Diabetes
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brolén, G. K.C.
Right arrow Articles by Semb, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brolén, G. K.C.
Right arrow Articles by Semb, H.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Diabetes 54:2867-2874, 2005
© 2005 by the American Diabetes Association, Inc.

Signals From the Embryonic Mouse Pancreas Induce Differentiation of Human Embryonic Stem Cells Into Insulin-Producing ß-Cell–Like Cells

Gabriella K.C. Brolén1, Nico Heins2, Josefina Edsbagge2, and Henrik Semb1

1 Division of Developmental Biology, Department of Experimental Medical Science, Lund University, Lund, Sweden
2 Cellartis, Gothenburg, Sweden


    ABSTRACT
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The recent success in restoring normoglycemia in type 1 diabetes by islet cell transplantation indicates that cell replacement therapy of this severe disease is achievable. However, the severe lack of donor islets has increased the demand for alternative sources of ß-cells, such as adult and embryonic stem cells. Here, we investigate the potential of human embryonic stem cells (hESCs) to differentiate into ß-cells. Spontaneous differentiation of hESCs under two-dimensional growth conditions resulted in differentiation of Pdx1+/Foxa2+ pancreatic progenitors and Pdx1+/Isl1+ endocrine progenitors but no insulin-producing cells. However, cotransplantation of differentiated hESCs with the dorsal pancreas, but not with the liver or telencephalon, from mouse embryos resulted in differentiation of ß-cell–like cell clusters. Comparative analysis of the basic characteristics of hESC-derived insulin+ cell clusters with human adult islets demonstrated that the insulin+ cells share important features with normal ß-cells, such as synthesis (proinsulin) and processing (C-peptide) of insulin and nuclear localization of key ß-cell transcription factors, including Foxa2, Pdx1, and Isl1.


Address correspondence and reprint requests to Henrik Semb, Division of Developmental Biology, Department of Experimental Medical Science, Lund University BMC, B10 SE-22184 Lund, Sweden. E-mail: Henrik.Semb{at}med.lu.se

Abbreviations: DAPI, 6'diamidino-2-phenylindole; dhESC, differentiated human embryonic stem cell; EGFP, enhanced green fluorescent protein; hESC, human embryonic stem cell; mAb, monoclonal antibody; MEF, mouse embryonic fibroblast; PFA, paraformaldehyde; PBS-T, Triton X-100 in PBS

The pancreatic islets of Langerhans originate from definitive endoderm. The path from definitive endoderm to the mature hormone-producing islet cell types is complex and involves sequential cell-fate decisions, including formation of pancreatic endoderm, endocrine progenitors, and hormone-producing islet cell types, including ß-cells. Systematic studies of the developmental biology of the pancreas have generated important knowledge about the lineage relationship between the different pancreatic cell types and the transcriptional machinery that regulates cell-type specification (13). In addition, important information about the extracellular signals that orchestrate pancreatic cell differentiation and morphogenesis has recently emerged (2,4). However, much remains to be learned about the extracellular cues that specify, maintain, expand, and differentiate endocrine progenitors. Taking these facts into account, the objective to in vitro control differentiation of undifferentiated embryonic stem cells into bona fide pancreatic ß-cells via the sequential cell-fate decisions that operate during normal ß-cell development will be a challenging task.

The potential use of human embryonic stem cells (hESCs) as a source for new ß-cells in cell replacement therapy of type 1 diabetes and as a tool to study human ß-cell development has created great interest in devising strategies for coaxing hESCs into pancreatic ß-cells. The rationale for the former is that cell replacement therapy of this severe disease already exists in the form of islet transplantation, but cadaveric islets available from donors are insufficient for the present and future need in islet transplantation. Thus, the unique nature of hESCs to either self-renew or differentiate into most of our cell types, presumably also islet cell types, including ß-cells, suggests that these cells could potentially supply an unlimited source of transplantable islet cells in the future.

Recent studies have shown that insulin+ cells can be generated from embryonic stem cells by the use of different experimental strategies (514). For example, spontaneous differentiation of mouse embryonic stem cells resulted in ineffective differentiation of insulin-producing cells (8). The most frequently used approach is based on the findings that similar mechanisms operate to control the development of both the central nervous system and the pancreas (1517) and that insulin-producing cells have been observed in the nervous system of invertebrates (1820) and in primary cell cultures from mammalian fetal brain (21). Specifically, embryonic stem cells were induced to differentiate into nestin-producing neural precursors that were expanded and exposed to conditions, which resulted in clusters of insulin-containing cells. In addition, this protocol has been modified, e.g., by constitutive expression of the transcription factors Pdx1 and Pax4 and phosphatidylinositol 3-kinase inhibitors, to enhance the efficiency of the number of insulin-containing cells (6,7). Insufficient characterization of the origin and phenotype of these insulin+ cells together with recent observations that the majority of the insulin+ cells do not synthesize de novo insulin, lack Pdx1, a key ß-cell transcription factor, and accumulate insulin from the medium suggest that the nestin+ progenitor is not a reproducible source for bona fide ß-cells (2224). These embryonic stem cell results are consistent with recent cell lineage analysis demonstrating that nestin-expressing cells within the pancreas give rise to mesenchymal cell types and few exocrine cells but no islet cell types (25).

These findings emphasize the need for using the same instructive principles that operate during normal ß-cell development when coaxing embryonic stem cells into insulin-producing ß-cells. This conceptual experimental strategy was previously shown to be realizable for in vitro differentiation of mouse embryonic stem cells into functional motor neuron (26). In this study, we have characterized spontaneous differentiation of hESCs into pancreatic progenitors and their mature exocrine and endocrine descendents in vitro. Whereas pancreatic endoderm and endocrine progenitors spontaneously formed, no pancreatic insulin-producing cells appeared. To address whether the pancreatic progenitors were capable of responding to cues from the developing pancreas, the cells were cotransplanted with mouse embryonic pancreas under the kidney capsule. Notably, this resulted in the differentiation of insulin+ cell clusters, which exhibited many of the characteristic features of normal ß-cells, such as de novo synthesis and processing of human insulin, as revealed by proinsulin and C-peptide expression, respectively. Furthermore, key ß-cell transcription factors, such as Foxa2, Pdx1, and Isl1, were confined to the nucleus.


