [95% CI 1.461.91]) and case-control (likelihood-ratio test P = 4.22 x 1015, OR for allele T = 1.78 [95% CI 1.542.06]) collections, with the combined result being highly significant (P = 6.02 x 1027) (Table 1). There was evidence of population heterogeneity in the 1858C>T genotype frequencies (P = 1.28 x 105), but not in the disease association (P = 0.98) (Table 2). Having confirmed the association and found a striking consistency across different Caucasian populations, we performed case-only locus-locus interaction analyses (14,15) between 1858C>T and the known type 1 diabetes susceptibility loci at IDDM1/HLA, the IDDM12/CTLA4 CT60 SNP (rs3087243) (5), and the IDDM2/INS variable number of tandem repeats (VNTR) (23HphI, rs689) (2). No evidence for an interaction with CTLA4 CT60, INS VNTR, and HLA-DRB1 was consistently found between the analyses of the affected offspring from the family collection and the case subjects from the case-control collection and PTPN22/LYP Arg620Trp/1858C>T (Table 3). However, evidence of a statistical interaction, or lack of one, is difficult to interpret (14,15). The distribution of 1858C>T genotypes were also evaluated on the basis of age at onset of type 1 diabetes, parent of origin, and sex, and no consistent evidence of heterogeneity was found (Table 3).
View this table:
[in this window]
[in a new window]
|
TABLE 1 The 1858C>T/Trp620 allele and genotype frequencies and association test results in the type 1 diabetic family and case-control collections
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 2 Population PTPN22/LYP1858C>T parental allele frequencies and transmission-disequilibrium test results for allele T/Trp620
|
|
Given that Graves disease, type 1 diabetes, autoimmune hypothyroidism, and other autoimmune diseases, such as rheumatoid arthritis, commonly cluster in the same families (16), it is likely they share some of the same susceptibility genes and alleles, as demonstrated at CTLA4 for type 1 diabetes and Graves disease (5). Owing to the central role of LYP in T-cell signaling, the Trp620 variant could be a shared determinant among different autoimmune and immune-mediated diseases. Hence, we investigated whether this locus was also associated with autoimmune thyroid disease, using a case-control collection (901 Graves disease case subjects and 833 control subjects, all of whom were independent of the type 1 diabetic control subjects study). We found evidence for an association (likelihood-ratio test P = 6.26 x 104, OR for allele T = 1.43 [95% CI 1.171.76]) (Table 4), indicating that this locus may have a general effect on predisposition to autoimmunity. Very recently, the Trp620 variant has also been associated with rheumatoid arthritis and systemic lupus erythematosus (17,18). It will be interesting to test in future experiments if Arg620Trp is the only disease-associated variant in the gene and in this chromosome region.
View this table:
[in this window]
[in a new window]
|
TABLE 4 PTPN22/LYP 1858C>T/Trp620 allele and genotype frequencies and association test results in the Graves disease case-control collection
|
|
 |
RESEARCH DESIGN AND METHODS
|
|---|
The 1,573 case subjects were recruited as part of the U.K. Genetic Resource Investigating Diabetes (GRID) study, which is a joint project between the University of Cambridge Departments of Pediatrics and Medical Genetics and is funded by the Juvenile Diabetes Research Foundation and the Wellcome Trust. The eventual aim of this project is to collect 8,000 case subjects with type 1 diabetes matched geographically across Great Britain (http://www-gene.cimr.cam.ac.uk/ucdr/grid.shtml) to 8,000 control subjects from the 1958 British Birth Cohort (http://www.cls.ioe.ac.uk/Cohort/Ncds/mainncds.htm) to allow statistically powered genetic association studies. The 1,718 1958 British Birth Cohort control subjects are part of a longitudinal study in which the subjects are British citizens born in a particular week in March 1958. The case subjects, all Caucasian and <16 years of age, have a mean age at onset of type 1 diabetes at 7.5 years, with an SD of 4 years. The regional distribution of case and control subjects are matched. All families were Caucasian of European descent and were composed of two parents and at least one affected child. The families consisted of 528 multiplex families from the Diabetes U.K. Warren 1 collection (20), including 56 simplex families from Yorkshire, providing 1,912 genotypes (2,040 individuals attempted to be genotyped), 336 multiplex families from the Human Biological Data Interchange (U.S.) (21), providing 1,315 genotypes (1,382 attempted), 263 multiplex/simplex families from Belfast (22), providing 847 genotypes (885 attempted), and 261 Romanian simplex families, providing 819 genotypes (845 attempted), with inclusion criteria as reported in Vella et al. (13). Caucasian, U.K.-born, Graves disease case subjects (n = 901) were recruited from thyroid clinics as described previously (5,23). Ethnically matched control subjects (n = 833) with no history of autoimmune disease were recruited at various sites in Birmingham and Oxford (independent of the U.K. GRID study). All DNA samples were collected after approval from the relevant research ethics committees, and written informed consent was obtained from the participants.
