Diabetes
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Published online August 13, 2007
Diabetes 56:2744-2752, 2007
DOI: 10.2337/db07-0563
© 2007 by the American Diabetes Association
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
db07-0563v1
db07-0563v2
56/11/2744    most recent
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wideman, R. D.
Right arrow Articles by Kieffer, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wideman, R. D.
Right arrow Articles by Kieffer, T. J.
Social Bookmarking
Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A Switch From Prohormone Convertase (PC)-2 to PC1/3 Expression in Transplanted {alpha}-Cells Is Accompanied by Differential Processing of Proglucagon and Improved Glucose Homeostasis in Mice

Rhonda D. Wideman1, Scott D. Covey1, Gene C. Webb2, Daniel J. Drucker3, and Timothy J. Kieffer1,4

1 Department of Cellular and Physiological Sciences, Laboratory of Molecular and Cellular Medicine, Life Sciences Institute, University of British Columbia, Vancouver, British Columbia, Canada
2 Department of Medicine, University of Chicago, Chicago, Illinois
3 Department of Medicine, Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Banting and Best Diabetes Centre, University of Toronto, Toronto, Ontario, Canada
4 Department of Surgery, Laboratory of Molecular and Cellular Medicine, Life Sciences Institute, University of British Columbia, Vancouver, British Columbia, Canada

Address correspondence and reprint requests to Dr. Timothy J. Kieffer, 2350 Health Sciences Mall, Vancouver, British Columbia, V6T 1Z3. E-mail: tim.kieffer{at}ubc.ca

Abbreviations: AUC, area under the curve; GLP, glucagon-like peptide; IPGTT, intraperitoneal glucose tolerance test; PC, prohormone convertase; PCNA, proliferating cell nuclear antigen; PGDP, proglucagon-derived peptide; STZ, streptozotocin


   ABSTRACT
TOP
 ABSTRACT
RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
OBJECTIVE—Glucagon, which raises blood glucose levels by stimulating hepatic glucose production, is produced in {alpha}-cells via cleavage of proglucagon by prohormone convertase (PC)-2. In the enteroendocrine L-cell, proglucagon is differentially processed by the alternate enzyme PC1/3 to yield glucagon-like peptide (GLP)-1, GLP-2, and oxyntomodulin, which have blood glucose–lowering effects. We hypothesized that alteration of PC expression in {alpha}-cells might convert the {alpha}-cell from a hyperglycemia-promoting cell to one that would improve glucose homeostasis.

RESEARCH DESIGN AND METHODS—We compared the effect of transplanting encapsulated PC2-expressing {alpha}TC-1 cells with PC1/3-expressing {alpha}TC{Delta}PC2 cells in normal mice and low-dose streptozotocin (STZ)-treated mice.

RESULTS—Transplantation of PC2-expressing {alpha}-cells increased plasma glucagon levels and caused mild fasting hyperglycemia, impaired glucose tolerance, and {alpha}-cell hypoplasia. In contrast, PC1/3-expressing {alpha}-cells increased plasma GLP-1/GLP-2 levels, improved glucose tolerance, and promoted ß-cell proliferation. In GLP-1R–/– mice, the ability of PC1/3-expressing {alpha}-cells to improve glucose tolerance was attenuated. Transplantation of PC1/3-expressing {alpha}-cells prevented STZ-induced hyperglycemia by preserving ß-cell area and islet morphology, possibly via stimulating ß-cell replication. However, PC2-expressing {alpha}-cells neither prevented STZ-induced hyperglycemia nor increased ß-cell proliferation. Transplantation of {alpha}TC{Delta}PC2, but not {alpha}TC-1 cells, also increased intestinal epithelial proliferation.

CONCLUSIONS—Expression of PC1/3 rather than PC2 in {alpha}-cells induces GLP-1 and GLP-2 production and converts the {alpha}-cell from a hyperglycemia-promoting cell to one that lowers blood glucose levels and promotes islet survival. This suggests that alteration of proglucagon processing in the {alpha}-cell may be therapeutically useful in the context of diabetes.

The proglucagon precursor gives rise to numerous peptides belonging to the glucagon superfamily of hormones (1). Despite significant peptide sequence homology, members of this superfamily exert diverse and sometimes opposing regulatory functions. Proglucagon is expressed in pancreatic {alpha}-cells, intestinal L-cells, and specific neurons in the central nervous system. Tissue-specific posttranslational processing by prohormone convertase (PC)-1/3 or PC2 results in a different profile of proglucagon-derived peptides (PGDPs) in these tissues. Thus, as a result of cleavage by PC2, the major bioactive PGDP arising in pancreatic {alpha}-cells is glucagon (2,3), which serves as a counterregulatory hormone opposing insulin action by increasing hepatic glucose output. While the activity of glucagon is critical for preventing hypoglycemia under normal conditions, hyperglucagonemia accompanies diabetes and may contribute to its pathology (4). Indeed, suppression of glucagon action using immunoneutralization, antisense oligonucleotides, or glucagon receptor antagonists improves glucose handling in both rodents (5,6) and humans (7,8).

In contrast to the {alpha}-cell, in the enteroendocrine L-cell and the brain, glucagon-like peptide (GLP)-1, GLP-2, and oxyntomodulin are released from proglucagon via the alternate processing enzyme PC1/3 (9,10). GLP-1 elicits effects that tend to lower blood glucose, including stimulation of insulin synthesis and secretion, inhibition of gastric emptying and food intake, and promotion of ß-cell survival and proliferation (1,11). This complement of antidiabetic effects has led to much interest in developing long-acting GLP-1 mimetics as a treatment for diabetes. GLP-2 and oxyntomodulin also tend to lower blood glucose levels by promoting satiety and inhibiting gastric emptying (12,13). Thus, depending on whether it is processed by PC2 or PC1/3, proglucagon gives rise to products having either glucose-raising or glucose-lowering effects.

We hypothesized that expression of PC1/3 rather than PC2 in {alpha}-cells might shift the PGDP profile to become more like that of the L-cell and thereby convert the {alpha}-cell from a hyperglycemia-promoting cell to one that would lower blood glucose levels. We therefore sought to directly compare the in vivo effects of PC2- versus PC1/3-derived PGDPs on glucose homeostasis, ß-cell survival, and morphology of the pancreas and jejunum in normal mice and in a mouse model of type 1 diabetes.