    RESEARCH DESIGN AND METHODS
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In vitro culture and differentiation of hESCs.
All in vitro experiments were performed with the hESC lines SA002, AS034, SA121, and SA181, whereas all transplantation experiments were performed with AS034 (27). Undifferentiated hESCs were propagated as previously described (27). Briefly, they were maintained on mitotically inactivated mouse embryonic fibroblasts (MEFs) with one-half medium change every 2nd day and manually passaged every 4–5 days onto fresh MEFs. Spontaneous differentiation of hESCs was induced by maintaining hESC colonies on MEFs without passaging for up to 34 days with one-half medium changes every 2nd to 3rd day. Cells expressing various endodermal markers (Foxa2+, Pdx1+, and Isl1+) became numerous around day 14 at the periphery of spontaneously differentiated hESC (dhESC) colonies. The peripheral areas of dhESC colonies were manually isolated for the transplantation experiments.

Animals.
The transgenic B5/enhanced green fluorescent protein (B5/EGFP) (The Jackson Laboratory) (28), C57B1/6J (The Jackson Laboratory), and SCID Beige (Charles River Laboratories) mouse strains were used.

Transplantation of dhESCs.
A heterogeneous population of in vitro dhESCs (14–19 days), including pancreatic Pdx1+ progenitors (Fig. 1B and C), were harvested by manual dissection, pooled, and divided into eppendorf tubes (100,000–150,000 cells), suspended in VitroHES (Vitrolife) supplemented with 4 ng/ml hrbFGF (Invitrogen), and placed in cell incubator until transplanted. Before transplantation, cells were centrifuged at 400 x g for 2 min, medium was discarded, and cells were resuspended in Cryo-PBS (Vitrolife) and transplanted without (n = 12, dhESCs) or with pieces of embryonic day (E) 11.5 (n = 8, dhESC/E11.5dp) or E13.5 (n = 5, dhESC/E13.5dp) dorsal pancreases from EGFP mouse embryos beneath the right kidney capsule of 5- to 7-week-old female SCID mice anesthetized with isofluran (Schering-Plough Animal Health) (n = number of transplanted animals) (29). As positive controls, E11.5 (n = 4, E11.5dp) and E13.5 (n = 4, E13.5dp) dorsal pancreata from EGFP mouse embryos were transplanted under the kidney capsule. As a negative control, Cryo-PBS (n = 6) was injected under the kidney capsule. Further controls included cotransplantation of the same pool of dhESCs with E11.5 liver (n = 1, dhESC/E11.5liv) or telencephalon (n = 1, dhESC/E11.5tel) from EGFP mouse embryos. Eight weeks after the transplantation, the recipients were killed, blood was collected for human C-peptide analysis in serum, and the right kidney together with the graft was removed for further analysis.


Figure 1
View larger version (82K):
[in this window]
[in a new window]

 
FIG. 1. Morphological and immunofluorescence (IF) analysis of spontaneously dhESC colonies on MEFs. AC: Phase-contrast images of an undifferentiated hESC colony at day 4 after passaging (A) and a dhESC colony at day 14 with endodermal cells at the periphery (broken line) (B). The boxed region is shown at higher magnification in C. DG: Immunofluorescence staining of a dhESC colony (center [top] and periphery [base]) at day 7 for Foxa2 (red) (D); nestin (green) (E); merged images of Foxa2 and nestin (F); and merged images of Foxa2, nestin, and DAPI (blue) (G). HK: Immunofluorescence staining of the periphery of a differentiated colony at day 14 for Foxa2 (green) (H); Pdx1 (red) (I); merged images of Foxa2 and Pdx1 (J); and merged images of Foxa2, Pdx1, and DAPI (blue) (K). LO: Immunofluorescence staining of the periphery of a differentiated colony at day 19 for Isl1 (green) (L); Pdx1 (red) (M); merged images of Isl1 and Pdx1 (N); and merged images of Isl1, Pdx1, and DAPI (blue) (O). Orange-yellow marks colocalization. Scale bars: 100 µm (A), 200 µm (B), 50 µm (C), 200 µm (D), 50 µm (H), and 50 µm (L).

 
Histological analysis.
Xenografted kidneys were fixed in 4.0% paraformaldehyde (PFA), infiltrated with 30% sucrose solution in PBS, embedded in Tissue-Tek compound (Sakura Finetek Europe), and frozen on dry ice. For histological examination, sections (10–12 µm) were stained with hematoxylin and eosin and photographed by a Zeiss Axioskop 2.