Genotyping.
Genotyping, in the type 1 diabetes collections, was undertaken using TaqMan (Applied Biosystems, Warrington, U.K.), and probes and primers were also designed by Applied Biosystems.
All genotyping was double scored to minimize error and a duplicate plate was typed to check genotyping quality. No mismatches were observed. The primers were as follows: forward, CAACTGCTCCAAGGATAGATGATGA, reverse, CCAGCTTCCTAACCACAATAAATG, FAM probe, TCAGGTGTCCGTACAGG, and VIC probe, TCAGGTGTCCATACAGG.
Genotyping in the Graves disease and control collection was undertaken using PCR followed by restriction enzyme digest with PCR primers and XcmI, as described by Bottini et al. (8).
The interaction analyses used CTLA4 CT60 (rs3087243) (5), the INS 23HphI (rs689) as a surrogate for the INS VNTR (2), and HLA-DRB1 (24).
Statistical analysis.
All statistical analyses were performed in the STATA statistical package (http://www.stata.com). Some additional STATA routines were used and may be downloaded from http://www-gene.cimr.cam.ac.uk/clayton/software/stata.
A score test was used to combine tests from family and case-control studies. If U is the score statistic, contrasting allele frequencies in case and control subjects or, in family studies, frequencies of transmitted and untransmitted alleles and V is the estimated variance of the score statistic, U2/V is asymptotically distributed as 2, with 1 degree of freedom. To combine results, we first calculate U and V for each study and calculate an overall U and V by summing the contributions from each study, U = U1 + U2 and V = V1 + V2. We then calculate U2/V.
Arg620Trp allele frequencies in parents and control subjects were in Hardy-Weinberg equilibrium. The case-only (affected offspring only) locus-locus interaction analysis, defined as deviation from a multiplicative model for the joint effects of the two genotypes (25), was performed using regression model as a score test for association between genotypes in case subjects.
Potential population substructure within the U.K. case-control collections could slightly inflate the P values reported. We have, therefore, analyzed the case-control collection adjusting for 12 geographical regions within Britain. This increases the P value to 8.23 x 1012 and OR to 172 (95% CI 1.472.01).
 |
ACKNOWLEDGMENTS
|
|---|
We thank the Juvenile Diabetes Research Foundation, the Wellcome Trust, Diabetes U.K., and the Medical Research Council for financial support.
We gratefully acknowledge the participation of all of the patients, control subjects, and family members and thank Tasneem Hassanali, Jayne Hutchings, Gillian Coleman, Sarah Field, Trupti Mistry, Kirsi Bourget, Sally Clayton, Matthew Hardy, Jennifer Keylock, Pamela Lauder, Meeta Maisuria, William Meadows, Meera Sebastian, and Sarah Wood for preparing the DNA samples.
 |
FOOTNOTES
|
|---|
D.S. and J.D.C. contributed equally to this work.
Address correspondence and reprint requests to Professor John A. Todd, Juvenile Diabetes Research Foundation (JDRF)/Wellcome Trust (WT) Diabetes and Inflammation Laboratory, Cambridge Institute for Medical Research (CIMR), University of Cambridge, Cambridge, U.K. E-mail: john.todd{at}cimr.cam.ac.uk
Received for publication June 4, 2004
and accepted in revised form August 17, 2004
Abbreviations:
GRID, Genetic Resource Investigating Diabetes; LYP, lymphoid protein tyrosine phosphatase; SNP, single nucleotide polymorphism; VNTR, variable number of tandem repeats
 |
REFERENCES
|
|---|
- Cucca F, Lampis R, Congia M, Angius E, Nutland S, Bain SC, Barnett AH, Todd JA: A correlation between the relative predisposition of MHC class II alleles to type 1 diabetes and the structure of their proteins.