   RESEARCH DESIGN AND METHODS
TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Tissue culture media, antibiotics, and fetal bovine serum were obtained from Invitrogen Canada (Burlington, Ontario, Canada). Active GLP-1 enzyme-linked immunosorbent assay, total GLP-1 radioimmunoassay, and glucagon radioimmunoassay kits were from Linco Research (St. Charles, MO). Glucagon and GLP-2 enzyme immunoassay kits were from Alpco Diagnostics (Salem, NH). Western blotting reagents were from GE Healthcare (Buckinghamshire, U.K.). {alpha}TC-1 (clone 9) cells were from the American Type Culture Collection. Imaging and quantification was performed using an Axiovert 200 microscope (Carl Zeiss, Toronto, Ontario, Canada) connected to a digital camera (Retiga 2000R; QImaging, Burnaby, British Columbia, Canada) controlled with Openlab 5.0 software (Improvision, Lexington, MA).

Cell culture and analysis.
{alpha}TC{Delta}PC2 cells are an {alpha}-cell line derived from mice lacking active PC2, precluding glucagon production, and have been described previously (14). {alpha}TC-1 and {alpha}TC{Delta}PC2 cells were cultured in high-glucose Dulbecco’s modified Eagle medium containing 10% fetal bovine serum, 100 units/ml penicillin, and 100 µg/ml streptomycin. Cells were maintained at 37°C/5% CO2, with media refreshment every 2–4 days. Experiments were performed using passages 10–14 or 20–29 for {alpha}TC-1 and {alpha}TC{Delta}PC2 cells, respectively. Cells were seeded at equal density in six-well plates, and media were collected after a 24-h static incubation and assayed for glucagon or active GLP-1 content. Equal amounts of protein from cell lysates were electrophoresed on a 10% polyacrylamide gel and transferred to a 0.2-µm polyvinylidene difluoride membrane (Bio-Rad, Hercules, CA). After blocking (5% milk powder in TBS + 0.1% Tween-20), the membrane was incubated with anti-PC1/3 antiserum (1:1,000) and developed using horseradish peroxidase–conjugated secondary antibody (1:5,000) and chemiluminescence reagents.

Animal experiments.
Male mice, age 8–10 weeks, were used for all experiments. CD-1 mice were from the University of British Columbia Animal Care Facility, and C57BL/6 mice were from Jackson Laboratories (Bar Harbor, ME). All experiments were approved by the University of British Columbia Animal Care Committee. Mice were maintained on a standard 12-h light/dark cycle and received a standard diet. Blood glucose and body weight were monitored two to three times weekly after a 4-h morning fast. Blood glucose monitoring and survival blood sampling was carried out on restrained unanaesthetized mice via the saphenous vein.

GLP-1R–/– mice (15) and wild-type littermates were maintained on a C57BL/6 background and genotyped using PCR primers that amplify 437 bp of the GLP-1R in transmembrane domains 2–4, the region disrupted in mice bearing a knockout allele (16) (forward 5'TACACAATGGGGAGCCCCTA3'; reverse 5'AAGTCATGGGATGTGTCTGGA3') and primers that amplify 280 bp of the NeoR insert (forward 5'CTTGGGTGGAGAGGCTATTC3'; reverse 5'AGGTGAGATGACAGGAGATC3'). PCR was carried out as follows using standard reaction mix with 1.5 mmol/l MgCl2: 2 min at 94°C; 30 cycles of 94°C for 1 min, 61°C for 1 min, and 72°C for 1 min; and 72°C for 10 min. Wild-type mice had a single 437-bp product, GLP-1R–/– mice had a single 280-bp product, and GLP-1R+/– mice had both products.

Encapsulation and transplantation of cells.
Cells were grown to ~80% confluence. After trypsinization, cells were washed in PBS without CaCl2, and a cell count was performed using a hematocytometer. Cells were resuspended in a mixture of 1.5% sodium alginate (IE-1010; Inotech Biosystems International, Rockville, MD) and morpholinepropanesulfonic acid, transferred to a sterile encapsulator (Inotech Biosystems International), and encapsulated according to the manufacturer’s instructions. Capsules (~700 µm) were washed in PBS without CaCl2 and loaded to sterile syringes attached to 18-G catheters. Recipient mice were anesthetized using isoflurane, and an incision was made midway between the ventral midline and the animal’s side, ~1.5 cm anterior of the hind leg. Capsules were injected to the intraperitoneal cavity, and the musculature and skin were closed with a running suture and a wound clip, respectively. For all experiments, 1.4–2.2 ml of capsules (~4.0 x 107 cells/mouse) were transplanted in <3 ml total volume. Transplants were completed within 1.5 h of cell encapsulation. Sham-operated mice received an equal volume of sterile saline under identical conditions.

In vivo glucose tolerance testing.
Glucose tolerance tests were performed by oral gavage (oral glucose tolerance test) or intraperitoneal (intraperitoneal glucose tolerance test [IPGTT]) delivery of glucose (2 g/kg) to recipient mice after an overnight fast. Blood glucose was monitored for 2 h after glucose delivery. Where blood glucose levels exceeded the limit of detection for the blood glucose meter, samples were diluted 1:2 in saline.

Streptozotocin treatment of C57BL/6 mice.
Streptozotocin (STZ) (Sigma, St. Louis, MO) was prepared in citrate buffer (pH 4.5) and delivered by intraperitoneal injection (50 mg/kg) for 5 consecutive days beginning 8 days posttransplant in C57BL/6 mice.

Plasma and tissue analysis of transplant recipients.
At the indicated time after transplantation, mice were anesthetized with isoflurane, and a cardiac puncture was performed to collect plasma before cervical dislocation. Pancreas and jejunum (8–10 cm distal to the pylorus) were removed, rinsed in PBS, fixed in 4% paraformaldehyde, and paraffin sectioned at 3 µm. Plasma analytes were measured using total GLP-1 radioimmunoassay, GLP-2 enzyme immunoassay, and/or glucagon enzyme immunoassay kits.

Histology and morphometric analysis.
After antigen retrieval in citrate buffer, pancreas sections were stained using guinea pig anti-insulin (1:900; Linco Research, St. Charles, MO), rabbit anti-glucagon (1:1,800; Sigma), mouse anti–proliferating cell nuclear antigen (PCNA) (1:200; BD Biosciences, San Jose, CA), and secondary antisera conjugated to Alexafluor 488 or 594 (1:800). Total insulin-/glucagon-positive area, as well as the number and average size of insulin-/glucagon-positive clusters, were determined in one section per mouse and normalized for sectional pancreatic area. The proportions of {alpha}- and ß-cells per islet were determined by counting nuclei of all glucagon- and insulin-positive cells of five or more randomly selected islets for each mouse. {alpha}-Cells within two cells of the islet edge were considered "peripheral " and otherwise were considered "central." Some sections were costained for insulin and PCNA, and the number of insulin-positive/PCNA-positive cells was quantified in seven or more randomly selected islets per animal.

Jejunal crypt cell proliferation was assessed using a method described elsewhere (17). Sections were stained for PCNA, and for six or more upright intact crypts per mouse, the first 20 cells extending upward from the crypt base (position 1) were scored as PCNA– or PCNA+. Crypt plus villus height was determined by measuring from the crypt base to the tip of the villus in 4–10 upright intact villi in hematoxylin-stained sections for each mouse.