Immunohistochemistry.
PFA-fixed air-dried cryo-sections (10–12 µm) were incubated in 0.1% Triton X-100 in PBS (PBS-T, wash medium) for 30 min before the staining procedure. dhESC colonies were fixed with 4.0% PFA for 10–15 min and washed three times for 5 min in PBS-T. Fixed hESC colonies and cryo-sections were washed in PBS, heated in microwave oven in 0.5 mol/l Tris-Base solution, pH 10 (only for C-peptide and proinsulin stainings), postfixed in methanol in serial dilutions (25, 50, and 75% methanol in PBS-T and 100% methanol with 3% H2O2 [only for Isl1 stainings]), and blocked in PBS supplemented with 5–10% serum (normal donkey serum, normal goat serum, or FCS; Jackson Immunoresearch) for 1 h at room temperature before they were incubated overnight at 4°C with the following primary antibodies and dilutions: goat polyclonal antibody anti-Foxa2 (Santa Cruz Biotechnology; 1:400), rabbit anti-Pdx1 (a gift from Dr. C. Wright; 1:2,000), rat monoclonal antibody (mAb) anti–E-cadherin (Zymed; 1:200), guinea pig anti-insulin (Dako; 1:1,000), rabbit anti-glucagon (Zymed; 1:1,000), rabbit anti-human {alpha}-amylase (Sigma; 1:1,000), mouse mAb anti-human proinsulin (a gift from Dr. P. Serup; 1:1,000) (30), rat mAb anti-human C-peptide (a gift from Dr. P. Serup; 1:2,000) (31), rabbit anti-mouse C-peptide (a gift from Dr. P. Serup; 1:1,500), guinea pig anti-Isl1 (a gift from Dr. H. Edlund; 1:1,000), mouse mAb anti-human nuclei (Chemicon; 1:250), mAb anti–{alpha}-fetoprotein (Sigma; 1:500), mouse mAb anti-desmin (Chemicon; 1:100), mouse anti-nestin (BD Biosciences; 1:200), mouse mAb anti-human ß-tubulin isotype III (Sigma; 1:100), mouse mAb anti-human Oct-4 (Santa Cruz; 1:500), mouse mAb anti–{alpha} smooth muscle actin (Sigma; 1:200), and rabbit anti-human {alpha}-1-antitrypsin (Dako; 1:200); washed three times for 5 min in PBS-T; and incubated with secondary antibodies (diluted according to the manufacturer’s instructions) for 60 min in PBS-T supplemented with 1–5% serum (staining solution) at room temperature. TSA kit (TSA Fluorescence Systems Fluorescein [green, NEL701]) or Tetramethylrhodamine (red, NEL702) (PerkinElmer) was used for visualizing proinsulin and C-peptide. Cell nuclei were visualized by incubating 4 min with 4'-6'diamidino-2-phenylindole (DAPI) (Sigma-Aldrich; 1:1,000) in PBS. EGFP-expressing cells and immunofluorescence stainings were detected and analyzed by epifluorescence microscopy (Zeiss Axioskop 2). For confocal images Leica LCS NT and Zeiss LSM 510 META confocal microscopes were used.

C-peptide levels in serum.
Eight weeks after transplantation, the recipient mice were killed, and blood was collected for serum extraction. Human C-peptide levels in mouse serum were measured using a commercially available C-peptide enzyme-linked immunosorbent assay kit (Dako Cytomation), which specifically detects human C-peptide, according to the manufacturer’s instructions.

Cell isolation and RNA extraction for measurement of gene expression by PCR.
Undifferentiated hESCs and a heterogeneous population of in vitro dhESCs at days 7, 12, and 17 were isolated, as described above. RNA was isolated from the cells using the RNeasy Midi kit (Qiagen) and treated with the RNase-free DNase kit (Qiagen) according to the manufacturer’s instructions. The SuperScript II (Invitrogen) reagent set was used for the reverse transcription reaction, after which PCR was performed. RNA extraction and standard PCR techniques were performed and analyzed as described by Ståhlberg et al. (32). To detect Ngn3, NeuroD1, Nkx2.2, and Pax6, primer sequences and RT-PCR conditions were as previously described (33,34). The primers for Oct4 were CGAAAGAGAAAGCGAACCAG (forward) and AACCACACTCGGACCACATC (reverse), Nanog primers were CCTATGCCTGTGATTTGTGG (forward) and AAGTGGGTTGTTTGCCTTTG (reverse), Hb9 primers were GCACCAGTTCAAGCTCAA CA (forward) and CCTTCTGTTTCTCCGCTTCC (reverse), Nkx6.1 primers were ATTCGTTGGGGATGACAGAG (forward) and CGAGTCCTGCTTCTTCTTGG (reverse), and Pdx1 primers were CCCATGGATGAAGTCTACC (forward) and GTCCTCCTCCTTTTTCCAC (reverse).


    RESULTS
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Spontaneous differentiation of hESCs results in Pdx1+ cells but no insulin+ cells.
To examine whether hESCs spontaneously differentiate into pancreatic progenitors and hormone-producing cells, spontaneous differentiation was induced under two- and three-dimensional conditions by maintaining hESCs on MEFs without passaging and in suspension cultures (embryoid bodies), respectively. Cellular morphology and expression of gene products that define cell types derived from all three germ layers were monitored at different time points. Whereas few pancreatic progenitors were found in embryoid bodies (data not shown), differentiation on MEFs generated cells with characteristics of pancreatic progenitor cells (see below). Throughout the rest of the study, dhESCs refer to cells differentiated on MEFs (Fig. 1AC). Starting from day 5, the hESCs exhibited a distinct differentiation pattern with ectodermal (nestin+, ßIII-tubulin+) cells confined to the center and mesodermal ({alpha}-smooth muscle actin+, desmin+) and endodermal (Foxa2+, Pdx1+, {alpha}1-antitrypsin+) cell types restricted to the periphery (Fig. 1DG and data not shown). Of particular interest were the numerous Foxa2+/Pdx1+, which started to appear at day 5, and became numerous around day 12 (Fig. 1HK). Notably, all Pdx1+ cells coexpressed Foxa2 at all stages. The fact that pancreatic progenitors normally express both Foxa2 and Pdx1 (35) suggests that this hESC-derived cell population represents pancreatic progenitors. The presence of pancreatic progenitors was corroborated by RT-PCR analysis of the differentiated peripheral cell population, which demonstrated that additional pancreatic endodermal markers, such as Hb9 and Nkx6.1, were induced at the time when the Pdx1+ cells were observed (data not shown). It has previously been shown that endocrine progenitors express Ngn3 and Isl1 and that these transcription factors are essential for differentiation of all islet cell types (36,37). To identify endocrine progenitors, we therefore examined the mRNA expression pattern of endocrine markers and searched by immunofluorescence for cells coexpressing Isl1 and Pdx1. Starting from around day 19, we identified rare clusters of Pdx1+/Isl1+ cells, suggesting that hESCs spontaneously differentiate into pancreatic endocrine progenitors (Fig. 1LO). However, early endocrine cell differentiation appeared to be inefficient because Ngn3 mRNA was not detected by RT-PCR within the differentiated peripheral cell population (data not shown). Finally, insulin protein and Nkx2.2 mRNA was not detected during the whole differentiation period (34 days).

In contrast to the endoderm, which was confined to the periphery of the colonies, neuroectodermal derivatives, such as cells expressing nestin and ßIII-tubulin, were mainly confined to the center of the colonies until day 10 (Fig. 1DG). After day 10, these cell types drastically decreased, suggesting that the culture conditions were unfavorable for differentiation/maintenance of neuroectodermal lineages.