Hum Mol Genet10
:2025
2037,2001[Abstract/Free Full Text]
- Barratt BJ, Payne F, Lowe CE, Hermann R, Healy BC, Harold D, Concannon P, Gharani N, McCarthy MI, Olavesen MG, McCormack R, Guja C, Ionescu-Tirgoviste C, Undlien DE, Ronningen KS, Gillespie KM, Tuomilehto-Wolf E, Tuomilehto J, Bennett ST, Clayton DG, Cordell HJ, Todd JA: Remapping the insulin gene/IDDM2 locus in type 1 diabetes.
Diabetes53
:1884
1889,2004[Abstract/Free Full Text]
- Bell GI, Horita S, Karam JH: A polymorphic locus near the human insulin gene is associated with insulin-dependent diabetes mellitus.
Diabetes33
:176
183,1984[Abstract]
- Nistico L, Buzzetti R, Pritchard LE, Van der Auwera B, Giovannini C, Bosi E, Larrad MT, Rios MS, Chow CC, Cockram CS, Jacobs K, Mijovic C, Bain SC, Barnett AH, Vandewalle CL, Schuit F, Gorus FK, Tosi R, Pozzilli P, Todd JA: The CTLA-4 gene region of chromosome 2q33 is linked to, and associated with, type 1 diabetes.
Hum Mol Genet5
:1075
1080,1996[Abstract/Free Full Text]
- Ueda H, Howson JM, Esposito L, Heward J, Snook H, Chamberlain G, Rainbow DB, Hunter KM, Smith AN, Di Genova G, Herr MH, Dahlman I, Payne F, Smyth D, Lowe C, Twells RC, Howlett S, Healy B, Nutland S, Rance HE, Everett V, Smink LJ, Lam AC, Cordell HJ, Walker NM, Bordin C, Hulme J, Motzo C, Cucca F, Hess JF, Metzker ML, Rogers J, Gregory S, Allahabadia A, Nithiyananthan R, Tuomilehto-Wolf E, Tuomilehto J, Bingley P, Gillespie KM, Undlien DE, Ronningen KS, Guja C, Ionescu-Tirgoviste C, Savage DA, Maxwell AP, Carson DJ, Patterson CC, Franklyn JA, Clayton DG, Peterson LB, Wicker LS, Todd JA, Gough SC: Association of the T-cell regulatory gene CTLA4 with susceptibility to autoimmune disease.
Nature423
:506
511,2003[Medline]
- Bottini N, Musumeci L, Alonso A, Rahmouni S, Nika K, Rostamkhani M, MacMurray J, Meloni GF, Lucarelli P, Pellecchia M, Eisenbarth GS, Comings D, Mustelin T: A functional variant of lymphoid tyrosine phosphatase is associated with type I diabetes.
Nat Genet36
:337
338,2004[Medline]
- Hasegawa K, Martin F, Huang G, Tumas D, Diehl L, Chan AC: PEST domain-enriched tyrosine phosphatase (PEP) regulation of effector/memory T cells.
Science303
:685
689,2004[Abstract/Free Full Text]
- Hill RJ, Zozulya S, Lu YL, Ward K, Gishizky M, Jallal B: The lymphoid protein tyrosine phosphatase Lyp interacts with the adaptor molecule Grb2 and functions as a negative regulator of T-cell activation.
Exp Hematol30
:237
244,2002[Medline]
- Cloutier JF, Veillette A: Cooperative inhibition of T-cell antigen receptor signaling by a complex between a kinase and a phosphatase.
J Exp Med189
:111
121,1999[Abstract/Free Full Text]
- Lohmueller KE, Pearce CL, Pike M, Lander ES, Hirschhorn JN: Meta-analysis of genetic association studies supports a contribution of common variants to susceptibility to common disease.
Nat Genet33
:177
182,2003[Medline]
- Dahlman I, Eaves IA, Kosoy R, Morrison VA, Heward J, Gough SC, Allahabadia A, Franklyn JA, Tuomilehto J, Tuomilehto-Wolf E, Cucca F, Guja C, Ionescu-Tirgoviste C, Stevens H, Carr P, Nutland S, McKinney P, Shield JP, Wang W, Cordell HJ, Walker N, Todd JA, Concannon P: Parameters for reliable results in genetic association studies in common disease.
Nat Genet30
:149
150,2002[Medline]
- Ioannidis JP, Trikalinos TA, Ntzani EE, Contopoulos-Ioannidis DG: Genetic associations in large versus small studies: an empirical assessment.