Statistical analysis.
Data are presented as means ± SE and were analyzed using the Student’s t test or ANOVA with Bonferroni’s post-test as appropriate (P < 0.05, P < 0.01, P < 0.001).


   RESULTS
TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Characterization of {alpha}-cell lines expressing PC2 or PC1/3.
To study the impact of expression of PC2 versus PC1/3 in the {alpha}-cell, we used two different {alpha}-cell lines. Using immunocytochemistry and immunoblotting, we confirmed that {alpha}TC-1 cells express PC2 (data not shown) but little or no PC1/3; {alpha}TC{Delta}PC2 cells, in contrast, express PC1/3 but not bioactive PC2 (Fig. 1A and B). Consistent with minimal PC1/3 expression, {alpha}TC-1 cells secreted very little GLP-1 compared with PC1/3-expressing {alpha}TC{Delta}PC2 cells (Fig. 1C) (6.6 ± 1.7 vs. 276.9 ± 96.0 ng/ml; n ≥ 2). However, {alpha}TC-1 cells secreted 10-fold more glucagon than {alpha}TC{Delta}PC2 cells (Fig. 1C) (113.0 ± 9.6 vs. 10.0 ± 1.9 ng/ml; n ≥ 2). Thus, these cells allowed us to compare the in vivo effects of transplanting {alpha}-cells expressing either PC1/3 or PC2.


Figure 1
View larger version (28K):
[in this window]
[in a new window]

  		FIG. 1. {alpha}TC-1 cells express PC2 and produce glucagon, whereas {alpha}TC{Delta}PC2 cells express PC1/3 and produce GLPs and oxyntomodulin. A: Proglucagon processing in {alpha}-cells expressing either PC2 or PC1/3. In PC2-expressing {alpha}TC-1 cells, proglucagon is processed to yield glucagon as the major bioactive product. PC1/3-expressing {alpha}TC{Delta}PC2 cells process proglucagon differently, resulting in GLP-1 production and action of GLP-1, GLP-2, and oxyntomodulin. B: Western blot for PC1/3 in {alpha}TC-1 and {alpha}TC{Delta}PC2 cell lysates. Blot is representative of four or more experiments. C: GLP-1 and glucagon (GLU) secretion from {alpha}TC-1 and {alpha}TC{Delta}PC2 cells (n ≥ 2). *P < 0.05, **P < 0.01. GRPP, glicentin-related polypeptide; IP, intervening peptide; MPGF, major proglucagon fragment.

 
Transplantation of PC2- or PC1/3-expressing {alpha}-cells to normal and GLP-1R–/– mice.
We sought to compare the impact of transplantation of PC2-expressing ({alpha}TC-1) or PC1/3-expressing ({alpha}TC{Delta}PC2) {alpha}-cells in normal mice. {alpha}TC-1 recipients had slightly increased fasting blood glucose levels during the 14 days after transplant (Fig. 2A) (P = 0.06 at 8 days; P = 0.054 at 12 days; P < 0.05 at 14 days; n ≥ 7), whereas blood glucose of {alpha}TC{Delta}PC2 recipients was slightly lower than that of sham-operated mice 2 days posttransplant (8.3 ± 0.2 vs. 9.0 ± 0.2 mmol/l, respectively; P < 0.05; n = 8) but not different thereafter. Body weights were not different among the three groups (data not shown).


Figure 2
View larger version (21K):
[in this window]
[in a new window]

  		FIG. 2. Transplantation with encapsulated {alpha}TC{Delta}PC2 cells improves glucose tolerance in normal mice. A–C: CD-1 mice were transplanted with 4.0 x 107 {alpha}TC{Delta}PC2 or {alpha}TC-1 cells (n ≥ 6). A: Four-hour morning fasted blood glucose. B: IPGTT (2 g/kg) performed 6 days posttransplant. C: AUC for IPGTT. #P < 0.05 ({alpha}TC-1 vs. sham), *P < 0.05, **P < 0.01, ***P < 0.001 ({alpha}TC{Delta}PC2 vs. sham). D–F: IPGTT (2 g/kg) performed in GLP-1R+/+ (D) or GLP-1R–/– (E) mice 7 days posttransplantation with 4.0 x 107 {alpha}TC{Delta}PC2 cells (n = 5–10). F: AUC for IPGTTs. *P < 0.05 ({alpha}TC{Delta}PC2 vs. sham).

 
Glucose handling was assessed using an IPGTT 7 days posttransplant (Fig. 2B). While sham-operated mice and {alpha}TC-1 recipients behaved similarly, {alpha}TC{Delta}PC2 recipients had a dramatic improvement in glucose tolerance, with both lower peak glucose levels (10.0 ± 0.2 vs. 16.7 ± 1.9 mmol/l for sham at 15 min; n ≥ 7) and a 41% decrease in area under the curve (AUC) (Fig. 2C). To assess the contribution of GLP-1R signaling to the improved glucose tolerance observed after {alpha}TC{Delta}PC2 transplant, we repeated transplant studies in GLP-1R–/– mice and wild-type littermates. GLP-1R+/+ mice receiving {alpha}TC{Delta}PC2 cells had a 33% decrease in peak glucose levels and a 25% decrease in AUC in an IPGTT performed 7 days posttransplant (Fig. 2D and F). In contrast, GLP-1R–/– mice receiving {alpha}TC{Delta}PC2 cells had a mild decrease in peak glucose and no change in AUC compared with controls (Fig. 2E and F).

Sixteen days posttransplant, CD-1 mice were killed and pancreas tissue collected for histological examination. Sham-operated and {alpha}TC-1 and {alpha}TC{Delta}PC2 recipients had similar total and average insulin-positive area and number of insulin-positive areas (Fig. 3A–E). However, {alpha}TC-1 recipients had relatively fewer {alpha}-cells per islet (Fig. 3F) and a trend toward decreased total glucagon-positive area (P = 0.11) owing to decreased average size of glucagon-positive areas (Fig. 3G–I).


