Diabetes 54:2844-2851, 2005 © 2005 by the American Diabetes Association, Inc. Attenuated Wnt Signaling Perturbs Pancreatic Growth but Not Pancreatic FunctionUmeå Centre for Molecular Medicine, University of Umeå, Umeå, Sweden
Mesenchymal-epithelial interactions are pivotal for proper pancreatic growth and development. We have earlier shown that the fibroblast growth factor (FGF) receptor 2 is expressed in pancreatic progenitor cells and that FGF10, the high-affinity ligand of the FGF receptor 2 isoform FGF receptor 2b, promotes expansion of pancreatic progenitors. The Wnt family of ligands, which signal to the Frizzled (Frz) type receptors, have also been shown to mediate mesenchymal-epithelial interactions and cell proliferation in a variety of different systems. Here, we show that Frz3, like FGF receptor 2, is expressed in the pancreatic epithelium during the proliferative phase of the embryonic pancreas in mice and that overexpression of a dominant-negative form of mouse Frz8 in pancreatic progenitors severely perturbs pancreatic growth. Nevertheless, the transgenic mice remain normoglycemic and display normal glucose tolerance and glucose-stimulated insulin secretion when challenged with exogenous glucose. The maintenance of normoglycemia in these mice appears to be the consequence of a relative increase in endocrine cell number per pancreatic area combined with enhanced insulin biosynthesis and insulin secretion. Collectively, our data provide evidence that Wnt signaling is required for pancreatic growth but not adult ß-cell function.
Address correspondence and reprint requests to Helena Edlund, Umeå Centre for Molecular Medicine, University of Umeå, S-901 87 Umeå, Sweden. E-mail: helena.edlund{at}ucmm.umu.se
Abbreviations: CPA, carboxypeptidase A; DAPI, 4',6 diamidino-2-phenylindole; DIG, digoxigenin; FGF, fibroblast growth factor; Frz, Frizzled; GSIS, glucose-stimulated insulin secretion; HSC, hematopoietic stem cell; LRP5, LDL receptor-related protein 5 The embryonic pancreas in mammals forms from a dorsal and ventral protrusion of the primitive gut epithelium (1). These buds grow, branch, and fuse to form the definitive pancreas, a process dependent on mesenchymal-epithelial interactions. Fibroblast growth factor (FGF) signaling has been implicated in the development of many organs that are dependent on mesenchymal-epithelial interactions, including the pancreas (2,3), and several independent studies have demonstrated that FGF signaling is critical for pancreatic growth. FGF ligands have been shown to have a stimulatory effect on pancreatic epithelial cell proliferation in vitro (4), and mice homozygous for a targeted deletion of the Fgf10 gene present with a hypoplastic pancreas due to impaired proliferation of pancreatic epithelial progenitors (5). In contrast, mice overexpressing Fgf10 under the Ipf1/Pdx1 promoter showed enhanced and persistent proliferation of pancreatic progenitors at the expense of pancreatic cell differentiation (6,7). Other factors that stimulate mesenchymal-epithelial interactions are the Wnt family of secreted glycoproteins. Wnts are expressed in a wide variety of mesenchymal tissues and have been shown to stimulate growth of several organs by signaling to epithelial cells (8). They bind to and activate members of the Frizzled (Frz) family of serpetine receptor proteins and are implicated in a variety of developmental processes such as cell differentiation, cell polarity, cell migration, and cell proliferation (9–12). Several independent studies have demonstrated a key role for Wnt signaling in cell proliferation. During development, Wnt signaling is required in the entire nervous system for expanding the progenitor cell population by simultaneously promoting cell proliferation and blocking apoptosis and differentiation (13). Studies in colorectal cancer cell lines and in transgenic mice in which Dkk1, a Wnt antagonist, is ectopically expressed have also demonstrated an essential role of Wnt signaling in the maintenance of intestinal stem cells by promoting proliferation and blocking differentiation (14–16). In addition, Wnt signaling promotes self-renewal of hematopoietic stem cells (HSCs); blocking Wnt signaling by overexpressing Axin or by incubating the HSCs in presence of the soluble Frz8 CRD-IgG fusion protein inhibits proliferation in vitro and the ability of HSCs to reconstitute blood cells in vivo (17). Wnt ligands and Frz receptors have been found to be expressed in the pancreas of mice and humans (18,19). RT-PCR analyses have shown that Wnt 5a, 5b, 2b, 7b, and 11 as well as Frz 2-9 are expressed in the developing pancreas (18). Mice in which Wnt1 and Wnt5a are misexpressed under control of the Ipf1/Pdx1 promoter show perturbed patterning of the foregut, including the pancreatic domain (18). In Ipf1/Pdx1-Wnt1 embryos, the foregut region resembled a posterior extension of the stomach associated with complete pancreatic and splenic agenesis. Ipf1/Pdx1-Wnt5a embryos displayed decrease in mass of several structures derived from the proximal foregut, including the pancreas, spleen, and stomach, without any apparent shift in the stomach-to-duodenum boundary (18). In addition, a role of Wnt signaling in adult ß-cell function has been proposed (20). Mice that lack the gene encoding LDL receptor-related protein 5 (LRP5), a coreceptor involved in ß-catenin–dependent Wnt signaling, show impaired glucose tolerance due to perturbed glucose-stimulated insulin secretion (GSIS) (20). Here, we describe the temporal and spatial expression of Wnt4, Wnt7b, and Frz3 in the pancreas in mice during the proliferative phase, i.e., embryonic days (e) 10–15. We also show that overexpression of a Frz8 CRD-IgG fusion protein, which functions as a Wnt signaling antagonist by inhibiting the binding of Wnt proteins to the Frz receptors (17,21), in the developing pancreatic epithelium in mice leads to grossly reduced pancreatic mass, suggesting a role for Wnt signaling in pancreatic epithelial cell proliferation. We also provide evidence that perturbation of Wnt signaling, via the expression of the Frz8 CRD domain in adult ß-cells, does not affect adult ß-cell function.
Generation and genotyping of transgenic mice. The Frz8CRD-IgG cDNA (21) (generous gift from Dr. J. Nathans) was cloned after the Ipf1/Pdxl promoter and followed by a SV40 polyA site. Transgenic mice were generated by pronuclear injection of the purified fragment (1.8 ng/ml) into F2 hybrid oocytes from B6/CBA parents (M&B A/S) as described previously (22). The genotype was determined by PCR analysis of genomic DNA extracted from tail biopsies using primers (from 5' to 3'): IPF1, 5'-3(GGGAAGAGGAGATGTAGACTT); FRZ8CRD, 3'(GGTTGAACTGGTTGGGCATGT). Four independent transgenic lines showed pancreatic hypoplasia, and all were used for further analysis.
In situ hybridization and immunohistochemistry.
Quantification of proliferating cells and endocrine cell types.
In vivo glucose and insulin measurements.
Quantification of mRNA levels.
Data analysis.
Wnt7b, Wnt4, and Frz3 are expressed in the pancreas. Wnts have been suggested to exert a role during early and late stages of gastrointestinal development as well as in adult islets (18–20). We used a degenerate RT-PCR approach to screen for Wnts and Frz in the mouse embryonic pancreas of stage e12 and e15. The amplicons were subcloned and sequenced to deduce the identity of each amplicon. Wnt4, wnt7b, and Frz3 were the most abundantly represented amplicons among the sequenced clones and were therefore selected for further expression analyses. Wnt4 expression was not observed in the early pancreatic progenitors (Fig. 1A). Wnt4 expression was, however, distinct in the later-appearing ngn3+ pro-endocrine cells and differentiated endocrine cells as well as the intestinal and stomach epithelia (Fig. 1B and data not shown). At later stages of development, Wnt4 expression became restricted to the islets with preferential high expression in non–ß-cells (Fig. 1C and data not shown). In agreement with previous findings, Wnt7b expression was apparent in the lung buds (29) and spinal cord (30) but not in the pancreas (18) of e10 embryos (Fig. 1D and E). By e13, Wnt7b expression was, however, expressed in the pancreatic epithelium (Fig. 1F).
In contrast to a report by Heller et al. (18), we found Frz3 to be expressed in the early e10 pancreatic buds (Fig. 1G). At this stage, the majority of the Frz3-expressing cells in the pancreatic bud coexpressed IPF1/PDX1 (Fig. 1G). A lower level of Frz3 expression was also observed in the adjacent IPF1/PDX1– mesenchyme (Fig. 1G). Frz3 expression was maintained in the developing pancreatic epithelium until e15 (Fig. 1H and data not shown) but appeared reduced and barely detectable at later stages (Fig. 1I). The temporal expression of Frz3 in the pancreatic epithelium between e10 and e15 overlaps with the major phase of pancreatic growth, implying a potential role for Wnt signaling in pancreatic epithelial cell proliferation.
The Ipf1/Frz8CRD mice show reduced pancreatic mass.
The reduction in pancreatic size observed in the Ipf1/Frz8CRD mice is due to attenuated pancreatic epithelial cell proliferation. To investigate whether the reduction in pancreatic mass displayed by the Ipf1/Frz8CRD mice reflected perturbations in initial pancreatic specification, proliferation, apoptosis, or premature differentiation, we set out to explore each of these possibilities separately. Defect pancreatic specification would reflect a role for Wnt signaling in controlling and/or mediating the molecular cues that define and/or induce the pancreatic domain along the primitive gut endoderm. If Wnt signaling is involved in the early specification of the pancreatic program, the phenotype would be evident already at e9–e10. To address this question, we performed whole-mount immunohistochemistry on transgenic (n = 5) and wild-type (n = 4) e10 embryos and compared the size of the pancreas at this stage. No obvious difference was apparent in the size of the dorsal and ventral buds of e10 transgenic versus wild-type embryos (Fig. 3A), providing evidence that the reduced pancreatic size of the Ipf1/Frz8CRD mice is not due to perturbed pancreatic specification.
Activated, intracellular Notch blocks pancreatic cell differentiation by repressing the expression of the pro-endocrine gene ngn3 (24,32). In the absence of activated Notch, pancreatic progenitor cells differentiate prematurely into the endocrine lineage at the expense of pancreatic progenitor cell expansion (24). To exclude that the reduced pancreatic size observed in Ipf1/Frz8CRD mice was the consequence of premature differentiation, we examined the expression of differentiation markers in e13 pancreases. No increase in the expression of the pro-endocrine marker ngn3 (Fig. 3A) or the endocrine marker ISL1 (data not shown) was observed, and the expression of Notch1 was indistinguishable from that observed in wild-type embryos of the same stage (Fig. 3A). Together, these data provide evidence that the reduced pancreatic size in Ipf1/Frz8CRD mice is not due to premature endocrine differentiation. To investigate whether an increase in apoptosis could explain the reduced pancreatic mass observed in the Ipf1/Frz8CRD mice, transgenic and wild-type pancreases at stages e13–17 were stained for the apoptotic marker Caspase 3. We did not find evidence of increased apoptosis in the embryonic pancreas of transgenic mice, suggesting that enhanced apoptosis did not cause the reduction in pancreatic size in the transgenic mice (data not shown). Finally, we performed immunohistochemistry using the mitotic marker phospho-Histone H3 and calculated the ratio of phospho-Histone H3+ cells over DAPI, i.e., total cell number (for all stages; transgenic, n = 4; wild type, n = 4). We detected a 25% reduction in the proliferating cells in the pancreas of e11 transgenic embryos and an even greater reduction, by 50%, at e13 (Fig. 3B). At e15, when pancreatic progenitor cell proliferation is declining also in wild-type mice, the difference in the proliferation rate was merely 20% (Fig. 3B). Taken together, these data provide evidence that the reduced size in Ipf1/Frz8CRD mice is the consequence of decreased pancreatic cell proliferation rather than perturbed specification, premature differentiation, or increased apoptosis.
The Ipf1/Frz8CRD mice display reduced levels of nonphosphorylated ß-catenin in the pancreatic epithelium.
The Ipf1/Frz8CRD mice show normal endocrine and exocrine function.
Ipf1/Frz8CRD mice are normoglycemic. Despite the drastic reduction in size, the transgenic mice did not display signs of either hyperglycemia or diabetes and showed a normal glucose tolerance when challenged with exogenous glucose (Fig. 5A). To test whether the normal glucose homeostasis in Ipf1/Frz8CRD mice reflected enhanced insulin secretion and/or glucose sensing, we monitored insulin levels in 10- to 12-week-old transgenic mice at fasted conditions and serum insulin levels in response to glucose challenge. Serum insulin levels were normal in fasted Ipf1/Frz8CRD mice, and the mice showed a normal first and second phase insulin release upon glucose challenge (Fig. 5B).
Determination of the relative insulin content in total pancreatic extracts (nanograms insulin per milligram pancreatic protein) from 12-week-old transgenic (n = 4) and wild-type mice (n = 4) revealed that there was a 50% increase in relative insulin content in the transgenic mice compared with the controls (Fig. 5C). These results suggest that insulin biosynthesis and/or the relative number of the insulin-positive cells is increased in the transgenic mice. Therefore, we quantified numbers of differentiated endocrine cell types against total endocrine cell count and against total pancreatic area in neonatal pancreas (Fig. 5D). There was an 50% reduction in the absolute numbers of endocrine cells (i.e., ISL1-positive cells), however, there were 30% more endocrine cells per pancreatic area, and no difference was observed in the proportion of ß- versus -cells over total endocrine cells (Fig. 5D). The relative increase in ß-cells observed in transgenic compared with wild-type mice might explain the normal serum insulin levels observed in the transgenic mice and the 50% increase observed in the relative total insulin content in transgenic pancreases. However, improved insulin biosynthesis and enhanced insulin secretion could also contribute to the increase in relative total insulin content and normal insulin levels in the transgenic mice. To explore this, we calculated the total relative insulin content and total insulin secretion per unit of ß-cell mass, i.e., per individual ß-cell, and observed a fourfold increase in insulin content and a twofold increase in insulin secretion per unit of ß-cell mass for the transgenic mice compared with control mice (Fig. 5E). Together, these data provide evidence that the reduced pancreatic mass of Ipf1/Frz8CRD mice is compensated by a parallel increase in relative ß-cell mass, insulin biosynthesis, and insulin secretion. In agreement with an enhanced insulin biosynthesis, the expression of prohormone convertase 1/3 (PC1/3), which promotes processing of proinsulin to mature insulin, was increased threefold in islets of 10-week-old Ipf1/Frz8CRD mice compared with wild-type littermates (Fig. 5F). PC1/3 expression has been shown to be dependent on Ipf1/Pdx1 and FGF receptor 1c signaling, and mice that express a dominant-negative form of FRFR1c or lack Ipf1/Pdx1 in ß-cells display reduced PC1/3 expression (25,34). Consequently, analysis of Ipf1/Pdx1 expression by quantitative RT-PCR showed that its expression was increased nearly 2.5-fold in transgenic islets compared with that of controls (Fig. 5F). The increased mRNA expression of Ipf1/Pdx1 in transgenic islets is also consistent with the strong IPF1/PDX1 immunoreactivity observed in the islets of transgenic mice (Fig. 4C and D), although quantitative information cannot be deduced from immunohistochemical data. The expression of glucose transporter type 2 and glucokinase mRNA, two key mediators of the ß-cell response to glucose, and insulin mRNA were only moderately increased in transgenic islets (Fig. 5F). These data suggest that the improved ß-cell function in Ipf1/Frz8CRD mice is mediated, at least in part, by the increased expression of Ipf1/Pdx1 and PC1/3. In summary, our data showed that attenuation of Wnt signaling in adult ß-cells does not affect glucose sensing and GSIS and that normoglycemia in the Ipf1/Frz8CRD mice was likely achieved by combination of increased relative endocrine cell number, enhanced insulin biosynthesis, and insulin secretion per unit of ß-cell mass.
The data presented here suggest that Wnt signaling plays a role in pancreatic epithelial cell proliferation. We show that the Wnt signaling components Wnt4, Wnt7b, and Frz3 are expressed in the developing pancreas of mice and that overexpression of a Wnt signaling antagonist in the embryonic pancreas perturbs pancreatic epithelial cell proliferation. In agreement with Heller et al. (18), we do not observe expression of Wnt7b in the early pancreatic buds. However, at later stages of development, Wnt7b expression could be observed in the pancreatic epithelium; and in contrast to Heller et al. (18), we find Frz3 to be expressed in the pancreatic epithelium during the phase of extensive growth. Consistent with previous reports, we also observed expression of these genes in the lung buds (Wnt7b) and spinal cord (Wnt7b and Frz3) of e10 embryos (29,30). The presence of Frz3 in the early pancreatic progenitor cells is in agreement with a potential role for this receptor in mediating Wnt signals that promote subsequent growth and morphogenesis of the early embryonic pancreas. Because several different Wnts and Frzs genes are expressed in the developing pancreas (18), the expression of the dominant-negative form of mouse Frz8 (i.e., the Frz8 CRD-IgG fusion protein), which appears to function as a general antagonist of Wnt signaling (17,21,31), is advantageous compared with gene inactivation approaches because it is less sensitive to potential redundant effects. Unlike mice overexpressing FGF10 under control of the Ipf1/Pdx1 promoter (6,7), mice overexpressing Wnt1 or Wnt5a under the control of the same promoter do not show signs of pancreatic hyperplasia (18). Instead, the mice overexpressing these Wnt ligands show signs of perturbed foregut specification and/or patterning (18), suggesting that enhanced Wnt signaling perturbs early foregut development. The pancreatic hypoplasia observed in the Ipf1/Frz8CRD mice provide evidence that Wnt signaling also stimulates pancreatic cell proliferation; and the observation that nonphopshorylated ß-catenin immunoreactivity is weaker in e13 Ipf1/Frz8CRD mice than that observed in stage-matched wild-type mice indicates that canonical rather than noncanonical Wnt signaling mediates pancreatic epithelial cell proliferation. FGFs, Wnts, and epidermal growth factors are known to act in synergy to promote proliferation in a variety of systems (35–37). Gross morphological analysis of Ipf1/Frz8CRD neonates revealed pancreatic hypoplasia, as early as e14. Fgf10–/– mice also display severe pancreatic hypoplasia, indicating a role for both signaling pathways in pancreatic growth. However, there is a distinct difference between the Ipf1/Frz8CRD and Fgf10–/– mouse models. The Fgf10–/– mice show complete pancreatic agenesis and severely reduced expression of IPF1/PDX1 in early pancreatic progenitors (5). The pancreatic growth arrest observed in the Fgf10–/– mice in fact resembles that observed in Ipf1/Pdx1–/– (38,39) mice. In contrast, IPF1/PDX1 expression is not perturbed in the Ipf1/Frz8CRD mice, and pancreatic epithelial cell proliferation still occurs in these mice albeit at a reduced rate. Nevertheless, the fact that FGF and Wnt signaling appear to stimulate proliferation of pancreatic progenitor cells leaves open the possibility that these pathways act together, possibly in synergy, to ensure optimal growth of the embryonic pancreas. Despite the 75% drastic reduction in overall pancreatic mass and 50% reduction in absolute ß-cell numbers, adult Ipf1/Frz8CRD mice were normoglycemic with an apparently normal endocrine and exocrine pancreatic function. The normoglycemia displayed by Ipf1/Frz8CRD mice suggests that Wnt signaling is not critical for normal glucose metabolism and insulin secretion. Analyses of mice lacking a functional copy of LRP5, a coreceptor involved in Wnt signaling, have suggested that Wnt/LRP5 signaling contributes to GSIS (20). LRP5–/– mice showed an impaired glucose tolerance and GSIS when glucose challenged, and pretreatment of isolated islets with Wnt-conditioned media resulted in enhanced GSIS from wild-type but not LRP5–/– islets (20). The difference in glucose tolerance and insulin secretion in LRP5–/– mice was, however, age dependent and developed first after 6 months, leaving open the possibility that the ß-cell defects in LRP5–/– mice are secondary rather than primary.
Although attenuation of Wnt signaling in the pancreas of Ipf1/Frz8CRD mice resulted in a reduced total endocrine cell count, the relative number of endocrine cells (i.e., endocrine cells per pancreatic area) was increased, and the ratio between ß- and There have been numerous reports on compensatory adaptations by adult ß-cells in response to variations in insulin demands (41). In rodents, a 40–60% reduction in ß-cell mass does not result in abnormal glucose homeostasis; 85–95% pancreatectomy is required to induce hyperglycemia in these rodents (42,43). Mice with a targeted disruption of the insulin receptor substrate 1 develop insulin resistance but maintain normoglycemia via a compensatory increase in ß-cell mass (44,45). Rats infused with glucose or lipids were shown to achieve maintenance of normoglycemia by dramatically increasing their insulin secretory response paralleled by enhanced ß-cell proliferation 1–2 days after infusion, leading to subsequent increase in ß-cell mass (46). Finally, chemical reduction of ß-cell mass in minipigs, which provokes glucose intolerance, resulted in an increased insulin response from the residual ß-cell population during a mixed-meal tolerance test (47). Our data suggest that the Ipf1/Frz8CRD mice also display compensatory ß-cell adaptations, and thus these mice could provide a useful tool for unraveling the cellular and molecular mechanisms underlying such ß-cell compensatory adaptations.
This work was supported by the Swedish Research Council, the Wallenberg Consortium North, and the Juvenile Diabetes Research Foundation. H.E. has received support from the EC 5th Program and EC Regional Fund, Objective 1. We thank Umeå Transgene Core Facility, U. Valtersson, E. Pålsson, I. Berglund-Dahl, F. Backlund, and project student Elisabet Berglöf for technical assistance, as well as Dr. Pär Steneberg and other members of our laboratory for helpful discussions. Received for publication February 11, 2005 and accepted in revised form June 27, 2005
This article has been cited by other articles:
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||