Lancet361
:567
571,2003[Medline]
- Vella A, Howson JM, Barratt BJ, Twells RC, Rance HE, Nutland S, Tuomilehto-Wolf E, Tuomilehto J, Undlien DE, Ronningen KS, Guja C, Ionescu-Tirgovi°te C, Savage DA, Todd JA: Lack of association of the Ala45Thr polymorphism and other common variants of the NeuroD gene with type 1 diabetes.
Diabetes53
:1158
1161,2004[Abstract/Free Full Text]
- Cordell HJ, Todd JA, Hill NJ, Lord CJ, Lyons PA, Peterson LB, Wicker LS, Clayton DG: Statistical modeling of interlocus interactions in a complex disease: rejection of the multiplicative model of epistasis in type 1 diabetes.
Genetics158
:357
367,2001[Abstract/Free Full Text]
- Cordell HJ: Epistasis: what it means, what it doesnt mean, and statistical methods to detect it in humans.
Hum Mol Genet11
:2463
2468,2002[Abstract/Free Full Text]
- Tait KF, Marshall T, Berman J, Carr-Smith J, Rowe B, Todd JA, Bain SC, Barnett AH, Gough SC: Clustering of autoimmune disease in parents of siblings from the type 1 diabetes Warren repository.
Diabet Med21
:358
362,2004[Medline]
- Begovich AB, Carlton VE, Honigberg LA, Schrodi SJ, Chokkalingam AP, Alexander HC, Ardlie KG, Huang Q, Smith AM, Spoerke JM, Conn MT, Chang M, Chang SY, Saiki RK, Catanese JJ, Leong DU, Garcia VE, McAllister LB, Jeffery DA, Lee AT, Batliwalla F, Remmers E, Criswell LA, Seldin MF, Kastner DL, Amos CI, Sninsky JJ, Gregersen PK: A missense single-nucleotide polymorphism in a gene encoding a protein tyrosine phosphatase (PTPN22) is associated with rheumatoid arthritis.
Am J Hum Genet75
:330
337,2004[Medline]
- Kyogoku C, Langefeld CD, Ortmann WA, Lee A, Selby S, Carlton VE, Chang M, Ramos P, Baechler EC, Batliwalla FM, Novitzke J, Williams AH, Gillett C, Rodine P, Graham RR, Ardlie KG, Gaffney PM, Moser KL, Petri M, Begovich AB, Gregersen PK, Behrens TW: Genetic association of the R620W polymorphism of protein tyrosine phosphatase PTPN22 with human SLE.
Am J Hum Genet75
:504
507,2004[Medline]
- Cordell HJ, Clayton DG: A unified stepwise regression procedure for evaluating the relative effects of polymorphisms within a gene using case/control or family data: application to HLA in type 1 diabetes.
Am J Hum Genet70
:124
141,2002[Medline]
- Bain SC, Todd JA, Barnett AH: The British Diabetic Association: Warren repository.
Autoimmunity7
:83
85,1990[Medline]
- Lernmark A, Ducat L, Eisenbarth G, Ott J, Permutt MA, Rubenstein P, Spielman R: Family cell lines available for research.
Am J Hum Genet47
:1028
1030,1990[Medline]
- Patterson CC, Carson DJ, Hadden DR: Epidemiology of childhood IDDM in Northern Ireland 19891994: low incidence in areas with highest population density and most household crowding: Northern Ireland Diabetes Study Group.
Diabetologia39
:1063
1069,1996[Medline]
- Allahabadia A, Heward JM, Nithiyananthan R, Gibson SM, Reuser TT, Dodson PM, Franklyn JA, Gough SC: MHC class II region, CTLA4 gene, and ophthalmopathy in patients with Graves disease.
Lancet358
:984
985,2001[Medline]
- Maier LM, Twells RC, Howson JM, Lam AC, Clayton DG, Smyth DJ, Savage D, Carson D, Patterson CC, Smink LJ, Walker NM, Burren OS, Nutland S, Rance H, Tuomilehto-Wolf E, Tuomilehto J, Guja C, Ionescu-Tirgovi
te C, Undlien DE, Ronningen KS, Cucca F, Todd JA: Testing the possible negative association of type 1 diabetes and atopic disease by analysis of the interleukin 4 receptor gene.
Genes Immun4
:469
475,2003[Medline]
- Clayton D, McKeigue PM: Epidemiological methods for studying genes and environmental factors in complex diseases.
Lancet358
:1356
1360,2001[Medline]

CiteULike Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
D. J. Smyth, J. D. Cooper, J. M.M. Howson, N. M. Walker, V. Plagnol, H. Stevens, D. G. Clayton, and J. A. Todd
PTPN22 Trp620 Explains the Association of Chromosome 1p13 With Type 1 Diabetes and Shows a Statistical Interaction With HLA Class II Genotypes
Diabetes,
June 1, 2008;
57(6):
1730 - 1737.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Zoledziewska, C. Perra, V. Orru, L. Moi, P. Frongia, M. Congia, N. Bottini, and F. Cucca
Further Evidence of a Primary, Causal Association of the PTPN22 620W Variant With Type 1 Diabetes
Diabetes,
January 1, 2008;
57(1):
229 - 234.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Rieck, A. Arechiga, S. Onengut-Gumuscu, C. Greenbaum, P. Concannon, and J. H. Buckner
Genetic Variation in PTPN22 Corresponds to Altered Function of T and B Lymphocytes
J. Immunol.,
October 1, 2007;
179(7):
4704 - 4710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Bailey, J. D. Cooper, L. Zeitels, D. J. Smyth, J. H.M. Yang, N. M. Walker, E. Hypponen, D. B. Dunger, E. Ramos-Lopez, K. Badenhoop, et al.
Association of the Vitamin D Metabolism Gene CYP27B1 With Type 1 Diabetes
Diabetes,
October 1, 2007;
56(10):
2616 - 2621.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
The International Multiple Sclerosis Genetics Cons
Risk Alleles for Multiple Sclerosis Identified by a Genomewide Study
N. Engl. J. Med.,
August 30, 2007;
357(9):
851 - 862.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. K. Kavvoura, T. Akamizu, T. Awata, Y. Ban, D. A. Chistiakov, I. Frydecka, A. Ghaderi, S. C. Gough, Y. Hiromatsu, R. Ploski, et al.
Cytotoxic T-Lymphocyte Associated Antigen 4 Gene Polymorphisms and Autoimmune Thyroid Disease: A Meta-Analysis
J. Clin. Endocrinol. Metab.,
August 1, 2007;
92(8):
3162 - 3170.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Sutherland, J. Davies, C. J. Owen, S. Vaikkakara, C. Walker, T. D. Cheetham, R. A. James, P. Perros, P. T. Donaldson, H. J. Cordell, et al.
Genomic Polymorphism at the Interferon-Induced Helicase (IFIH1) Locus Contributes to Graves' Disease Susceptibility
J. Clin. Endocrinol. Metab.,
August 1, 2007;
92(8):
3338 - 3341.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Heward, O. J. Brand, J. C. Barrett, J. D. Carr-Smith, J. A. Franklyn, and S. C. Gough
Association of PTPN22 Haplotypes with Graves' Disease
J. Clin. Endocrinol. Metab.,
February 1, 2007;
92(2):
685 - 690.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. H. Lee, Y. H. Rho, S. J. Choi, J. D. Ji, G. G. Song, S. K. Nath, and J. B. Harley
The PTPN22 C1858T functional polymorphism and autoimmune diseases--a meta-analysis
Rheumatology,
January 1, 2007;
46(1):
49 - 56.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Ikari, S. Momohara, E. Inoue, T. Tomatsu, M. Hara, H. Yamanaka, and N. Kamatani
Haplotype analysis revealed no association between the PTPN22 gene and RA in a Japanese population
Rheumatology,
November 1, 2006;
45(11):
1345 - 1348.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Onengut-Gumuscu, J. H. Buckner, and P. Concannon
A Haplotype-Based Analysis of the PTPN22 Locus in Type 1 Diabetes.
Diabetes,
October 1, 2006;
55(10):
2883 - 2889.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. A. Aly, A. Ide, M. M. Jahromi, J. M. Barker, M. S. Fernando, S. R. Babu, L. Yu, D. Miao, H. A. Erlich, P. R. Fain, et al.
Extreme genetic risk for type 1A diabetes
PNAS,
September 19, 2006;
103(38):
14074 - 14079.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Tsurumaru, E. Kawasaki, H. Ida, K. Migita, A. Moriuchi, K. Fukushima, T. Fukushima, N. Abiru, H. Yamasaki, S. Noso, et al.
Evidence for the Role of Small Ubiquitin-Like Modifier 4 as a General Autoimmunity Locus in the Japanese Population
J. Clin. Endocrinol. Metab.,
August 1, 2006;
91(8):
3138 - 3143.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Gillespie
Type 1 diabetes: pathogenesis and prevention.
Can. Med. Assoc. J.,
July 18, 2006;
175(2):
165 - 170.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Smyth, J. D. Cooper, C. E. Lowe, S. Nutland, N. M. Walker, D. G. Clayton, and J. A. Todd
No Evidence for Association of OAS1 With Type 1 Diabetes in Unaffected Siblings or Type 1 Diabetic Cases.
Diabetes,
May 1, 2006;
55(5):
1525 - 1528.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Barker
Type 1 Diabetes-Associated Autoimmunity: Natural History, Genetic Associations, and Screening
J. Clin. Endocrinol. Metab.,
April 1, 2006;
91(4):
1210 - 1217.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Hinks, J. Worthington, and W. Thomson
The association of PTPN22 with rheumatoid arthritis and juvenile idiopathic arthritis
Rheumatology,
April 1, 2006;
45(4):
365 - 368.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Simmonds, J. M. Heward, J. Carr-Smith, H. Foxall, J. A. Franklyn, and S. C. L. Gough
Contribution of Single Nucleotide Polymorphisms within FCRL3 and MAP3K7IP2 to the Pathogenesis of Graves' Disease
J. Clin. Endocrinol. Metab.,
March 1, 2006;
91(3):
1056 - 1061.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Taylor, S. C. Gough, P. J. Hunt, T. H. Brix, K. Chatterjee, J. M. Connell, J. A. Franklyn, L. Hegedus, B. G. Robinson, W. M. Wiersinga, et al.
A Genome-Wide Screen in 1119 Relative Pairs with Autoimmune Thyroid Disease
J. Clin. Endocrinol. Metab.,
February 1, 2006;
91(2):
646 - 653.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Traherne, L. F. Barcellos, S. J. Sawcer, A. Compston, P. P. Ramsay, S. L. Hauser, J. R. Oksenberg, and J. Trowsdale
Association of the truncating splice site mutation in BTNL2 with multiple sclerosis is secondary to HLA-DRB1*15
Hum. Mol. Genet.,
January 1, 2006;
15(1):
155 - 161.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kahles, E. Ramos-Lopez, B. Lange, O. Zwermann, M. Reincke, and K. Badenhoop
Sex-specific association of PTPN22 1858T with type 1 diabetes but not with Hashimoto's thyroiditis or Addison's disease in the German population
Eur. J. Endocrinol.,
December 1, 2005;
153(6):
895 - 899.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Florez
Editorial: Genetic Susceptibility for Polycystic Ovary Syndrome on Chromosome 19: Advances in the Genetic Dissection of Complex Reproductive Traits
J. Clin. Endocrinol. Metab.,
December 1, 2005;
90(12):
6732 - 6734.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Noso, H. Ikegami, T. Fujisawa, Y. Kawabata, K. Asano, Y. Hiromine, M. Tsurumaru, S. Sugihara, I. Lee, E. Kawasaki, et al.
Genetic Heterogeneity in Association of the SUMO4 M55V Variant With Susceptibility to Type 1 Diabetes
Diabetes,
December 1, 2005;
54(12):
3582 - 3586.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. C. L. Gough and M. C. O'Donovan
Clustering of metabolic comorbidity in schizophrenia: a genetic contribution?
J Psychopharmacol,
November 1, 2005;
19(6_suppl):
47 - 55.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Concannon, H. A. Erlich, C. Julier, G. Morahan, J. Nerup, F. Pociot, J. A. Todd, S. S. Rich, and the Type 1 Diabetes Genetics Consortium
Type 1 Diabetes: Evidence for Susceptibility Loci from Four Genome-Wide Linkage Scans in 1,435 Multiplex Families
Diabetes,
October 1, 2005;
54(10):
2995 - 3001.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C E Jennings, C J Owen, V Wilson, and S H S Pearce
A haplotype of the CYP27B1 promoter is associated with autoimmune Addison's disease but not with Graves' disease in a UK population
J. Mol. Endocrinol.,
June 1, 2005;
34(3):
859 - 863.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Zheng and J.-X. She
Genetic Association Between a Lymphoid Tyrosine Phosphatase (PTPN22) and Type 1 Diabetes
Diabetes,
March 1, 2005;
54(3):
906 - 908.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Simmonds and S. C. L. Gough
Genetic insights into disease mechanisms of autoimmunity
Br. Med. Bull.,
February 8, 2005;
71(1):
93 - 113.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|