Cotransplantation of dhESCs with embryonic mouse pancreas induces differentiation of insulin+ cells.
The in vitro results suggested that hESCs spontaneously differentiate into Pdx1+ pancreatic progenitors, including Pdx1+/Isl1+ endocrine precursors. However, the fact that even after prolonged culture periods no insulin+ cells appeared suggested that the appropriate extracellular cues for inducing differentiation and maturation of these cells were lacking in vitro. To test whether exposure to signals from the developing pancreas could drive differentiation of spontaneously dhESCs, a series of cotransplantation experiments were performed where dhESCs, including Pdx1+ pancreatic progenitors, were grafted together with the developing mouse pancreas under the kidney capsule of SCID mice. Normally, grafting fetal mouse and human pancreatic tissue under the kidney capsule results in differentiation of both endocrine and exocrine cell types, suggesting that the kidney provides the necessary cues for promoting pancreatic cell-type differentiation. We chose two stages of the developing pancreas, E11.5 and E13.5, which represent phases of pancreatic progenitor expansion and endocrine cell differentiation/expansion, respectively (38,39). As controls, dhESCs were grafted with other mouse embryonic tissues, such as the liver and telecephalon. To examine the consequence of cotransplanting different embryonic mouse organs with the dhESCs on pancreatic cell-type differentiation, histochemical and immunofluorescence analyses were performed. Histochemical analysis demonstrated that independent of whether the dhESCs were grafted alone or with the different embryonic mouse tissues, grafts were mainly composed of epithelial cells organized in ducts and gut-like (containing mucous-producing cells) structures surrounded by connective tissue and smooth muscle cells.

To identify hESC-derived cells, we used an antibody against human nuclear antigen, whereas the grafted mouse cells, including the embryonic pancreas, liver, and telencephalon, were identified by transgenic EGFP expression. Mouse host cells were identified as DAPI+ cells that neither expressed EGFP nor were recognizable by the anti-human nuclear antibody (Fig. 2AC). As expected, the grafted EGFP+ mouse pancreatic cells differentiated into insulin+, glucagon+, and amylase+ cells (Fig. 2DI).


Figure 2
View larger version (68K):
[in this window]
[in a new window]

 
FIG. 2. Cotransplantation of dhESCs and EGFP+ mouse dorsal pancreas (dp). AC: Human nuclei antibody (HN) (red) (A) was used to distinguish human cells from EGFP+ mouse cells (green) (B) and mouse host cells, indicated by arrows (HN–/EGFP–/DAPI+) in merged images of human nuclei, EGFP, and DAPI (blue) (C) in sections from grafts of dhESC/E11.5dp. DI: Immunofluorescence analysis of grafted EGFP+ E11.5dp, which developed into EGFP-expressing (green), insulin+ (blue), glucagon+ (red) (DF), and amylase+ (red) (GI) cells. dhESC, manually isolated dhESCs from the periphery of spontaneously dhESC colonies (days 14–19); dp, EGFP+ mouse embryonic dorsal pancreas. Scale bars: 25 µm (A), 50 µm (D), 25 µm (G).

 
Notably, in all animals in which dhESCs were cotransplanted with E11.5 or E13.5 EGFP dorsal pancreata, differentiation of hESC-derived insulin+ cells (human nuclei+/ins+/EGFP) was induced (Figs. 3AC and 4). The insulin+ cells were predominantly organized into clusters of 5–25 cells (Fig. 3AC), which were localized nearby but not in direct contact with the embryonic mouse cells, which also underwent differentiation into islet-like clusters (Fig. 2). Importantly, no human nuclei+/ins+ cells were identified when dhESCs were transplanted alone or together with either mouse embryonic liver of telencephalon (Fig. 4). In contrast to the insulin+ cells, glucagon+ and amylase+ cells of hESC origin (human nuclei+/EGFP) were also identified in grafts from dhESCs alone. In these grafts, glucagon+ and amylase+ cells of hESC origin were preferentially localized in ducts (data not shown), whereas in grafts from cotransplanted dhESCs and mouse dorsal pancreases, they were organized into small clusters (5–10 cells) distinct from the hESC- and mouse-derived insulin+ cell clusters (Fig. 3DI). In summary, we show that hESCs can differentiate into insulin+, glucagon+, and amylase+ cells. Whereas the presence of the developing mouse embryonic dorsal pancreas was required for differentiation of insulin+ cells, differentiation of glucagon+ and amylase+ cells occurred in the absence of the developing mouse pancreas. Importantly, hESC-derived insulin+ cells (human nuclei+/insulin+) expressed human C-peptide but not mouse C-peptide and EGFP, indicating that the appearance of these cells could not be explained by fusion between hESC-derived cells and EGFP+/insulin+ mouse cells. Correspondingly, we also demonstrate that glucagon+/human nuclei+ cells and amylase+/human nuclei+ cells were distinct from mouse EGFP+/glucagon+ and EGFP+/amylase+ cells, respectively.


Figure 3
View larger version (52K):
[in this window]
[in a new window]

 
FIG. 3. Differentiation of hESCs into endocrine and acinar cell types. AC: Confocal images of immunofluorescence (IF) staining of sections from dhESC/E13.5dp grafts for insulin (green) (A), human nuclei antibody (HN) (red) (B), and merged images of insulin and human nuclei (C). DF: Immunofluorescence stainings of sections from dhESC/E11.5dp grafts for glucagon (green) (D), HN (red) (E), and merged images of glucagon and HN (F). GI: Immunofluorescence stainings of sections from dhESC/E11.5dp grafts for amylase (green) (G), HN (red) (H), and merged images of amylase and HN (I). dhESC, manually isolated dhESCs from the periphery of spontaneously dhESC colonies (days 14–19); dp, EGFP+ mouse embryonic dorsal pancreas. Scale bars: 25 µm.

 

Figure 4
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 4. Characterization of hESC-derived insulin+ cells. In vitro differentiation was for up to 34 days. For in vivo differentiation, dhESCs were transplanted alone or cotransplanted with dp, liv, or tel under the kidney capsule for 8 weeks. A: Each column represents the absence (–) or presence (+) of hESC-derived insulin+ cells (HN+/ins+). B: Absence (–) or presence (+) of the indicated marker within the hESC-derived insulin+ cells. dhESC, differentiated hESC (manually isolated from the periphery of spontaneously differentiated hESC colonies [days 14–19]); dp, EGFP+ mouse embryonic dorsal pancreas; HN+/ins+, cells coexpressing human nuclear antigen (HN) and insulin (ins); liv, EGFP+ mouse embryonic liver; tel, EGFP+ mouse embryonic telencephalon.

 
The hESC-derived insulin+ cells express human pro-insulin, C-peptide, and key ß-cell transcription factors.
To characterize the insulin+ cells further, we investigated whether they synthesized and processed insulin and expressed other characteristics of normal ß-cells, such as expression of transcription factors known to regulate development and function of ß-cells. To examine whether insulin+ cells synthesized and processed insulin, coexpression of proinsulin and C-peptide were analyzed. We show that the same cells that expressed insulin also expressed proinsulin and C-peptide, indicating that insulin+ cells synthesized and processed insulin (Figs. 46). It is expected that cells, which synthesize and secrete insulin, should express key ß-cell transcription factors, such as Foxa2, Pdx1, and Isl1, which participate in the transcriptional regulation of ß-cell differentiation and function. Isl1 is required for formation of progenitors for all islet cell types, whereas Foxa2 and Pdx1 are required for growth and differentiation of all pancreatic cell types and for ß-cell function (13). Importantly, the insulin+ cells expressed Foxa2, Pdx1, and Isl1, emphasizing some ß-cell features of these cells (Figs. 46). E-cadherin, which is normally expressed in both exocrine and endocrine cell types (40,41), was also expressed in the hESC-derived insulin+ cells (data not shown). Moreover, Pdx1 was expressed at markedly lower levels in the insulin+ cells compared with the surrounding insulin epithelial cells (Fig. 5A). For comparative analysis, we stained sections of adult human pancreas with antibodies against Pdx1, Isl1, proinsulin, C-peptide, and insulin (Fig. 5B). Thus, based on the comparative marker expression analysis between hESC-derived insulin+ cells and normal adult ß-cells, we conclude that the hESC-derived insulin+ cells synthesize and process insulin and share additional important features of normal ß-cells, such as the expression of essential ß-cell transcription factors.


Figure 6
View larger version (54K):
[in this window]
[in a new window]

 
FIG. 6. hESC-derived insulin+ cells coexpress Pdx1 and proinsulin. Confocal immunofluorescence images of cryo-sections of dhESC with E13.5 EGFP grafts stained for HN (red), Pdx1 (green), and insulin (blue) (A); and proinsulin (green), insulin (red), and DAPI (blue) (B). dhESC, manually isolated dhESCs from the periphery of spontaneously dhESC colonies (days 14–19); dp, EGFP+ mouse embryonic dorsal pancreas. Scale bars: 20 µm.

 

Figure 5
View larger version (69K):
[in this window]
[in a new window]

 
FIG. 5. hESCs differentiate into proinsulin+ and C-peptide+ cells, which express several ß-cell transcription factors. Immunofluorescence (IF) analysis of ß-cell markers on consecutive sections of a hESC-derived insulin+ cell cluster (A) and adult human islets (B). A: Hematoxylin and eosin (a) and immunofluorescence stainings of consecutive cryo-sections (a) from dhESC/E13.5dp graft (8 weeks) for Pdx1 (red) and insulin (green) (b); Isl1 (green) (c); C-peptide (green) and DAPI (blue) (d); insulin (green) and Pdx1 (red) (e); proinsulin (green), insulin (red), and DAPI (blue) (f); Foxa2 (red) and insulin (green) (g); Pdx1 (red) and insulin (green) (h); and human nuclei antibody (HN) (red) and insulin (green) (i). Note that one section between (b) and (c) is missing in the panel of consecutive sections in A. The inset in h shows that Pdx1 was expressed at lower levels in insulin+ cells compared with the surrounding Pdx1+ cells (also seen in b and e). B: Hematoxylin and eosin (a) and immunofluorescence stainings of paraffin (c and f) and frozen sections (a, b, d, and e) of adult human pancreas for Pdx1 (red) (b), insulin (green) (c), Isl1 (green) (d), C-peptide (green) (e), and merged images of proinsulin (green) and insulin (red) (f). dhESC, manually isolated dhESCs from the periphery of spontaneously dhESC colonies (days 14–19); dp, EGFP+ mouse embryonic dorsal pancreas. Scale bars: 50 µm.

 

    DISCUSSION
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although we know that mouse embryonic stem cells can differentiate into functional ß-cells in chimeric mice, this process cannot be controlled in vitro. Similar pluripotency tests cannot, for obvious ethical reasons, be carried out with hESCs, which is why it remains to be shown whether hESCs can differentiate into insulin-producing ß-cells. Therefore, our finding that hESCs, under certain conditions, can be coaxed into insulin-producing cells with ß-cell features is of significant importance. Moreover, based on the observation that many of the mechanistic principles that regulate ß-cell development are conserved throughout evolution, it is assumed that knowledge of ß-cell development from nonprimate model organisms can be applied to hESCs. For this reason, it is particularly encouraging that we find that signals from the mouse embryonic pancreas can specifically induce differentiation of hESCs into insulin-producing ß-cell–like cells, suggesting that hESCs respond to extracellular cues that normally regulate ß-cell differentiation and that these signals are conserved from mice to men.

Our findings raise several interesting questions. First, what is the origin of the insulin+ cells? Second, why do hESCs fail to differentiate into insulin+ cells in vitro? Third, how similar are the hESC-derived insulin+ cells to normal ß-cells? The fact that we have been unable to determine the cell lineage relationship between potential pancreatic progenitors in vitro and the insulin-producing cells within the graft leaves us with speculations regarding the origin of the insulin+ cells. The combinatorial expression of Foxa2 and Pdx1 indicates that foregut endoderm progenitors spontaneously differentiate from hESCs in vitro. Moreover, the presence of such cells implies that definitive endoderm spontaneously differentiate in vitro under current experimental conditions. A potential caveat in validating definitive endoderm is that several genes known to regulate definitive endoderm and its derivatives, such as Sox17 and Foxa2, are also expressed in extraembryonic endoderm (42,43). Moreover, expression of Pdx1 mRNA and insulin in visceral endoderm, which later becomes the yolk sac, has been reported (44). However, we failed to detect Pdx1 protein in the mouse yolk sac (data not shown). Although both definitive and extraembryonic endoderm share many markers, {alpha}-fetoprotein has been reported to be a major secreted protein in the visceral yolk sac (45), whereas it is transiently expressed in embryonic endoderm derivatives, such as fetal hepatic cells (46). The fact that few {alpha}-fetoprotein+ cells were identified in colonies enriched for Foxa2+/Pdx1+ cells in vitro suggests that the Foxa2+/Pdx1+ cells originate from definitive endoderm and not from extraembryonic endoderm. Yet, perhaps the most convincing evidence of definitive endoderm-derived pancreatic islet progenitors in vitro was the appearance of Pdx1+/Isl1+ cells, which appeared rather late during the differentiation period. Altogether, the data support in vitro differentiation of definitive endoderm-derived pancreatic and islet progenitors. We speculate that a fraction of these cells can respond to differentiation cues present in the mouse embryonic pancreas by maturing into hormone-producing islet cell types and acinar cells in vivo.

The fact that no insulin+ cells appeared throughout the in vitro differentiation period (34 days) could either be explained by timing or inappropriate extracellular cues. The former may be pertinent because it takes ~7–8 weeks to go from a gastrulating human embryo to insulin-producing cells (4). However, grafting dhESCs, including Pdx1+ progenitors, for 8 weeks did not result in differentiation of insulin+ cells, arguing against time being the complete answer. In fact, insulin+ cells only appeared when dhESCs were cotransplanted with the mouse dorsal pancreas and not when they were transplanted alone or with other embryonic tissues, such as the liver and telencephalon. Therefore, we favor an alternative explanation, namely that the appropriate stimulatory/inhibitory extracellular cues for inducing differentiation and maturation of hESCs into insulin-producing ß-cell–like cells are lacking in vitro.

Finally, with regard to the ß-cell features of the hESC-derived insulin-producing cells, the cells apparently synthesize and process insulin, as defined by the expression of proinsulin and C-peptide. Moreover, in one of the mice cotransplanted with hESCs and mouse dorsal pancreas, human C-peptide was detected at levels (1.81 ng/ml) corresponding to normal serum C-peptide levels in nonfasted humans (~2 ng/ml) (47,48). Notably, the graft from this individual contained the highest number of insulin+ clusters (data not shown). Furthermore, immunofluorescence analysis showed that transcription factors known to regulate development and function of ß-cells, such as Foxa2, Pdx1, and Isl1, were confined to the nuclei of hESC-derived insulin-producing cells, lending further support to the ß-cell characteristics of these cells. Notably, Pdx1 expression was markedly lower within Pdx1+/insulin+ cells compared with the surrounding Pdx1+/insulin cells. Consistently, it was recently demonstrated that during human fetal pancreas development, Pdx1 expression was lower in developing ß-cells compared with the neighboring epithelial progenitors (49). In contrast, newly formed mouse ß-cells express higher levels of Pdx1 compared with the surrounding pancreatic Pdx1+/insulin progenitors (38,49). Whether the apparent discrepancy in Pdx1 expression during ß-cell differentiation in mice and humans implies differences in the role of Pdx1 remains to be shown. Finally, the rather inefficient differentiation of the insulin-producing cells impedes their isolation for more extended characterization of their functional characteristics, such as glucose-regulated insulin-secretion and ability to restore normoglycemia in mice with experimentally induced diabetes.

Future studies will focus on elucidating the origin of the insulin+ cells, understanding which steps in the differentiation of hESCs toward an insulin-producing ß-cell–like cell the embryonic mouse pancreas regulates, and the functional characteristics of these cells.


    ACKNOWLEDGMENTS
 
The work was supported by grants from the Swedish Research Council, Juvenile Diabetes Research Foundation, Swedish Diabetes Research Foundation, and Ingabritt och Arne Lundbergs forskningsstiftelse.

We thank C. Wright for anti-Pdx1; P. Serup and O. Madsen for anti-human-C-peptide, anti-mouse-C-peptide, and anti-proinsulin; H. Edlund for anti-Isl1; and O. Korsgren for paraffin and frozen biopsies of human pancreas. We also thank Cellartis for providing hESCs and especially Katarina Andersson, Karin Noaksson, and Angelica Niklasson for their assistance and propagation of hESCs. We acknowledge Anders Ståhlberg for assistance with the RT-PCR and the Swegene Centre for Cellular Imaging at Gothenburg University for the use of imaging equipment and for continuous support from the staff.

Received for publication May 9, 2005 and accepted in revised form July 20, 2005


    REFERENCES
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Murtaugh LC, Melton DA: Genes, signals, and lineages in pancreas development. Ann Rev Cell Dev Biol 19:71–89, 2003[Medline]
  2. Edlund H: Pancreatic organogenesis: developmental mechanisms and implications for therapy. Nat Rev Genet 3:524–532, 2002[Medline]
  3. Jensen J: Gene regulatory factors in pancreatic development. Dev Dynam 229:176–200, 2004[Medline]
  4. Scharfmann R: Control of early development of the pancreas in rodents and humans: implications of signals from the mesenchyme. Diabetologia 43:1083–1092, 2000[Medline]
  5. Assady S, Maor G, Amit M, Itskovitz-Eldor J, Skorecki KL, Tzukerman M: Insulin production by human embryonic stem cells. Diabetes 50:1691–1697, 2001[Abstract/Free Full Text]
  6. Blyszczuk P, Czyz J, Kania G, Wagner M, Roll U, St-Onge L, Wobus AM: Expression of Pax4 in embryonic stem cells promotes differentiation of nestin-positive progenitor and insulin-producing cells. Proc Natl Acad Sci U S A 100:998–1003, 2003[Abstract/Free Full Text]
  7. Hori Y, Rulifson IC, Tsai BC, Heit JJ, Cahoy JD, Kim SK: Growth inhibitors promote differentiation of insulin-producing tissue from embryonic stem cells. Proc Natl Acad Sci U S A 99:16105–16110, 2002[Abstract/Free Full Text]
  8. Kahan BW, Jacobson LM, Hullett DA, Ochoada JM, Oberley TD, Lang KM, Odorico JS: Pancreatic precursors and differentiated islet cell types from murine embryonic stem cells: an in vitro model to study islet differentiation. Diabetes 52:2016–2024, 2003[Abstract/Free Full Text]
  9. Lester LB, Kuo HC, Andrews L, Nauert B, Wolf DP: Directed differentiation of rhesus monkey ES cells into pancreatic cell phenotypes (Review). Reprod Biol Endocrinol 2:42, 2004[Medline]
  10. Miyazaki S, Yamato E, Miyazaki J: Regulated expression of pdx-1 promotes in vitro differentiation of insulin-producing cells from embryonic stem cells. Diabetes 53:1030–1037, 2004[Abstract/Free Full Text]
  11. Moritoh Y, Yamato E, Yasui Y, Miyazaki S, Miyazaki J: Analysis of insulin-producing cells during in vitro differentiation from feeder-free embryonic stem cells. Diabetes 52:1163–1168, 2003[Abstract/Free Full Text]
  12. Segev H, Fishman B, Ziskind A, Shulman M, Itskovitz-Eldor J: Differentiation of human embryonic stem cells into insulin-producing clusters. Stem Cells 22:265–274, 2004[Abstract/Free Full Text]
  13. Shiroi A, Yoshikawa M, Yokota H, Fukui H, Ishizaka S, Tatsumi K, Takahashi Y: Identification of insulin-producing cells derived from embryonic stem cells by zinc-chelating dithizone. Stem Cells 20:284–292, 2002[Abstract/Free Full Text]
  14. Soria B, Roche E, Berna G, Leon-Quinto T, Reig JA, Martin F: Insulin-secreting cells derived from embryonic stem cells normalize glycemia in streptozotocin-induced diabetic mice. Diabetes 49:1–6, 2000[Abstract]
  15. Kim SK, Hebrok M, Melton DA: Notochord to endoderm signaling is required for pancreas development. Development 124:4243–4252, 1997[Abstract]
  16. Li H, Arber S, Jessell TM, Edlund H: Selective agenesis of the dorsal pancreas in mice lacking homeobox gene Hlxb9. Nat Genet 23:67–70, 1999[Medline]
  17. Schwitzgebel VM, Scheel DW, Conners JR, Kalamaras J, Lee JE, Anderson DJ, Sussel L, Johnson JD, German MS: Expression of neurogenin3 reveals an islet cell precursor population in the pancreas. Development 127:3533–3542, 2000[Abstract]
  18. Smit AB, Vreugdenhil E, Ebberink RHM, Geraerts WPM, Klootwijk J, Joosse J: Growth-controlling mulluscan neurons produce the precursor of an insulin-related peptide. Nature 331:535–538, 1988[Medline]
  19. Brogiolo W, Stocker H, Ikeya T, Rintelen F, Fernandez R, Hafen E: An evolutionary conserved function of the Drosophila insulin receptor and insulin-like peptides in growth control. Current Biol 11:213–221, 2000
  20. Rulifson EJ, Kim SK, Nusse R: Ablation of insulin-producing neurons in flies: growth and diabetic phenotypes. Science 296:1118–1120, 2002[Abstract/Free Full Text]
  21. Clarke DW, Mudd L, Boyd FT Jr, Fields M, Raizada MK: Insulin is released from rat brain neuronal cells in culture. J Neurochem 47:831–836, 1986[Medline]
  22. Sipione S, Eshpeter A, Lyon JG, Korbutt GS, Bleackley RC: Insulin expressing cells from differentiated embryonic stem cells are not beta cells. Diabetologia 47:499–508, 2004[Medline]
  23. Rajagopal J, Anderson WJ, Kume S, Martinez OI, Melton DA: Insulin staining of ES cell progeny from insulin uptake. Science 299:363, 2003[Free Full Text]
  24. Hansson M, Tonning A, Frandsen U, Petri A, Rajagopal J, Englund MC, Heller RS, Håkansson J, Fleckner J, Nilsson Sko H, Melton D, Semb H, Serup P: Artifactual insulin release from differentiated embryonic stem cells. Diabetes 53:2603–2609, 2004[Abstract/Free Full Text]
  25. Delacour A, Nepote V, Trumpp A, Herrera PL: Nestin expression in pancreatic exocrine cell lineages. Mech Dev 121:3–14, 2004[Medline]
  26. Wichterle H, Lieberam I, Porter JA, Jessell TM: Directed differentiation of embryonic stem cells into motor neurons. Cell 110:385–397, 2002[Medline]
  27. Heins N, Englund MC, Sjoblom C, Dahl U, Tonning A, Bergh C, Lindahl A, Hanson C, Semb H: Derivation, characterization, and differentiation of human embryonic stem cells. Stem Cells 22:367–376, 2004[Abstract/Free Full Text]
  28. Hadjantonakis AK, Gertsenstein M, Ikawa M, Okabe M, Nagy A: Generating green fluorescent mice by germline transmission of green fluorescent ES cells. Mech Dev 76:79–90, 1998[Medline]
  29. Greiner DL, Hesselton RA, Shultz LD: SCID mouse models of human stem cell engraftment. Stem Cells 16:166–177, 1998[Abstract/Free Full Text]
  30. Madsen OD, Cohen RM, Fitch FW, Rubenstein AH, Steiner DF: The production and characterization of monoclonal antibodies specific for human proinsulin using a sensitive microdot assay procedure. Endocrinology 113:2135–2144, 1983[Abstract]
  31. Blume N, Petersen JS, Andersen LC, Kofod H, Dyrberg T, Michelsen BK, Serup P, Madsen OD: Immature transformed rat islet beta-cells differentially express C-peptide derived from the genes coding for insulin I and II as well as a transfected human insulin gene. Mol Endocrinol 6:299–307, 1992[Abstract]
  32. Ståhlberg A, Håkansson J, Xian X, Semb H, Kubista M: Properties of the reverse transcription reaction in mRNA quantification. Clin Chem 50:509–515, 2004[Abstract/Free Full Text]
  33. Heremans Y, Van De Casteele M, in’t Veld P, Gradwohl G, Serup P, Madsen O, Pipeleers D, Heimberg H: Recapitulation of embryonic neuroendocrine differentiation in adult human pancreatic duct cells expressing neurogenin 3. J Cell Biol 159:303–311, 2002[Abstract/Free Full Text]
  34. Hori Y, Gu X, Xie X, Kim SK: Differentiation of insulin-producing cells from human neural progenitor cells. PLoS Med 2:e103, 2005 [Epub 26 April 2005][Medline]
  35. Sund NJ, Vatamaniuk MZ, Casey M, Ang SL, Magnuson MA, Stoffers DA, Matschinsky FM, Kaestner KH: Tissue-specific deletion of Foxa2 in pancreatic beta cells results in hyperinsulinemic hypoglycemia. Genes Dev 15:1706–1715, 2001[Abstract/Free Full Text]
  36. Ahlgren U, Pfaff S, Jessel TM, Edlund T, Edlund H: Independent requirement for ISL1 in the formation of the pancreatic mesenchyme and islet cells. Nature 385:257–260, 1997[Medline]
  37. Gradwohl G, Dierich A, LeMeur M, Guillemot F.: Neurogenin3 is required for the development of the four endocrine cell lineages of the pancreas. Proc Natl Acad Sci U S A 97:1607–1611, 2000[Abstract/Free Full Text]
  38. Slack JM: Developmental biology of the pancreas. Development 121:1569–1580, 1995[Abstract]
  39. Han JH, Rall L, Rutter WJ: Selective expression of rat pancreatic genes during embryonic development. Proc Natl Acad Sci U S A 83:110–114, 1986[Abstract/Free Full Text]
  40. Dahl U, Sjödin A, Semb H: Cadherins regulate aggregation of pancreatic beta-cells in vivo. Development 122:2895–2902, 1996[Abstract]
  41. Rouiller DG, Cirulli V, Halban PA: Uvomorulin mediates calcium-dependent aggregation of islet cells, whereas calcium-independent cell adhesion molecules distinguish between islet cell types. Dev Biol 148:233–242, 1991[Medline]
  42. Murakami A, Shen H, Ishida S, Dickson C: SOX7 and GATA-4 are competitive activators of Fgf-3 transcription. J Biol Chem 279:28564–28573, 2004[Abstract/Free Full Text]
  43. Futaki S, Hayashi Y, Yamashita M, Yagi K, Bono H, Hayashizaki Y, Okazaki Y, Sekiguchi K: Molecular basis of constitutive production of basement membrane components: gene expression profiles of Engelbreth-Holm-Swarm tumor and F9 embryonal carcinoma cells. J Biol Chem 278:50691–50701, 2003[Abstract/Free Full Text]
  44. McGrath KE, Palis J: Expression of homeobox genes, including an insulin promoting factor, in the murine yolk sac at the time of hematopoietic initiation. Mol Reprod Dev 48:145–153, 1997[Medline]
  45. Liao WS, Conn AR, Taylor JM: Changes in rat a 1-fetoprotein and albumin mRNA levels during fetal and neonatal development. J Biol Chem 255:10036–10039, 1980[Abstract/Free Full Text]
  46. Muglia L, Locker L: Developmental regulation of albumin and a-fetoprotein gene expression in the rat. Nucleic Acids Res 12:6751–6762, 1984[Abstract/Free Full Text]
  47. Gaber AO, Fraga D, Kotb M, Lo A, Sabek O, Latif K: Human islet graft function in NOD-SCID mice predicts clinical response in islet transplant recipients. Transplant Proc 36:1108–1110, 2004[Medline]
  48. Clausen JO, Borch-Johnsen K, Ibsen H, Bergman RN, Hougaard P, Winther K, Pedersen O: Insulin sensitivity index, acute insulin response, and glucose effectiveness in a population-based sample of 380 young healthy Caucasians analysis of the impact of gender, body fat, physical fitness, and life-style factors. J Clin Invest 98:1195–1209, 1996[Medline]
  49. Piper K, Brickwood S, Turnpenny LW, Cameron IT, Ball SG, Wilson DI, Hanley NA: Beta cell differentiation during early human pancreas development. J Endocrinol 181:11–23, 2004[Abstract]

Add to CiteULike CiteULike   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
DiabetesHome page
J. J. Meier, A. E. Butler, Y. Saisho, T. Monchamp, R. Galasso, A. Bhushan, R. A. Rizza, and P. C. Butler
{beta}-Cell Replication Is the Primary Mechanism Subserving the Postnatal Expansion of {beta}-Cell Mass in Humans
Diabetes, June 1, 2008; 57(6): 1584 - 1594.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
B. Blum and N. Benvenisty
Clonal Analysis of Human Embryonic Stem Cell Differentiation into Teratomas
Stem Cells, August 1, 2007; 25(8): 1924 - 1930.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
M. Mimeault and S. K. Batra
Concise Review: Recent Advances on the Significance of Stem Cells in Tissue Regeneration and Cancer Therapies
Stem Cells, November 1, 2006; 24(11): 2319 - 2345.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
M. Leslie
The action behind the words: embryonic stem cell research marches on
J. Cell Biol., September 11, 2006; 174(6): 743 - 746.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
A. Trounson
The Production and Directed Differentiation of Human Embryonic Stem Cells
Endocr. Rev., April 1, 2006; 27(2): 208 - 219.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brolén, G. K.C.
Right arrow Articles by Semb, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brolén, G. K.C.
Right arrow Articles by Semb, H.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE