Diabetes
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Larger, E.
Right arrow Articles by Gasc, J.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Larger, E.
Right arrow Articles by Gasc, J.-M.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Diabetes 53:752-761, 2004
© 2004 by the American Diabetes Association, Inc.

Hyperglycemia-Induced Defects in Angiogenesis in the Chicken Chorioallantoic Membrane Model

Etienne Larger1,2, Michel Marre2, Pierre Corvol1, and Jean-Marie Gasc1

1 INSERM U36, Chaire de Médecine Expérimentale, Collège de France, Paris, France
2 Faculté de Médecine X, Bichat, Université Paris 7, Paris, France


    ABSTRACT
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Diabetes is associated with abnormal angiogenesis. Increased angiogenesis contributes to severe forms of diabetic retinopathy, but angiogenesis is decreased in response to myocardial ischemia in diabetic patients. We evaluated the direct effect of hyperglycemia on angiogenesis in the chicken chorioallantoic membrane assay, a model of active neoangiogenesis. Hyperglycemia, lasting up to 7 days, was induced in 7-day-old chick embryos by a single intravitellus glucose injection. Control embryos received either water (volumic control) or mannitol (osmotic control). Hyperglycemia decreased angiogenesis in this model from the 5th day on. The pattern and expression level of the main vascular growth factors’ genes were not altered by hyperglycemia, as assessed by in situ hybridization and semiquantitative RT-PCR. As early as 2 days after hyperglycemia was induced, an increased apoptosis of endothelial cells and pericytes was detected by transferase-mediated deoxyuridine triphosphate nick-end labeling assay and electron microscopy. In the meantime, endothelial cell proliferation was decreased, as assessed by incorporation of bromo-deoxyuridine. Hyperglycemia can therefore impair angiogenesis without altering the expression level of vascular growth factors through induction of apoptosis and decreased proliferation of endothelial cells.


Alterations in structure and function of both micro- and macrovessels cause most diabetes-associated morbidity and mortality. Microvessel pathology is characteristically involved in the pathogenesis of diabetic retinopathy, neuropathy, and nephropathy. In the retina, the process begins in isolated capillaries that become acellular and nonperfused, extends to groups of capillaries, and ultimately advances centripetally to involve the arterioles and their side branches (1). Both endothelial cells and pericytes are involved through a complex set of cellular and molecular abnormalities (2). In addition to the cellular defects, functional vascular abnormalities involving retinal blood flow, vascular permeability, and rheological perturbation have been well documented (3). When capillary occlusion is extensive, it is responsible for retinal ischemia, which triggers an angiogenic response. In contrast, the arteriogenic response triggered by myocardial or lower limb ischemia is decreased in diabetic patients (4). This dual response to ischemia in diabetic patients has been called "the diabetic paradox" (5). It therefore remains unclear whether hyperglycemia has a direct stimulatory or an inhibitory role on ongoing angiogenesis and arteriogenesis.

Angiogenic response to tissue ischemia recapitulates many aspects of embryonic vessel development (6). Ischemia, via hypoxia-inducible transcription factors (HIF-1{alpha} and -2{alpha}), triggers a coordinated response of angiogenesis and arteriogenesis by inducing the expression of growth factors, such as the vascular endothelial growth factor (VEGF), the angiopoietins, and the transforming growth factor-ß1 (TGF-ß1) and their receptors, and by decreasing expression of natural inhibitors (e.g., thrombospondin-1, pigment epithelium-derived factor).

Few animal models have been developed to study the effects of hyperglycemia on ongoing physiological angiogenesis. In a murine model of short-term in vitro culture of embryos, it has been shown that hyperglycemia affects VEGF/VEGF receptor signaling pathways, causing arrest of vascular development at the primary capillary plexus stage in the yolk sac (7).

The chicken chorioallantoic membrane (CAM) assay is a well-established model of angiogenesis that can be used to test pro- and antiangiogenic conditions and molecules (810). The allantois is an extraembryonic membrane, composed of endoderm and mesoderm, in which primitive blood vessels begin to take shape on day 3 of incubation. Primitive vessels continue to proliferate into an arteriovenous system until day 8, and the vascular system attains its final arrangement on day 18, just before hatching. The main function of CAM is to mediate gas exchanges with the outer environment.

The CAM model has several advantages over mammalian models. The vascular system of CAM is directly accessible to observation and experimentation, and there are no metabolic or hormonal influences from the mother. In addition, it is a more physiological model than in vitro models because vascularization of CAMs is subject to regulations through fluxes, pressure, shear stress, growth factors, and so on. Furthermore, in contrast to mammalian models of embryonic development, there is no external (i.e., maternal) influence.

In this study, we used the CAM model to study the direct effects of hyperglycemia on physiological embryonic angiogenesis, specifically on vascular cell apoptosis and proliferation and on expression of vascular growth factors.


    RESEARCH DESIGN AND METHODS
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Fertilized White Leghorn chicken eggs were incubated at 37.9°C in a humidified atmosphere (>60% relative humidity). By day 3 postincubation, 2 ml albumin was aspirated through a small hole pricked in the shell and a 2–3 cm2 window was opened in the shell. The window was sealed with adhesive tape.

Hyperglycemia was induced by a single, intravitellus injection of 5 mg/g whole egg glucose by day 8 postincubation. This age was chosen because it corresponds to the end of organogenesis. When injected earlier, such as on day 6 postincubation, or at a higher dosage, glucose was lethal (>90% deaths by day 2 postinjection; data not shown). Control embryos received either mannitol (osmotic control) or water (volumic control).

Glucose (Fluka, Buchs, Switzerland) was injected as a 30% (wt/vol) solution in water (5 mg/g egg). Mannitol (Fluka) was injected as a 20% (wt/vol) solution in water (2 mg/g egg). Water-injected embryos received a 1-ml injection of sterile water. In some experiments, water-injected embryos were compared with embryos incubated in the same conditions but left uninjected (untreated embryos). Blood glucose levels were measured on blood samples taken from a CAM vessel using a One Touch Profile reflectancemeter (Lifescan, Milpitas, CA)

Plasma osmolarity.
Plasma osmolarity was measured using a freezing point osmometer (Roebling, Berlin, Germany) on 50- or 100-µl plasma samples in duplicate. In water-injected embryos, plasma osmolarity was 275 ± 6 mOsm/l (n = 10) by day 7 postinjection. In embryos treated with 2 mg/g mannitol, plasma osmolarity was 288 ± 4 mOsm/l (n = 5), similar to that observed in glucose-treated embryos with plasma glucose levels of 12 mmol/l (286 ± 3 mOsm/l; n = 3).