Figure 3
View larger version (31K):
[in this window]
[in a new window]

  		FIG. 3. Morphometric analysis of pancreata from mice transplanted with encapsulated {alpha}TC{Delta}PC2 or {alpha}TC-1 cells. CD-1 mice transplanted with {alpha}TC{Delta}PC2 or {alpha}TC-1 cells were killed 16 days posttransplant (n ≥ 4). A: Insulin (green) and glucagon (red) in representative islets from transplant recipients. Scale bar = 100 µm. B: Total insulin-positive area per section, expressed as percentage of sectional pancreas area. C: Number of insulin-positive clusters per section, normalized for sectional pancreas area. D: Islet number, stratified by islet size, expressed as percentage of total islets per section. {square}, >2,500 µm2; blk12, 2,501–10,000 µm2; {blacksquare}, 10,001–50,000 µm2; Figure 3, >50,001 µm2. E: Average size of an individual insulin-positive area (µm2). F: Proportion of {alpha}- and ß-cells, expressed as percentage of total {alpha}- and ß-cells per islet. G: Total glucagon-positive area per section, expressed as percentage of sectional pancreas area. H: Number of glucagon-positive clusters per section, normalized for sectional pancreas area. I: Average size of an individual glucagon-positive area. *P < 0.05 (sham vs. {alpha}TC-1). #P < 0.05 ({alpha}TC{Delta}PC2 vs. {alpha}TC-1). (Please see http://dx.doi.org/10.2337/db07-0563 for a high-quality digital representation of this figure.)

 
Administration of multiple low-dose STZ to mice after {alpha}TC{Delta}PC2 or {alpha}TC-1 cell transplant.
Because transplantation of PC1/3-expressing {alpha}TC{Delta}PC2 cells or PC2-expressing {alpha}TC-1 cells resulted in opposite effects on glucose homeostasis in nondiabetic mice, we sought to examine the impact of {alpha}TC{Delta}PC2 or {alpha}TC-1 cells in a mouse model of type 1 diabetes. C57BL/6 mice received sham surgery or encapsulated {alpha}TC{Delta}PC2 or {alpha}TC-1 cells on day 0, and a low-dose regimen of the ß-cell toxin STZ was administered from 8–12 days posttransplant. {alpha}TC{Delta}PC2 recipients exhibited lower fasting blood glucose levels than sham-operated mice even before STZ was administered, and whereas control mice developed mild diabetes within ~10 days of the last dose of STZ, {alpha}TC{Delta}PC2 recipients did not progress to diabetes (Fig. 4A). Body weights of control mice and {alpha}TC{Delta}PC2 recipients did not differ (Fig. 4B). An IPGTT was performed 7 days post-transplant (before STZ administration), and consistent with our observations in CD-1 mice, {alpha}TC{Delta}PC2 recipients exhibited a dramatic improvement in glucose tolerance, with lower blood glucose levels at all time points and a 55.6% decrease in AUC (Fig. 4C). Plasma GLP-1 was measured in blood samples collected just before glucose administration, and whereas GLP-1 was below the level of detection in control mice (<8.9 pg/ml), {alpha}TC{Delta}PC2 recipients had plasma GLP-1 levels of 297.7 ± 36.7 pg/ml (n ≥ 6). In an oral glucose tolerance test performed 20 days posttransplant (just before STZ-induced diabetes onset), {alpha}TC{Delta}PC2 recipients again displayed improved glucose disposal, with lower peak blood glucose values and a 24.9% decrease in AUC (Fig. 4D).


Figure 4
View larger version (21K):
[in this window]
[in a new window]

  		FIG. 4. Transplantation of encapsulated {alpha}TC{Delta}PC2 cells prevents hyperglycemia onset in multiple low-dose STZ-treated mice. C57BL/6 mice received sham surgery or cell transplant on day 0 and daily STZ (50 mg/kg) from days 8 to 12 inclusive (n ≥ 8). Four-hour morning fasted blood glucose (A) and body weight (B) of recipients is shown. C: IPGTT (2 g/kg) performed 7 days posttransplant. Inset: AUC. D: Oral glucose tolerance test (2 g/kg) performed 20 days posttransplant. Inset: AUC. *P < 0.05, **P < 0.01, ***P < 0.001 compared with sham.

 
In contrast to {alpha}TC{Delta}PC2 recipients, {alpha}TC-1–transplanted mice had consistently higher blood glucose levels than sham-operated controls following transplant (Fig. 5A). An IPGTT was performed 7 days posttransplant, and unlike {alpha}TC{Delta}PC2 recipients, {alpha}TC-1 recipients exhibited impaired glucose tolerance relative to control mice, with higher peak blood glucose levels and a 53.0% increase in AUC (Fig. 5C). Plasma glucagon was measured in blood samples collected just before glucose administration, and {alpha}TC-1 recipients had threefold greater glucagon levels than controls (799.6 ± 60.2 pg/ml vs. 246.6 ± 41.2 pg/ml; n = 8; P < 0.001). In response to STZ treatment, {alpha}TC-1 recipients developed hyperglycemia similar to control mice (Fig. 5A). Finally, an oral glucose tolerance test was performed 20 days posttransplant, and in contrast to {alpha}TC{Delta}PC2 recipients, {alpha}TC-1 recipients did not exhibit improved glucose handling (Fig. 5D).


Figure 5
View larger version (21K):
[in this window]
[in a new window]

  		FIG. 5. Transplantation of encapsulated {alpha}TC-1 cells does not prevent hyperglycemia in multiple low-dose STZ-treated mice. C57BL/6 mice received sham surgery or cell transplant on day 0 and daily STZ (50 mg/kg) from days 8 to 12 inclusive (n ≥ 8). Four-hour morning fasted blood glucose (A) and body weight (B) of recipients is shown. C: IPGTT (2 g/kg) performed 7 days posttransplant. Inset: AUC. D: Oral glucose tolerance test (2 g/kg) performed 20 days posttransplant. Inset: AUC. *P < 0.05, **P < 0.01, ***P < 0.001 compared with sham.

 
Plasma and histological analysis of STZ-treated {alpha}TC{Delta}PC2 or {alpha}TC-1 recipient mice.
Mice were killed 30 days posttransplant, and plasma and pancreatic tissue were collected for further analysis. {alpha}TC{Delta}PC2-treated mice had threefold higher plasma GLP-1 and 1.8-fold greater plasma GLP-2 levels than sham-operated controls at this time (177.7 ± 56.5 vs. 59.9 ± 12.0 pg/ml for GLP-1, n ≥ 5; 1.3 ± 0.2 vs. 0.7 ± 0.02 ng/ml for GLP-2; n ≥ 8). {alpha}TC-1 recipients had 8.3-fold higher plasma glucagon levels than controls (494.6 ± 164.7 vs. 59.77 ± 11.37 pg/ml; n = 8).

Histological examination of the pancreas revealed that sham-operated STZ-treated mice had relatively more {alpha}-cells and fewer ß-cells per islet than did {alpha}TC{Delta}PC2-transplanted STZ-treated mice (Fig. 6A and B). Sham-operated mice exhibited disrupted islet architecture, with more centrally located {alpha}-cells, whereas mice receiving {alpha}TC{Delta}PC2 cells were protected against this STZ-induced abnormality (28.0 ± 3.2 vs. 15.8 ± 1.6%, respectively; P < 0.01; n ≥ 7). {alpha}TC{Delta}PC2 recipients tended to have more insulin-positive pancreatic area (P = 0.062) and, on average, larger islets, although the number of islets was unchanged (Fig. 6C–E). {alpha}TC{Delta}PC2 recipients also displayed an increased number of replicating (i.e., PCNA+) ß-cells as a percentage of total ß-cells (Fig. 6F–G).


Figure 6
View larger version (24K):
[in this window]
[in a new window]

  		FIG. 6. Morphometric analysis of pancreata from STZ-treated mice receiving encapsulated {alpha}TC{Delta}PC2 cells. Mice were killed 30 days posttransplant (n ≥ 3). A: Insulin (green) and glucagon (red) in representative islets from recipients. Scale bar = 100 µm. B: Proportion of {alpha}- and ß-cells in islets, expressed as percentage of total combined {alpha}- and ß-cells per islet. C: Total insulin-positive area, expressed as percentage of sectional pancreas area. D: Average area of an individual insulin-positive region. E: Number of insulin-positive areas per animal, normalized for sectional pancreas area. F: Insulin (green) and PCNA (red) staining in representative islets from recipients. Scale bar = 50 µm. Arrow identifies a PCNA+ ß-cell. G: Number of PCNA+ ß-cells, expressed as a percentage of total insulin-positive cells. *P < 0.05 vs. sham. (Please see http://dx.doi.org/10.2337/db07-0563 for a high-quality digital representation of this figure.)

 
STZ-treated {alpha}TC-1–transplanted mice also displayed relatively fewer {alpha}-cells and more ß-cells per islet (Fig. 7A and B). Sham-operated mice had more centrally located {alpha}-cells than did {alpha}TC-1 recipients (28.8 ± 1.8 vs. 16.7 ± 2.4% of {alpha}-cells, respectively; P < 0.01; n ≥ 7). However, whereas {alpha}TC-1 recipients exhibited no change in insulin-positive area, islet size, or islet number relative to sham-operated controls (Fig. 7C–E), they tended to have decreased total glucagon-positive pancreatic area (Fig. 7F; P = 0.068). The average glucagon-positive area per islet was decreased in {alpha}TC-1 recipients, although the number of glucagon-positive areas was unchanged (Fig. 7G and H). ß-Cell replication as assessed by insulin/PCNA costaining was not altered in {alpha}TC-1 recipients relative to controls (data not shown).


Figure 7
View larger version (19K):
[in this window]
[in a new window]

  		FIG. 7. Morphometric analysis of pancreata from STZ-treated mice receiving encapsulated {alpha}TC-1 cells. Mice were killed 30 days posttransplant (n ≥ 6). A: Insulin (green) and glucagon (red) in representative islets from recipients. Scale bar = 100 µm. B: Proportion of {alpha}- and ß-cells in islets, expressed as percentage of total combined {alpha}- and ß-cells per islet. C: Total insulin-positive area per animal, expressed as percentage of sectional pancreas area. D: Average area of an individual insulin-positive cluster. E: Number of insulin-positive areas, normalized for sectional pancreas area. F: Total glucagon-positive area per section, expressed as percentage of sectional pancreas area. G: Average size of an individual glucagon-positive area. H: Number of glucagon-positive areas, normalized for sectional pancreas area. *P < 0.05, **P < 0.01 vs. sham. (Please see http://dx.doi.org/10.2337/db07-0563 for a high-quality digital representation of this figure.)

 
We also examined jejunal sections for evidence of possible effects that any {alpha}TC{Delta}PC2–or {alpha}TC-1–derived products might have had on this tissue. Compared with sham-operated controls, {alpha}TC{Delta}PC2 recipients displayed increased crypt plus villus height and increased proliferation (i.e., PCNA+ cells) in the region 16–20 cells up from the crypt base (Fig. 8A and B). In contrast, {alpha}TC-1 recipients displayed no change in crypt plus villus height or crypt cell proliferation compared with their respective controls (Fig. 8C and D).


Figure 8
View larger version (18K):
[in this window]
[in a new window]

  		FIG. 8. Jejunal proliferation in STZ-treated mice receiving encapsulated {alpha}TC{Delta}PC2 or {alpha}TC-1 cells. Jejunal proliferation was assessed in sections prepared from {alpha}TC{Delta}PC2 (A and B) or {alpha}TC-1 (C and D) recipients 30 days posttransplantation. Crypt plus villus height was measured from the base of the crypt to the tip of the villus in duplicate for at least four upright intact villi per animal using a hematoxylin-stained slide (A and C). Distribution of PCNA+ cells in jejunal crypts immunostained for PCNA (B and D). The cell at the midpoint of the crypt base was defined as position 1, and the first 20 cells extending upward from this position were scored as PCNA– (0) or PCNA+ (1). *P < 0.05, **P < 0.01 compared with respective sham.

 

   DISCUSSION
TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In this study, we compared the effect of transplanting {alpha}-cells in which proglucagon was processed as normal via PC2 ({alpha}TC-1) or as in the L-cell via PC1/3 ({alpha}TC{Delta}PC2) (Fig. 1). As has been reported previously (18,19), we observed that {alpha}TC-1 cells express PC2 but not PC1/3 and secrete glucagon but not GLP-1. In contrast, {alpha}TC{Delta}PC2 cells, which lack bioactive PC2 (14), expressed abundant levels of PC1/3 and thus produced high levels of GLP-1 but very little glucagon. The upregulation of PC1/3 in the absence of PC2 seems to be specific to this cell line and not a more general feature of loss of function of PC2 in {alpha}-cells, since there is no apparent induction of PC1/3 expression in the {alpha}-cells of PC2–/– mice (2,20). Robust PC1/3 expression in {alpha}TC{Delta}PC2 cells may reflect developmental arrest induced by transformation at a stage when PC2 and PC1/3 are normally coexpressed in the developing {alpha}-cell (14,20,21). High glucose culture conditions may have further promoted PC1/3 expression in {alpha}TC{Delta}PC2 cells, since hyperglycemia has been shown to increase PC1/3 expression in rodent {alpha}-cells (22).

Alginate encapsulation provides a means of protecting transplanted cells from host immune attack and has been used to achieve long-term maintenance of transplanted islets in models of diabetes (23,24). We used cell encapsulation to allow us to examine the long-term delivery of PC2- versus PC1/3-derived PGDPs in mice in the absence of immunosuppression. Capsules remained interspersed throughout the intraperitoneal cavity of transplant recipients, although beyond ~3–4 weeks posttransplant, capsules occasionally hardened and clumped together. Because at the time of death mice receiving {alpha}TC-1 or {alpha}TC{Delta}PC2 cells still had elevated plasma levels of glucagon and GLP-1, respectively, transplanted cells likely remained viable even 30 days posttransplantation.

CD-1 mice that received transplants of glucagon-producing {alpha}TC-1 cells displayed increased fasting blood glucose levels, whereas mice that received GLP-1–producing {alpha}TC{Delta}PC2 cells exhibited greatly improved glucose tolerance (Fig. 2). Thus, by changing the processing enzyme present in {alpha}-cells from PC2 to PC1/3, transplanted cells were converted from hyperglycemia promoting to causing a robust improvement in glucose homeostasis, even in normal mice that were not glucose intolerant. Transplantation of {alpha}TC{Delta}PC2 cells to GLP-1R–/– mice revealed that the improvement in glucose tolerance observed in normal mice was primarily due to GLP-1R signaling. Given that GLP-1R signaling has been implicated in ß-cell survival (1,11,25), this finding led us to compare the effect of {alpha}TC-1 and {alpha}TC{Delta}PC2 transplantation in a mouse model of diabetes.

In the low-dose STZ model, sham-operated mice developed hyperglycemia 1–2 weeks after STZ administration, and whereas {alpha}TC{Delta}PC2 recipients were protected against diabetes development and had improved glucose tolerance (Fig. 4A), {alpha}TC-1 recipients developed hyperglycemia along with their respective controls and had impaired glucose tolerance (Fig. 5). Histological examination of the pancreas revealed that {alpha}TC{Delta}PC2 recipients had greater insulin-positive area than controls (Fig. 6), whereas {alpha}TC-1 recipients showed no change compared with controls (Fig. 7). Interestingly, sham-operated mice displayed the disrupted islet architecture typical of the multiple low-dose STZ model (26), whereas {alpha}TC{Delta}PC2 recipients did not (Fig. 6). The relative increase in the number of ß-cells per islet, and the increases in islet area and ß-cell replication observed in {alpha}TC{Delta}PC2-treated mice, suggest that a PC1/3-derived PGDP may have stimulated ß-cell replication. GLP-1 is the most likely candidate given its known trophic effects on ß-cell mass (1,11,27). It is possible that GLP-1 produced by the transplanted cells might also have protected islets against STZ-induced apoptosis in the {alpha}TC{Delta}PC2 recipients, consistent with GLP-1’s known pro-survival effect on ß-cells (1,11,25). Further supporting the concept that these effects are mediated by a PC1/3-derived PGDP is the observation that transplanted PC2-expressing {alpha}TC-1 cells afforded no protection against STZ-induced hyperglycemia and did not induce greater insulin-positive area or ß-cell proliferation (Fig. 7).

Consistent with our observations in CD-1 mice transplanted with {alpha}TC-1 cells, {alpha}TC-1–transplanted C57BL/6 mice displayed increased fasting blood glucose levels even before STZ treatment (Fig. 5). {alpha}TC-1 transplant in this model also caused impaired glucose tolerance. It is unclear how transplanted {alpha}TC-1 cells impaired glucose tolerance in C57BL/6 but not CD-1 mice, but it is possible that different genetic backgrounds have different capacities to compensate for hyperglucagonemia. In both models, chronic stimulation of hepatic glucose output by the excessive glucagon coming from the transplanted {alpha}TC-1 cells may have led to the observed perturbations in blood glucose levels. Consistent with the notion that ectopic glucagon decreased the demand for pancreatic glucagon, {alpha}TC-1 recipients exhibited {alpha}-cell hypoplasia in the endogenous pancreas (Figs. 3 and 7). This observation supports previous studies in which {alpha}-cell atrophy resulted secondary to hyperglucagonemia induced by transplantation of a glucagonoma (28,29) or by glucagon minipump (30). Notably, {alpha}-cell hypoplasia was absent in CD-1 mice receiving {alpha}TC{Delta}PC2 transplants, providing further evidence that this was a compensatory adaptation specific to the PC2 product glucagon.

Disorganization of islet architecture and a relative increase in number of {alpha}-cells have been widely reported in models of ß-cell damage or dysfunction (26,31–34). It remains unclear whether these architectural changes reflect true {alpha}-cell hyperplasia or are an artifact of decreased islet size and the inward collapse of islets as ß-cells are destroyed. It is also unknown whether this putative change in {alpha}-cell mass is secondary to hyperglycemia or is directly due to the loss of an intra-islet ß-cell–derived signal. However, in the current study, {alpha}TC-1 recipients were protected against STZ-induced disorganization of islet architecture and {alpha}-cell hyperplasia, even in the face of hyperglycemia. Our studies therefore suggest that hyperglycemia itself is not sufficient to induce islet disorganization and {alpha}-cell hyperplasia.

In addition to GLP-1, it is likely that {alpha}TC{Delta}PC2 cells also produce oxyntomodulin and GLP-2, since these are also products of PC1/3 cleavage and are cosecreted along with GLP-1 from the enteroendocrine L-cell (1,11,35). The observation that {alpha}TC{Delta}PC2 transplant improved glucose tolerance in wild-type, but not GLP-1R–/–, mice suggests that GLP-1 coming from the transplanted cells is the primary PC1/3-derived proglucagon product that mediates this effect. However, since GLP-1R–/– mice receiving {alpha}TC{Delta}PC2 cells had lower blood glucose than controls 15 min after glucose delivery, some other product of {alpha}TC{Delta}PC2 cells may also have beneficial effects on glucose handling. Oxyntomodulin has been reported to stimulate insulin secretion (36,37) and thus is a potential candidate contributing to glucose-lowering effects, although such actions might also be mediated in part through the GLP-1 receptor (38).

STZ-treated {alpha}TC{Delta}PC2 recipients had increased plasma GLP-2 levels relative to controls and hyperplasia of the intestinal epithelium (Fig. 8A and B). Notably, these effects were absent in mice that received {alpha}TC-1 cells, which lack the capacity for GLP-2 production (Fig. 8C and D). Our observations in {alpha}TC{Delta}PC2 recipient mice are consistent with the known role of GLP-2 as a proliferative factor for intestinal enterocytes (11,39,40) and agree with a recent study in which injection of a GLP-2 analog resulted in greater proliferation in the "rapidly proliferating transit zone" defined by cells 11–20 of the jejunal crypts (17). Since a role for GLP-2 in promotion of ß-cell function or survival has not been described (41) and since the GLP-2 receptor has not been localized to the ß-cell (42), we consider it unlikely that GLP-2 acted directly on the ß-cell to contribute significantly to the phenotype of {alpha}TC{Delta}PC2 recipient mice.

In summary, these studies demonstrate that simply switching the PC profile in proglucagon-expressing cells can render them either glucose raising (PC2) or glucose lowering (PC1/3). Transplantation of GLP-1–producing {alpha}TC{Delta}PC2 cells prevented STZ-induced hyperglycemia, which supports the growing body of evidence suggesting that long-term activation of the GLP-1 receptor in mice promotes ß-cell survival and proliferation (25,43,44). We have recently shown that delivery of PC1/3 to islets induces GLP-1 production, improves islet function and survival, and enhances islet transplantation outcomes in STZ-treated mice (45). The current work provides additional evidence that modulation of proglucagon processing in the {alpha}-cell promotes the release of a beneficial profile of PGDPs and could be useful for diabetes therapy. Moreover, {alpha}TC{Delta}PC2 cells provide a model system for studying alternate proglucagon processing and examining the impact of continuous delivery of PC1/3-derived proglucagon products.


   ACKNOWLEDGMENTS
 
This research was funded by grants from the Canadian Diabetes Association, the Canadian Institutes for Health Research, and the Juvenile Diabetes Research Foundation (JDRF). T.J.K. received a Career Development Award from JDRF and scholarship support from the Michael Smith Foundation for Health Research (MSFHR). R.D.W. received scholarship support from MSFHR and the Natural Sciences and Engineering Research Council.

We thank Dr. D. Steiner (University of Chicago) for helpful discussions and Dr. L. Devi (Mount Sinai School of Medicine) for providing PC1/3 antisera. We acknowledge the excellent technical support provided by C. Donald for these studies.


   FOOTNOTES
 
Published ahead of print at http://diabetes.diabetesjournals.org on 17 August 2007. DOI: 10.2337/db07-0563.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received for publication April 23, 2007 and accepted in revised form August 6, 2007