Plasma insulin levels.
Plasma insulin was assayed as previously described using a guinea pig anti-porcine antibody and chicken insulin as the standard and tracer (11) in triplicate on pools of 900 µl plasma obtained from 1–3 embryos.

Evaluation of CAM vessels.
Embryos were injected through a CAM vessel with 10–100 µl of 20 mg/ml 70-kDa fluoresceinated dextran (Sigma, St. Louis, MO) in PBS. The vessels were observed with a MZ FLIII Leica stereomicroscope, and digitalized pictures were taken with a Coolsnap digital camera (Roper Scientific, Trenton, NJ). Based on the centripetal ordering method of microvascular mapping of the first two orders of pre- and postcapillary microvessels, with the capillaries serving as the initial point of reference (12), first- and second-order centripetal blood vessels (Fig. 3A) were manually counted, as previously described (10), on a quarter of the digitalized picture (i.e., in a zone consisting of ~50 first-order vessels and 20 second-order vessels). All observations were made blinded of the treatment group and postinjection day.



View larger version (57K):
[in this window]
[in a new window]
 
FIG. 3. Assessment of CAM blood vessels. CAM vessels were counted on digitalized pictures taken after an intravitellus injection of 70-kDa fluoresceinated dextran. A: Representative angiography obtained after an intravitellus injection of 70-kDa fluoresceinated dextran in a glucose-injected embryo 5 days after a single, intravitellus glucose injection at day 8 postincubation. Dashed lines surround acapillary zones, and asterisks show diffusions of the dye. Based on the centripetal ordering method of microvascular mapping of the first two orders of pre- and postcapillary microvessels, with the capillaries serving as the initial point of reference, first-order vessels are numbered "1" and second-order vessels are numbered "2." B: Assessment of CAM blood vessels. At least five embryos per group were evaluated 1–7 days (D1-D7) after a single, intravitellus injection of 5 mg/g egg glucose ({blacksquare}), 2 mg/g egg mannitol (), or 1 ml water ({square}) at day 8 postincubation. Results are expressed as the percent (means ± SD) of the mean value observed in control, water-injected embryos. The decrease in the number of first- and second-order vessels in glucose-injected embryos compared with those of water- and mannitol-injected control embryos became significant by day 5. *P = 0.05; **P = 5.10-3; ***P = 10-3.

 
Histology.
Tissues were fixed for 2 h in 4% paraformaldehyde and processed for paraffin embedding. Next 7-µm thick sections were cut, as previously described (13). Endothelial cells were stained using biotin-labeled Sambucus nigra lectin (1/3,000; Vector, Burlingame, CA) (14). For the study of apoptosis, CAMs were fixed overnight in 4% paraformaldehyde at 4°C, dehydrated in graded alcohol, cleared in xylene, and embedded in paraffin. For the study of proliferation by the evaluation of bromo-deoxyuridine (BrdU) incorporation (see below), CAMs were fixed in 3% acetic acid in absolute ethanol for 1 h, dehydrated, cleared in xylene, and embedded in paraffin. Analyses of histological samples were performed by two independent observers who were blinded to groups and time after treatment.

Islets of Langerhans were stained using guinea pig anti-porcine insulin (1/300; Dako, Glostrup, Denmark) and rabbit anti-glucagon 1/2,000 (ICN) primary antibodies, biotinylated goat anti-rabbit immunoglobulin 1/200 secondary antibodies (Vector), a Vectastain ABC kit (Vector), and diaminobenzidine.

In situ hybridization.
In situ hybridization was performed as previously described on paraffin sections (13). The antisense and sense probes used, cEPAS, cVEGF, and Quek-I, have been previously described (15,16). Probes for chicken-angiopoietin-1, chicken-angiopoietin-2 (17), and their receptor tie-2 (18) were generated after cloning of cDNA in PCR II, using the Topo cloning kit (Invitrogen). PCR amplification of whole embryo cDNA obtained from a 10-day-old embryo was performed, using the following primers: angiopoietin-1: 5'-TGGAACATGTATGGAAAAC-3', forward, and 5'-CTCCCAGACACT-3', reverse; tie-2: 5'-GAAGAAGATGCAGTGATCTAC-3', forward, and 5'-GAAGTTATGTCCACTGTTTGT, reverse; angiopoietin-2: 5'-GATTTCTGTTCAGACCAACGAG-3', forward, and 5'-CAGGATTATCTTAAGAACGTAGC-3', reverse (17,19); fibroblast growth factor-2 (FGF-2): 5'-TTCTTCCTGCGCATCAAC-3', forward, and 5'-CGATAGCTCGTCCAG-3', reverse.

Electron microscopy.
Samples were fixed in gluteraldehyde (Sigma) 2.5% in 0.1 mol/l cacodylate buffer (pH 7.4) for 2 h at 4°C. Samples were then rinsed for 10 min three times in cacodylate buffer and overnight in 0.2 mol/l sucrose (Merck) in cacodylate buffer. Samples were postfixed in 1% osmic acid in cacodylate buffer for 1 h at 4°C. Samples were then dehydrated in graded alcohol and embedded in Epon.

Apoptosis.
Apoptotic cells were stained using the transferase-mediated deoxyuridine triphosphate nick-end labeling (TUNEL) technique. Sections were treated with 5 µg/ml proteinase K (Roche, Basel, Switzerland) for 8 min at room temperature. The TUNEL reaction was performed for 1 h at 37°C in a humidified chamber, using 0.5 nmol biotin-labeled deoxyuridine triphosphate (Enzo, New York, NY) and 12.5 units of recombinant terminal-deoxynucleotide-transferase (Invitrogen, Cergy Pontoise, France).

Proliferation.
BrdU (10 µmol/l; Roche) was laid onto the CAM in two siliconized rings, 25 µl each, overnight, as previously described (9). Detection was performed using the BrdU detection kit (Roche) according to the manufacturer’s instructions, with the anti-BrdU antibody at a 1:50 dilution. The second antibody was polyclonal antimouse antibody made in horse (Vector).

Semiquantitative RT-PCR.
For RNA extraction, CAMs were snap-frozen in liquid nitrogen and stored at -80°C. Total RNA was extracted using the RNeasy mini kit (Qiagen, Valencia, CA). First-strand cDNA was synthesized on 1 µg total RNA using 200 units of Moloney murine leukemia virus RT (Invitrogen) and 10 pmol random hexamer primers. Semiquantitative PCR was performed using 1/20th of the RT reaction with a QuantumRNA Classic 18S kit (Ambion, Austin, TX) according to the manufacturer’s instructions. Primers and hybridization temperatures were as follows: FGF-2: TTCTTCCTGCGCATCAAC, GGATAGCTTTCTGTCCAG, 54°C; HIF-2{alpha}-endothelial PAS domain protein (EPAS): CCGAGCGTGACTTCTTCATGAGG, GCTCATCGTCAACAGGTGTGGCT, 56°C; cVEGF: ATGAACTTTCTGCTCACTTG, TCACCGTCTCGGTTTTTCAC, 58°C; chicken-angiopoietin-2 : GATTTCTGTTCAGACCAACGAG, CAGGATTATCTTAAGAACGTAGC, 56°C; and chicken-angiopoietin-1: TGGAACATGTGATGGAAAAC, CCTTAGAACAGAGGGTAATTAGAG, 58°C. PCR products were run on 1 or 2% agarose gels and quantified using a Biorad Phosphorimager and the Quantify One software (Biorad, Hercules, CA).

Statistical analysis.
Data are given as means ± SD and were with Statview software. The independent effects of treatment groups and time were analyzed by ANOVA when variable distributions were normal. Otherwise, the nonparametric Kruskal-Wallis test was used. Results were considered significant at P < 0.05. Categorical parameters were evaluated with Fisher’s exact test.


    RESULTS
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Induction of hyperglycemia in chicken embryos.
As shown in Fig. 1, blood glucose levels were not different between water- and mannitol-injected embryos throughout the period of observation, up to 7 days postinjection. By day 7 postinjection, blood glucose levels were similar in water-injected and untreated embryos (5.2 ± 1.2 mmol/l [n = 63] and 5.6 ± 0.8 mmol/l [n = 12]). Hyperglycemia was induced in embryos injected with glucose (Fig. 1). Blood glucose levels were significantly higher in the glucose group than in the water and mannitol groups throughout the whole period of observation (glucose effect P < 10-4 vs. water- or mannitol-injected embryos, by ANOVA). Although blood glucose values decreased throughout the period of observation in glucose-injected embryos, they were significantly higher in glucose-injected embryos as compared with control embryos at every day postinjection (P = 2.10-4 at day 1 and P < 10-4 at days 2–7 postinjection) (Fig. 1). However, because blood glucose levels varied to some extent in glucose-injected embryos, with some having blood glucose levels similar to those observed in mannitol- or water-injected embryos, only embryos with a blood glucose level >10 mmol/l were considered as hyperglycemic in the following experiments. Considering only those embryos, the blood glucose levels of glucose-injected embryos were as follows: day 1: 15 ± 6.8 mmol/l (n = 8/12); day 2: 12.4 ± 2.5 mmol/l (n = 42/74); day 3: 12.4 ± 2.0 mmol/l (n = 36/57); day 4: 12.3 ± 2.0 mmol/l (n = 22/59); day 5: 13.1 ± 3.2 mmol/l (n = 29/75); day 6: 12.4 ± 3.3 mmol/l (n = 45/167); and day 7: 12.2 ± 3.1 mmol/l (n = 39/152).



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 1. Blood glucose levels in chicken embryos. Whole-blood glucose levels were measured on blood samples taken from a CAM vessel, 1–7 days (D1-D7) after a single, intravitellus injection of glucose ({blacksquare}), mannitol ({blacksquare}), or water ({square}) at day 8 postincubation. Results are shown as means ± SD. *P = 2.10-4; **P < 10-4 for the day-to-day comparison between glucose-injected and control embryos.

 
Plasma insulin levels and morphology of the pancreas.
Plasma insulin levels were measured by day 7 postinjection in pools of plasma obtained from one to three embryos. The level of plasma insulin was 17 ± 1 µU/ml in water-injected embryos (n = 2; plasma glucose level 8.3 mmol/l), 17 ± 2 µU/ml in mannitol-injected embryos (n = 4; plasma glucose level 8.7 mmol/l), and 31 ± 5 µU/ml in glucose-injected embryos (n = 4; plasma glucose level 14.7 mmol/l) (P = 0.04).

After staining pancreatic tissue sections with antiinsulin and anti-glucagon antibodies, absolute numbers and relative proportions of pancreatic {alpha}- and ß-cells were found to be highly variable from one section to the other in all the studied groups. At least four sections were evaluated per pancreas (range four to eight). No difference was seen among the different groups by day 7 postinjection (n = 6 in each group) with regards to absolute numbers of {alpha}- and ß-cells or relative proportions.

Growth curve of the embryos.
As shown in Fig. 2, the growth curves of water- and mannitol-injected embryos were similar. By day 7 postinjection, the weight of water-injected embryos (9.8 ± 1.7 g; n = 27) was similar to that of untreated embryos (9.1 ± 1 g; n = 12). The weight of glucose-injected, hyperglycemic embryos was decreased compared with that of mannitol- or water-injected embryos (group effect P < 10-4 by two-way ANOVA). The weight of glucose-injected embryos became significantly lower than that of control embryos by day 2 postinjection, and the weight difference between glucose- and control-injected embryos was maximal at day 7 postinjection. At day 7, the weight of glucose-injected embryos was 5.7 ± 0.9 g (n = 24) vs. 9.8 ± 1.7 g (n = 27) and 10.8 ± 1 g (n = 18) for water- and mannitol-injected embryos, respectively (P < 10-4).



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 2. Weight of embryos. Embryos were weighed 1–7 days (D1-D7) after a single, intravitellus injection of glucose ({blacksquare}), mannitol (), or water ({square}) at day 8 postincubation. Results are shown as means ± SD. Day-to-day intergroup comparisons became significant by day 2. *10-3< P < 10-2; **10-3 < P < 10-4.

 
Assessment of CAM blood vessels.
CAM vessels were angiographically assessed after injection of 70-kDa fluoresceinated dextran. At least 5 embryos per group were evaluated (range 5–17) every day through day 7 postinjection after glucose or control injection. Hyperglycemia significantly decreased angiogenesis in the CAM, reaching ~30% from day 5 to day 7 (Fig. 3B). In glucose-injected animals, at day 5, the number of first- and second-order vessels was 67 ± 30% (n = 10) that of water-injected embryos, as compared with 100 ± 16 (n = 9) and 93 ± 15% (n = 6) in water-and mannitol-injected embryos, respectively (P = 0.05, Kruskal-Wallis test). At day 6, the percent changed in glucose-injected embryos to 67 ± 25% (n = 11) vs. 100 ± 9 (n = 14) and 88 ± 14% (n = 5) in water- and mannitol-injected embryos, respectively (P = 0.005). At day 7, the percent was 70 ± 20% (n = 11) in glucose-injected embryos vs. 100 ± 16 (n = 13) and 88 ± 12% (n = 5) in water- and mannitol-injected embryos, respectively (P = 0.0009). Not only was the number of vessels reduced in glucose-injected embryos, but also their appearance was abnormal. Circulating microthrombi were sometimes observed, and thrombosis of arteries was frequently observed. Acapillary zones were frequently observed accompanied by leakage of the 70-kDa fluoresceinated dextran. (Fig. 3A).

Lectin staining.
The average diameter of subectodermal arteries was measured after they were stained with Sambucus nigra agglutinin at days 2–4 postinjection (14) (Fig. 4A). At least 20 subectodermal arteries, corresponding to first- and second-order vessels on angiographies using fluoresceinated dextran, were evaluated per CAM. The diameter of arteries was measured on digitalized pictures (magnification x250). Arbitrary units, corresponding to the number of pixels of the measured diameter, were used. The average diameter decreased, although not statistically significantly so, at day 3 after glucose injection (P = 0.08 for glucose versus water or mannitol; n = 5 in each group) and became significant by day 4 (P = 0.01; n = 5 in each group) (Fig. 4B).



View larger version (71K):
[in this window]
[in a new window]
 
FIG. 4. CAM vessels stained with Sambucus nigra lectin. A: CAM section stained with biotin-labeled Sambucus nigra lectin. The ectodermal capillary network is indicated with arrowheads. The diameter of subectodermal arteries (arrows) was measured in control and glucose-injected, hyperglycemic embryos (B). A major artery (asterisk), deep in the mesoderm, is surrounded by unstained veins and lymphatic vessels. B: The mean diameter of subectodermal vessels (corresponding to first- and second-order vessels; see legend to Fig. 3) was evaluated on CAM sections after staining endothelial cells with Sambucus nigra lectin in embryos injected by day 8 postincubation with 5 mg/g egg glucose ({blacksquare}; n = 5), 2 mg/g egg mannitol ( n = 5), or 1 ml water ({square}; n = 5). Results are expressed as the percent (means ± SD) of the mean value in control, water-injected embryos. *P = 0.01. D, day.

 
Apoptosis.
Apoptosis was evaluated on CAMs using TUNEL staining. Sections were evaluated for the presence of apoptotic cells in the endothelium of medium and big arteries, as it was not possible in the ectoderm to ascertain whether a stained cell was a capillary endothelial cell or an ectodermal cell (Fig. 5). Apoptotic endothelial cells were observed more frequently in glucose-injected embryos. By day 2 posttreatment, apoptotic cells were observed in two of six glucose-injected embryos compared with none in five in both water-and mannitol-injected embryos (P = 0.09). By day 3, the figures were five of five in glucose-injected, zero of five in water-injected, and two of five in mannitol-injected embryos (P = 0.04), and by day 4, were four of six in glucose-injected, one of five in water-injected, and none of five in mannitol-injected embryos (P = 0.05).



View larger version (124K):
[in this window]
[in a new window]
 
FIG. 5. Apoptosis in CAM vessels after staining with TUNEL. Apoptosis in the CAMs was studied using the TUNEL method, as described in RESEARCH DESIGN AND METHODS. The figure shows mesodermal vessels with apoptotic endothelial cells (arrow) and an apoptotic pericyte (arrowhead).

 
Electron microscopy.
By day 3 after glucose injection, the microvascular ectodermal network appeared altered in glucose-injected embryos (Fig. 6). Occluded capillaries were observed. Indications suggesting that endothelial cells were undergoing an apoptotic process were observed in microvessels and in arteries, such as condensed nuclei and vacuolation of the cytoplasm.



View larger version (118K):
[in this window]
[in a new window]
 
FIG. 6. Electron microscopy. CAM samples from an untreated embryo (A) or embryos treated with water (B, D, and E) or glucose (C and F) were taken 3 days postinjection and observed using electron microscopy. Capillaries of the ectoderm are presented in A, B, and C. Occluded capillaries were observed in glucose-injected embryos. Arteries of the mesoderm are presented in C and D. Endothelial cells presenting extensive vacuolization (arrows) were observed in glucose-injected embryos. EC, endothelial cells; PC, pericytes. Original magnification: A and D: x3,600; B and C: x4,600; E and F: x2,800.

 
Proliferation.
The proliferation of endothelial cells was evaluated 2 and 3 days posttreatment in all conditions after overnight treatment with 25 µl BrdU (Fig. 7). Staining levels were classified as low and irregular or normal. By day 2 posttreatment, the proliferation was low and irregular in four of five glucose-injected embryos, and one of five of both water- and mannitol-injected embryos (P < 0.01); by day 3 the proportions were five of five, none of five, and two of five, respectively (P = 0.01).



View larger version (150K):
[in this window]
[in a new window]
 
FIG. 7. Proliferation. Embryos were treated for 12 h with BrdU directly applied onto the CAM. CAM sections were stained using anti-BrdU as described in RESEARCH DESIGN AND METHODS. The figure shows an area of high proliferation (A) taken from a control, water-injected embryo and an area with nearly no detectable proliferation (B) taken from a hyperglycemic, glucose-injected embryo.

 
In situ hybridization.
Evaluation of the expression of mRNA was performed using in situ hybridization at days 1–4 postinjection. The expression level of the following mRNAs was evaluated on five embryos per group: VEGF and its receptor VEGF-R2, HIF-2{alpha}-EPAS-1, angiopoietin 1, angiopoietin 2, and the angiopoietin receptor, tie 2. No differences in the expression level were found for any of these probes (Figs. 8 and 9).



View larger version (126K):
[in this window]
[in a new window]
 
FIG. 8. In situ hybridization. The expression pattern of VEGF-R2, angiopoietin 1 (Ang-1), angiopoietin 2 (Ang-2), the angiopoietin receptor tie-2, and HIF-2{alpha} was evaluated using in situ hybridization as described in RESEARCH DESIGN AND METHODS. For each probe, the same field is presented in a bright and dark field. Upper panel: An in situ hybridization using the VEGF-R2 antisense probe in a water-treated embryo at low magnification. Lower panel: The pattern of expression of the different probes in the wall of mesodermal arteries in water-injected control and glucose-injected hyperglycemic embryos at day 3 postinjection.

 


View larger version (124K):
[in this window]
[in a new window]
 
FIG. 9. In situ hybridization of VEGF. The expression pattern of VEGF, evaluated using in situ hybridization, in control, water-injected, and glucose-injected hyperglycemic embryos at days 1–4 (D1-D4) postinjection. Upper panel: An in situ hybridization using the VEGF antisense probe in a water-treated embryo at day 3 postinjection at low magnification. Lower panel: The pattern of expression of the different probes in the ecto-mesodermal capillary network. The same field is presented in a bright and dark field.

 
Semiquantitative RT-PCR.
The expression level of the main vascular growth factor VEGF and FGF-2, angiopoietin-1, angiopoietin-2, and HIF-2{alpha}-EPAS was evaluated on the CAMs using a semiquantitative RT-PCR assay, on three to five samples per group taken at days 1–4 after glucose injection. As shown in Fig. 10, no consistent significant difference was observed for any of the studied growth factors at any time following treatment.



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 10. Semiquantitative RT-PCR. The expression levels of mRNA coding for HIF-2{alpha}-EPAS-1, VEGF, angiopoietin-1(Ang-1), angiopoietin-2 (Ang-2), and FGF-2 were evaluated by semiquantitative RT-PCR, as described in RESEARCH DESIGN AND METHODS, in embryos injected with 5 mg/g egg glucose ({blacksquare}), 2 mg/g egg mannitol (), or 1 ml water ({square}). Results are expressed as the percent (means ± SD) of the mean value in control, water-injected embryos. At any time point, three to five samples were studied in each group. No significant differences were observed between the glucose and control groups for any of the studied factors. Ethidium bromide-stained agarose gels are shown for each tested growth factor. For VEGF, the primers amplify all isoforms of VEGF; quantification was performed on the lowest molecular weight isoform, VEGF-122. A semiquantitative RT-PCR for FGF-2 performed 3 days posttreatment in embryos treated with glucose (G), water (H), or mannitol (M) (n = 3 in each group) is also shown.

 

    DISCUSSION
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although the effect of hyperglycemia on angiogenesis is often presented as a stimulatory one, on the basis of what is observed in the late phase of diabetic retinopathy, defective angiogenesis has been observed in different models such as wound healing (20,21), embryonic growth (7,22), and transplantation of avascular islets of Langerhans (23). In diabetic patients and in rodent models of diabetes, collateral vessel development, in response to coronary vessel occlusion, has been shown to be impaired by hyperglycemia (4). There are, however, few models to study the direct effect of hyperglycemia on physiological angiogenesis. In the mouse model, embryos from a diabetic mother or embryos cultured in vitro in a diabetic milieu show impaired angiogenesis (7,22). In the model we used, a short-term, modest hyperglycemia without hypoinsulinemia was found to decrease embryonic angiogenesis in vivo. This effect was not mediated by alterations in the pattern or level of expression of vascular growth factors or their receptors. Instead, we found that hyperglycemia decreased the proliferation rate of endothelial cells and induced apoptosis of endothelial cells.

Compared with in vitro models (i.e., cell cultures of endothelial or vascular smooth muscle cells), the CAM model has the advantage of being subject to regulations involving growth factors, vascular flux, and blood pressure. Compared with mammalian models, there is no influence of factors coming from the mother. A possible therapeutic intervention may thus be through administration of antioxidant molecules or regulatory peptides (10).

In the present study, defective angiogenesis in response to high glucose was seen, even though we observed a normal level and pattern of VEGF expression as well as that of other major vascular growth factors and their receptors using morphological evaluation with in situ hybridization and/or semiquantitative RT-PCR.

The expression level of VEGF, the major vascular growth factor, has been found to be decreased by hyperglycemia in models where impaired angiogenesis was observed (7,20,21,24,25) and in fibroblasts isolated from diabetic embryos (26). The expression level of VEGF was found to be unaltered by hyperglycemia in other models (27,28) and increased at sites of aberrant angiogenesis in diabetic patients, particularly in the retina of diabetic patients with proliferative diabetic retinopathy (29). In the retina, the increased expression of VEGF was observed within 1 week after the induction of diabetes in animal models (30,31). However, a retinal gene expression profile using cDNA microarray found no significant increase of VEGF at days 3, 7, or 21 after the induction of hyperglycemia in a rat model (32). The direct effect of hyperglycemia on VEGF expression thus remains uncertain. The main regulators of VEGF expression are hypoglycemia and hypoxia, both acting through HIF nuclear factors. The main regulation of HIF-1{alpha} is at the protein level through a pathway involving the proline hydroxylases and von Hippel Lindau proteins (33). We have studied the expression level of HIF-2{alpha}-EPAS-1 mRNA rather than that of HIF-1{alpha} mRNA because in chicken embryo, expression of the HIF-2{alpha}-EPAS-1 gene is more extensively regulated than that of the HIF-1{alpha} (34). It has recently been shown that glucose can directly induce HIF-1{alpha} degradation via a proteasomal pathway (35) and that HIF-2{alpha}-EPAS-1 might be more involved in the response to hypoglycemia than to hypoxia (36). Hyperglycemia is thus expected to lead to decreased expression of VEGF through increased degradation of HIF proteins. However, there are many other pathways of HIF-1{alpha} regulation, including pathways involving insulin and IGF-I, and VEGF expression is also regulated by many cytokines and growth factors. In this regard, our model of hyperglycemia was characterized by hyperinsulinemia, rather than insulin deficiency, which is closer to the common state of insulin-treated diabetic patients than rodent models that are characterized by profound insulin deficiency. In our model, hyperinsulinemia may have counterbalanced the negative effects of hyperglycemia on HIF degradation (37,38). The influence of hyperglycemia on the expression of the angiopoietins has been studied only in a model of wound healing in mice, where a modest induction of angiopoietin 1 mRNA was observed, with no increase in the protein level, as compared with normal embryos (20). Angiopoietin 2 expression levels were similar in the early phase to those observed in control embryos (20). The effect of hyperglycemia on the expression of FGF-2 has been studied in rats (39). FGF-2 expression was increased in the retina, but not in the other tissues studied, and insulin treatment normalized the expression of FGF-2 in this model. Although the evidence from the literature suggests that the lack of significant alteration in the expression pattern of vascular growth factors we observed is plausible, our observations may have been hampered by insufficient statistical power. We can, however, exclude a major effect. Variations in other, unstudied growth factors might also have been involved.

Our results point to a hyperglycemia-induced defect in endothelial cell proliferation and an increase in apoptosis rather than to defects in the expression level of growth factors. Hyperglycemia-induced apoptosis has been observed in vitro on many endothelial cell types and in vivo in animal models of diabetes and the retinas of diabetic patients (40,41). The mechanisms by which hyperglycemia induces apoptosis are not fully characterized. It has been shown that in pericytes, but not in endothelial cells, apoptosis is the consequence of nuclear factor-{kappa}B activation (42). In vitro, the effector mechanism of increased apoptosis in endothelial cells has been shown to be the direct activation of caspases (41), an event that was prevented in vitro by incubation with an activator of AMP-kinase (43). It has been shown in vitro that hyperglycemia decreases endothelial cell proliferation (44) and that endothelial progenitor cells isolated from diabetic patients exhibit impaired proliferation, adhesion, and incorporation into vascular structure (45).

Our results indicate that short-term hyperglycemia can decrease angiogenesis without altering the expression of major vascular growth factors and their regulators. This antiangiogenic effect of hyperglycemia seems to be mediated by direct proapoptotic and antiproliferative effects of hyperglycemia on endothelial cells. Our results may account for some recent clinical observations. For example, in diabetic patients, collateral vessel development is impaired after coronary artery occlusion (4). Strict control of hyperglycemia, using insulin infusions, improves mortality in patients with type 2 diabetes by ~40% (46). Although an effect of insulin-glucose-potassium infusion on arrhythmic episodes has been hypothesized to account for this improved prognosis, improved collateral development through euglycemia and insulin infusion may have contributed to these results.


    ACKNOWLEDGMENTS
 
During this work, E.L. was supported by a grant from l’Association Française des Diabétiques and Association Diabète Risque Vasculaire.

We thank Marie-Thérèse Morin and Françoise Mongiat for expert assistance with histology and electron microscopy, Nicole Rideau (INRA, Nouzilly) for performing the insulin assay, and Judith Favier for help with molecular biology.

Address correspondence and reprint requests to Etienne Larger, MD, INSERM U36, Collège de France, 11 pl. M. Berthelot, F-75005 Paris, France. E-mail: etienne.larger{at}college-de-france.fr

Received for publication July 2, 2003 and accepted in revised form November 13, 2003

Abbreviations: BrdU, bromo-deoxyuridine; CAM, chorioallantoic membrane; FGF-2, fibroblast growth factor-2; HIF, hypoxia-inducible transcription factor; EPAS, endothelial PAS domain protein; TGF-ß1, transforming growth factor-ß; TUNEL, transferase-mediated deoxyuridine triphosphate nick-end labeling; VEGF, vascular endothelial growth factor


    REFERENCES
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Engerman RL, Kern TS: Retinopathy in animal models of diabetes. Diabetes Metab Rev11 :109 –120,1995[Medline]
  2. Lorenzi M, Gerhardinger C: Early cellular and molecular changes induced by diabetes in the retina. Diabetologia44 :791 –804,2001
  3. Candido R, Allen TJ: Haemodynamics in microvascular complications in type 1 diabetes. Diabetes Metab Res Rev18 :286 –304,2002[Medline]
  4. Abaci A, Oguzhan A, Kahraman S, Eryol N, Unal S, Arinç H, Ergin A: Effect of diabetes mellitus on the formation of coronary collateral vessels. Circulation99 :2239 –2242,1999[Abstract/Free Full Text]
  5. Duh E, Aiello LP: Vascular endothelial growth factor and diabetes: the agonist versus antagonist paradox. Diabetes48 :1899 –1906,1999[Abstract]
  6. Carmeliet P: Mechanisms of angiogenesis and arteriogenesis. Nat Med6 :389 –395,2000[Medline]
  7. Pinter E, Haigh J, Nagy A, Madri JA: Hyperglycemia-induced vasculopathy in the murine conceptus is mediated via reductions of VEGF-A expression and VEGF receptor activation. Am J Pathol158 :1199 –1206,2001[Abstract/Free Full Text]
  8. Ribatti D, Vacca A, Roncali L, Dammacco F: The chick embryo chorioallantoic membrane as a model for in vivo research on angiogenesis. Int J Dev Biol40 :1189 –1197,1996[Medline]
  9. Cruz A, Parnot C, Ribatti D, Corvol P, Gasc JM: Endothelin-1, a regulator of angiogenesis in the chick chorioallantoic membrane. J Vasc Res38 :536 –545,2001[Medline]
  10. Celerier J, Cruz A, Lamande N, Gasc JM, Corvol P: Angiotensinogen and its cleaved derivatives inhibit angiogenesis. Hypertension39 :224 –228,2002[Abstract/Free Full Text]
  11. Ruffier L, Simon J, Rideau N: Isolation of functional glucagon islets of Langerhans from the chicken pancreas. Gen Comp Endocrinol112 :153 –162,1998[Medline]
  12. DeFouw DO, Rizzo VJ, Steinfeld R, Feinberg RN: Mapping of the microcirculation in the chick chorioallantoic membrane during normal angiogenesis. Microvasc Res38 :136 –147,1989[Medline]
  13. Sibony M, Commo F, Callard P, Gasc JM: Enhancement of mRNA in situ hybridization signal by microwave heating. Lab Invest73 :586 –591,1995[Medline]
  14. Nanka O, Peumans WJ, Van Damme EJ, Pfuller U, Valasek P, Halata Z, Schumacher U, Grim M: Lectin histochemistry of microvascular endothelium in chick and quail musculature. Anat Embryol (Berl)204 :407 –411,2001[Medline]
  15. Favier J, Kempf H, Corvol P, Gasc J: Cloning and expression pattern of EPAS1 in the chicken embryo: colocalization with tyrosine hydroxylase. FEBS Lett462 :19 –24,1999[Medline]
  16. Ribatti D, Cruz A, Nico B, Favier J, Vacca A, Corsi P, Roncali L, Dammacco F: In situ hybridization and immunogold localization of vascular endothelial growth factor receptor-2 on the pericytes of the chick chorioallantoic membrane. Cytokine17 :262 –265,2002[Medline]
  17. Mezquita J, Mezquita B, Pau M, Mezquita C: Characterization of a novel form of angiopoietin-2 (Ang-2B) and expression of VEGF and angiopoietin-2 during chicken testicular development and regression. Biochem Biophys Res Commun260 :492 –498,1999[Medline]
  18. Moyon D, Pardanaud L, Yuan L, Breant C, Eichmann A: Selective expression of angiopoietin 1 and 2 in mesenchymal cells surrounding veins and arteries of the avian embryo. Mech Dev106 :133 –136,2001[Medline]
  19. Jones P, McClain J, Robinson D, Sato T, Yancopoulos GD: Identification and characterisation of chicken cDNAs encoding the endothelial cell-specific receptor tyrosine kinase Tie2 and its ligands, the angiopoietins. Angiogenesis2 :357 –364,1999
  20. Kampfer H, Pfeilschifter J, Frank S: Expressional regulation of angiopoietin-1 and -2 and the tie-1 and -2 receptor tyrosine kinases during cutaneous wound healing: a comparative study of normal and impaired repair. Lab Invest81 :361 –373,2001[Medline]
  21. Altavilla D, Saitta A, Cucinotta D, Galeano M, Deodato B, Colonna M, Torre V, Russo G, Sardella A, Urna G, Campo GM, Cavallari V, Squadrito G, Squadrito F: Inhibition of lipid peroxidation restores impaired vascular endothelial growth factor expression and stimulates wound healing and angiogenesis in the genetically diabetic mouse. Diabetes50 :667 –674,2001[Abstract/Free Full Text]
  22. Pinter E, Mahooti S, Wang Y, Imhof BA, Madri JA: Hyperglycemia-induced vasculopathy in the murine vitelline vasculature: correlation with PECAM-1/CD31 tyrosine phosphorylation state. Am J Pathol154 :1367 –1379,1999[Abstract/Free Full Text]
  23. Vasir B, Jonas JC, Steil GM, Hollister-Lock J, Hasenkamp W, Sharma A, Bonner-Weir S, Weir GC: Gene expression of VEGF and its receptors Flk-1/KDR and Flt-1 in cultured and transplanted rat islets. Transplantation71 :924 –935,2001[Medline]
  24. Rivard A, Silver M, Chen D, Kearney M, Magner M, Annex B, Peters K, Isner JM: Rescue of diabetes-related impairment of angiogenesis by intramuscular gene therapy with adeno-VEGF. Am J Pathol154 :355 –363,1999[Abstract/Free Full Text]
  25. Chou E, Suzuma I, Way KJ, Opland D, Clermont AC, Naruse K, Suzuma K, Bowling NL, Vlahos CJ, Aiello LP, King GL: Decreased cardiac expression of vascular endothelial growth factor and its receptors in insulin-resistant and diabetic states: a possible explanation for impaired collateral formation in cardiac tissue. Circulation105 :373 –379,2002[Abstract/Free Full Text]
  26. Lerman OZ, Galiano RD, Armour M, Levine JP, Gurtner GC: Cellular dysfunction in the diabetic fibroblast: impairment in migration, vascular endothelial growth factor production, and response to hypoxia. Am J Pathol162 :303 –312,2003[Abstract/Free Full Text]
  27. da Costa Pinto FA, Malucelli BE: Inflammatory infiltrate, VEGF and FGF-2 contents during corneal angiogenesis in STZ-diabetic rats. Angiogenesis5 :67 –74,2002[Medline]
  28. Mandl-Weber S, Cohen CD, Haslinger B, Kretzler M, Sitter T: Vascular endothelial growth factor production and regulation in human peritoneal mesothelial cells. Kidney Int61 :570 –578,2002[Medline]
  29. Aiello LP, Avery RL, Arrigg PG, Keyt BA, Jampel HD, Shah ST, Pasquale LR, Thieme H, Iwamoto MA, Park JE, et al: Vascular endothelial growth factor in ocular fluid of patients with diabetic retinopathy and other retinal disorders. N Engl J Med331 :1480 –1487,1994[Abstract/Free Full Text]
  30. Joussen AM, Poulaki V, Tsujikawa A, Qin W, Qaum T, Xu Q, Moromizato Y, Bursell SE, Wiegand SJ, Rudge J, Ioffe E, Yancopoulos GD, Adamis AP: Suppression of diabetic retinopathy with angiopoietin-1. Am J Pathol160 :1683 –1693,2002[Abstract/Free Full Text]
  31. Poulaki V, Qin W, Joussen AM, Hurlbut P, Wiegand SJ, Rudge J, Yancopoulos GD, Adamis AP: Acute intensive insulin therapy exacerbates diabetic blood-retinal barrier breakdown via hypoxia-inducible factor-1alpha and VEGF. J Clin Invest109 :805 –815,2002[Medline]
  32. Joussen AM, Huang S, Poulaki V, Camphausen K, Beecken WD, Kirchhof B, Adamis AP: In vivo retinal gene expression in early diabetes. Invest Ophthalmol Vis Sci42 :3047 –3057,2001[Abstract/Free Full Text]
  33. Pugh CW, Ratcliffe PJ: Regulation of angiogenesis by hypoxia: role of the HIF system. Nat Med9 :677 –684,2003[Medline]
  34. Favier J, Kempf H, Corvol P, Gasc JM: Coexpression of endothelial PAS protein 1 with essential angiogenic factors suggests its involvement in human vascular development. Dev Dyn222 :377 –388,2001[Medline]
  35. Malhotra R, Tyson DG, Sone H, Aoki K, Kumagai AK, Brosius FC 3rd: Glucose uptake and adenoviral mediated GLUT1 infection decrease hypoxia-induced HIF-1alpha levels in cardiac myocytes. J Mol Cell Cardiol34 :1063 –1073,2002[Medline]
  36. Brusselmans K, Bono F, Maxwell P, Dor Y, Dewerchin M, Collen D, Herbert JM, Carmeliet P: Hypoxia-inducible factor-2alpha (HIF-2alpha) is involved in the apoptotic response to hypoglycemia but not to hypoxia. J Biol Chem276 :39192 –39196,2001[Abstract/Free Full Text]
  37. Zelzer E, Levy Y, Kahana C, Shilo BZ, Rubinstein M, Cohen B: Insulin induces transcription of target genes through the hypoxia-inducible factor HIF-1alpha/ARNT. Embo J17 :5085 –5094,1998[Medline]
  38. Treins C, Giorgetti-Peraldi S, Murdaca J, Semenza GL, Van Obberghen E: Insulin stimulates hypoxia-inducible factor 1 through a phosphatidylinositol 3-kinase/target of rapamycin-dependent signaling pathway. J Biol Chem277 :27975 –27981,2002[Abstract/Free Full Text]
  39. Lowe WL Jr, Florkiewicz RZ, Yorek MA, Spanheimer RG, Albrecht BN: Regulation of growth factor mRNA levels in the eyes of diabetic rats. Metabolism44 :1038 ,1995[Medline]
  40. Mizutani M, Kern TS, Lorenzi M: Accelerated death of retinal microvascular cells in human and experimental diabetic retinopathy. J Clin Invest97 :2883 –2890,1996[Medline]
  41. Mohr S, Xi X, Tang J, Kern TS: Caspase activation in retinas of diabetic and galactosemic mice and diabetic patients. Diabetes51 :1172 –1179,2002[Abstract/Free Full Text]
  42. Romeo G, Liu WH, Asnaghi V, Kern TS, Lorenzi M: Activation of nuclear factor-{kappa}B induced by diabetes and high glucose regulates a proapoptotic program in retinal pericytes. Diabetes51 :2241 –2248,2002[Abstract/Free Full Text]
  43. Ido Y, Carling D, Ruderman N: Hyperglycemia-induced apoptosis in human umbilical vein endothelial cells: inhibition by the AMP-activated protein kinase activation. Diabetes51 :159 –167,2002[Abstract/Free Full Text]
  44. Lorenzi M, Cagliero E, Toledo S: Glucose toxicity for human endothelial cells in culture: delayed replication, disturbed cell cycle, and accelerated death. Diabetes34 :621 –627,1985[Abstract]
  45. Tepper OM, Galiano RD, Capla JM, Kalka C, Gagne PJ, Jacobowitz GR, Levine JP, Gurtner GC: Human endothelial progenitor cells from type II diabetics exhibit impaired proliferation, adhesion, and incorporation into vascular structures. Circulation106 :2781 –2786,2002[Abstract/Free Full Text]
  46. Malmberg K, Ryden L, Efendic S, Herlitz J, Nicol P, Waldenstrom A, Wedel H, Welin L: Randomized trial of insulin-glucose infusion followed by subcutaneous insulin treatment in diabetic patients with acute myocardial infarction (DIGAMI study): effects on mortality at 1 year. J Am Coll Cardiol26 :57 –65,1995[Abstract]

Add to CiteULike CiteULike   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
F. Facchiano, D. D'Arcangelo, K. Russo, V. Fogliano, C. Mennella, R. Ragone, G. Zambruno, V. Carbone, D. Ribatti, C. Peschle, et al.
Glycated Fibroblast Growth Factor-2 Is Quickly Produced in Vitro upon Low-Millimolar Glucose Treatment and Detected in Vivo in Diabetic Mice
Mol. Endocrinol., November 1, 2006; 20(11): 2806 - 2818.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L.-S. Fetita, E. Sobngwi, P. Serradas, F. Calvo, and J.-F. Gautier
Consequences of Fetal Exposure to Maternal Diabetes in Offspring
J. Clin. Endocrinol. Metab., October 1, 2006; 91(10): 3718 - 3724.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
T. Shoji, H. Koyama, T. Morioka, S. Tanaka, A. Kizu, K. Motoyama, K. Mori, S. Fukumoto, A. Shioi, N. Shimogaito, et al.
Receptor for advanced glycation end products is involved in impaired angiogenic response in diabetes.
Diabetes, August 1, 2006; 55(8): 2245 - 2255.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
R. Kivela, M. Silvennoinen, A.-M. Touvra, T. M. Lehti, H. Kainulainen, and V. Vihko
Effects of experimental type 1 diabetes and exercise training on angiogenic gene expression and capillarization in skeletal muscle
FASEB J, July 1, 2006; 20(9): 1570 - 1572.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
L. Pardanaud and A. Eichmann
Identification, emergence and mobilization of circulating endothelial cells or progenitors in the embryo
Development, July 1, 2006; 133(13): 2527 - 2537.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Savary, A. Michaud, J. Favier, E. Larger, P. Corvol, and J.-M. Gasc
Role of the renin-angiotensin system in primitive erythropoiesis in the chick embryo
Blood, January 1, 2005; 105(1): 103 - 110.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Larger, E.
Right arrow Articles by Gasc, J.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Larger, E.
Right arrow Articles by Gasc, J.-M.
Social Bookmarking