   REFERENCES
TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Kieffer TJ, Habener JF: The glucagon-like peptides. Endocr Rev 20:876–913, 1999[Abstract/Free Full Text]
  2. Furuta M, Zhou A, Webb G, Carroll R, Ravazzola M, Orci L, Steiner DF: Severe defect in proglucagon processing in islet A-cells of prohormone convertase 2 null mice. J Biol Chem 276:27197–27202, 2001[Abstract/Free Full Text]
  3. Rouille Y, Bianchi M, Irminger JC, Halban PA: Role of the prohormone convertase PC2 in the processing of proglucagon to glucagon. FEBS Lett 413:119–123, 1997[Medline]
  4. Unger RH: Glucagon in pathogenesis of diabetes (Letter). Lancet 1:1036–1032, 1975[Medline]
  5. Sorensen H, Brand CL, Neschen S, Holst JJ, Fosgerau K, Nishimura E, Shulman GI: Immunoneutralization of endogenous glucagon reduces hepatic glucose output and improves long-term glycemic control in diabetic ob/ob mice. Diabetes 55:2843–2848, 2006[Abstract/Free Full Text]
  6. Sloop KW, Cao JX, Siesky AM, Zhang HY, Bodenmiller DM, Cox AL, Jacobs SJ, Moyers JS, Owens RA, Showalter AD, Brenner MB, Raap A, Gromada J, Berridge BR, Monteith DK, Porksen N, McKay RA, Monia BP, Bhanot S, Watts LM, Michael MD: Hepatic and glucagon-like peptide-1-mediated reversal of diabetes by glucagon receptor antisense oligonucleotide inhibitors. J Clin Invest 113:1571–1581, 2004[Medline]
  7. Shah P, Vella A, Basu A, Basu R, Schwenk WF, Rizza RA: Lack of suppression of glucagon contributes to postprandial hyperglycemia in subjects with type 2 diabetes mellitus. J Clin Endocrinol Metab 85:4053–4059, 2000[Abstract/Free Full Text]
  8. Petersen KF, Sullivan JT: Effects of a novel glucagon receptor antagonist (Bay 27-9955) on glucagon-stimulated glucose production in humans. Diabetologia 44:2018–2024, 2001[Medline]
  9. Rouille Y, Kantengwa S, Irminger JC, Halban PA: Role of the prohormone convertase PC3 in the processing of proglucagon to glucagon-like peptide 1. J Biol Chem 272:32810–32816, 1997[Abstract/Free Full Text]
  10. Zhu X, Zhou A, Dey A, Norrbom C, Carroll R, Zhang C, Laurent V, Lindberg I, Ugleholdt R, Holst JJ, Steiner DF: Disruption of PC1/3 expression in mice causes dwarfism and multiple neuroendocrine peptide processing defects. Proc Natl Acad Sci U S A 99:10293–10298, 2002[Abstract/Free Full Text]
  11. Drucker DJ: The biology of incretin hormones. Cell Metab 3:153–165, 2006[Medline]
  12. Wynne K, Bloom SR: The role of oxyntomodulin and peptide tyrosine-tyrosine (PYY) in appetite control. Nat Clin Pract Endocrinol Metab 2:612–620, 2006[Medline]
  13. Meier JJ, Nauck MA, Pott A, Heinze K, Goetze O, Bulut K, Schmidt WE, Gallwitz B, Holst JJ: Glucagon-like peptide 2 stimulates glucagon secretion, enhances lipid absorption, and inhibits gastric acid secretion in humans. Gastroenterology 130:44–54, 2006[Medline]
  14. Webb GC, Dey A, Wang J, Stein J, Milewski M, Steiner DF: Altered proglucagon processing in an alpha-cell line derived from prohormone convertase 2 null mouse islets. J Biol Chem 279:31068–31075, 2004[Abstract/Free Full Text]
  15. Scrocchi LA, Brown TJ, MaClusky N, Brubaker PL, Auerbach AB, Joyner AL, Drucker DJ: Glucose intolerance but normal satiety in mice with a null mutation in the glucagon-like peptide 1 receptor gene. Nat Med 2:1254–1258, 1996[Medline]
  16. Flamez D, Van Breusegem A, Scrocchi LA, Quartier E, Pipeleers D, Drucker DJ, Schuit F: Mouse pancreatic beta-cells exhibit preserved glucose competence after disruption of the glucagon-like peptide-1 receptor gene. Diabetes 47:646–652, 1998[Abstract]
  17. Anini Y, Izzo A, Oudit GY, Backx PH, Brubaker PL: Role of phosphatidylinositol-3 kinase-gamma in the actions of glucagon-like peptide-2 on the murine small intestine. Am J Physiol Endocrinol Metab 292:E1599–E1606, 2007[Abstract/Free Full Text]
  18. Rouille Y, Westermark G, Martin SK, Steiner DF: Proglucagon is processed to glucagon by prohormone convertase PC2 in alpha TC1–6 cells. Proc Natl Acad Sci U S A 91:3242–3246, 1994[Abstract/Free Full Text]
  19. Dhanvantari S, Brubaker PL: Proglucagon processing in an islet cell line: effects of PC1 overexpression and PC2 depletion. Endocrinology 139:1630–1637, 1998[Abstract/Free Full Text]
  20. Vincent M, Guz Y, Rozenberg M, Webb G, Furuta M, Steiner D, Teitelman G: Abrogation of protein convertase 2 activity results in delayed islet cell differentiation and maturation, increased alpha-cell proliferation, and islet neogenesis. Endocrinology 144:4061–4069, 2003[Abstract/Free Full Text]
  21. Wilson ME, Kalamaras JA, German MS: Expression pattern of IAPP and prohormone convertase 1/3 reveals a distinctive set of endocrine cells in the embryonic pancreas. Mech Dev 115:171–176, 2002[Medline]
  22. Nie Y, Nakashima M, Brubaker PL, Li QL, Perfetti R, Jansen E, Zambre Y, Pipeleers D, Friedman TC: Regulation of pancreatic PC1 and PC2 associated with increased glucagon-like peptide 1 in diabetic rats. J Clin Invest 105:955–965, 2000[Medline]
  23. Duvivier-Kali VF, Omer A, Lopez-Avalos MD, O’Neil JJ, Weir GC: Survival of microencapsulated adult pig islets in mice in spite of an antibody response. Am J Transplant 4:1991–2000, 2004[Medline]
  24. Suzuki K, Bonner-Weir S, Trivedi N, Yoon KH, Hollister-Lock J, Colton CK, Weir GC: Function and survival of macroencapsulated syngeneic islets transplanted into streptozocin-diabetic mice. Transplantation 66:21–28, 1998[Medline]
  25. Li Y, Hansotia T, Yusta B, Ris F, Halban PA, Drucker DJ: Glucagon-like peptide-1 receptor signaling modulates beta cell apoptosis. J Biol Chem 278:471–478, 2003[Abstract/Free Full Text]
  26. Li Z, Karlsson FA, Sandler S: Islet loss and alpha cell expansion in type 1 diabetes induced by multiple low-dose streptozotocin administration in mice. J Endocrinol 165:93–99, 2000[Abstract]
  27. Wang Q, Brubaker PL: Glucagon-like peptide-1 treatment delays the onset of diabetes in 8 week-old db/db mice. Diabetologia 45:1263–1273, 2002[Medline]
  28. Drucker DJ, Lee YC, Asa SL, Brubaker PL: Inhibition of pancreatic glucagon gene expression in mice bearing a subcutaneous glucagon-producing GLUTag transplantable tumor. Mol Endocrinol 6:2175–2184, 1992[Abstract]
  29. Ehrlich P, Tucker D, Asa SL, Brubaker PL, Drucker DJ: Inhibition of pancreatic proglucagon gene expression in mice bearing subcutaneous endocrine tumors. Am J Physiol 267:E662–E671, 1994[Medline]
  30. Webb GC, Akbar MS, Zhao C, Swift HH, Steiner DF: Glucagon replacement via micro-osmotic pump corrects hypoglycemia and {alpha}-cell hyperplasia in prohormone convertase 2 knockout mice. Diabetes 51:398–405, 2002[Abstract/Free Full Text]
  31. Weir GC, Atkins RF, Martin DB: Glucagon secretion from the perfused rat pancreas following acute and chronic streptozotocin. Metabolism 25:1519–1521, 1976[Medline]
  32. Weir GC, Knowlton SD, Atkins RF, McKennan KX, Martin DB: Glucagon secretion from the perfused pancreas of streptozotocin-treated rats. Diabetes 25:275–282, 1976[Abstract]
  33. Guz Y, Nasir I, Teitelman G: Regeneration of pancreatic beta cells from intra-islet precursor cells in an experimental model of diabetes. Endocrinology 142:4956–4968, 2001[Abstract/Free Full Text]
  34. Jones CW, Reynolds WA, Hoganson GE: Streptozotocin diabetes in the monkey: plasma levels of glucose, insulin, glucagon, and somatostatin, with corresponding morphometric analysis of islet endocrine cells. Diabetes 29:536–546, 1980[Abstract]
  35. Dhanvantari S, Seidah NG, Brubaker PL: Role of prohormone convertases in the tissue-specific processing of proglucagon. Mol Endocrinol 10:342–355, 1996[Abstract]
  36. Jarrousse C, Bataille D, Jeanrenaud B: A pure enteroglucagon, oxyntomodulin (glucagon 37), stimulates insulin release in perfused rat pancreas. Endocrinology 115:102–105, 1984[Abstract]
  37. Schjoldager BT, Baldissera FG, Mortensen PE, Holst JJ, Christiansen J: Oxyntomodulin: a potential hormone from the distal gut: pharmacokinetics and effects on gastric acid and insulin secretion in man. Eur J Clin Invest 18:499–503, 1988[Medline]
  38. Baggio LL, Huang Q, Brown TJ, Drucker DJ: Oxyntomodulin and glucagon-like peptide-1 differentially regulate murine food intake and energy expenditure. Gastroenterology 127:546–558, 2004
  39. Bjerknes M, Cheng H: Modulation of specific intestinal epithelial progenitors by enteric neurons. Proc Natl Acad Sci U S A 98:12497–12502, 2001[Abstract/Free Full Text]
  40. Drucker DJ, Erlich P, Asa SL, Brubaker PL: Induction of intestinal epithelial proliferation by glucagon-like peptide 2. Proc Natl Acad Sci U S A 93:7911–7916, 1996[Abstract/Free Full Text]
  41. Schmidt WE, Siegel EG, Creutzfeldt W: Glucagon-like peptide-1 but not glucagon-like peptide-2 stimulates insulin release from isolated rat pancreatic islets. Diabetologia 28:704–707, 1985[Medline]
  42. Yusta B, Huang L, Munroe D, Wolff G, Fantaske R, Sharma S, Demchyshyn L, Asa SL, Drucker DJ: Enteroendocrine localization of GLP-2 receptor expression in humans and rodents. Gastroenterology 119:744–755, 2000[Medline]
  43. Soltani N, Kumar M, Glinka Y, Prud’homme GJ, Wang Q: In vivo expression of GLP-1/IgG-Fc fusion protein enhances beta-cell mass and protects against streptozotocin-induced diabetes. Gene Ther 14:981–988, 2007[Medline]
  44. Kumar M, Hunag Y, Glinka Y, Prud’homme GJ, Wang Q: Gene therapy of diabetes using a novel GLP-1/IgG1-Fc fusion construct normalizes glucose levels in db/db mice. Gene Ther 14:162–172, 2007[Medline]
  45. Wideman RD, Yu IL, Webber TD, Verchere CB, Johnson JD, Cheung AT, Kieffer TJ: Improving function and survival of pancreatic islets by endogenous production of glucagon-like peptide 1 (GLP-1). Proc Natl Acad Sci U S A 103:13468–13473, 2006[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
db07-0563v1
db07-0563v2
56/11/2744    most recent
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow