Diabetes
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Diabetes 56:720-727, 2007
DOI: 10.2337/db06-0521
© 2007 by the American Diabetes Association
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ukropcova, B.
Right arrow Articles by Smith, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ukropcova, B.
Right arrow Articles by Smith, S. R.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Family History of Diabetes Links Impaired Substrate Switching and Reduced Mitochondrial Content in Skeletal Muscle

Barbara Ukropcova, Olga Sereda, Lilian de Jonge, Iwona Bogacka, Tuong Nguyen, Hui Xie, George A. Bray, and Steven R. Smith

From the Pennington Biomedical Research Center, Baton Rouge, Louisiana

Address correspondence and reprint requests to Steven R. Smith, Pennington Biomedical Research Center, 6400 Perkins Rd., Baton Rouge, LA 70808. E-mail: smithsr{at}pbrc.edu

Abbreviations: FFA, free fatty acid; mtDNA, mitochondrial DNA; HFD, high-fat diet; RQ, respiratory quotient


    ABSTRACT
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Insulin resistance is associated with metabolic inflexibility, impaired switching of substrate oxidation from fatty acids to glucose in response to insulin. Impaired switching to fat oxidation in response to a high-fat diet (HFD) is hypothesized to contribute to insulin resistance. The objective of this study was to test the hypothesis that defects in substrate switching in response to insulin and a HFD are linked to reduced mitochondrial biogenesis and occur before the development of diabetes. Metabolic flexibility was measured in young sedentary men with (n = 16) or without (n = 34) a family history of diabetes by euglycemic-hyperinsulinemic clamp. Flexibility correlated with fat oxidation measured in a respiratory chamber after a 3-day HFD. Muscle mitochondrial content was higher in flexible subjects with high fat oxidation after a HFD and contributed 49% of the variance. Subjects with a family history of diabetes were inflexible and had reduced HFD-induced fat oxidation and muscle mitochondrial content but did not differ in the amount of body or visceral fat. Metabolic inflexibility, lower adaptation to a HFD, and reduced muscle mitochondrial mass cluster together in subjects with a family history of diabetes, supporting the role of an intrinsic metabolic defect of skeletal muscle in the pathogenesis of insulin resistance.

A high-fat diet (HFD) is a risk factor for obesity and has been implicated in the development of insulin resistance (1). A short-term HFD, as well as a lipid infusion, causes insulin resistance (24), reduces oxidative metabolism in skeletal muscle in rats (5), and downregulates genes of oxidative phosphorylation and mitochondrial biogenesis, such as peroxisome proliferator–activated {gamma} coactivator-1{alpha} (PGC-1{alpha}) (6). Moreover, oxidative phosphorylation and PGC-1{alpha} gene expression are decreased in insulin resistance (7,8). Taken together, these findings point to HFD, reduced oxidative capacity, and lipotoxicity in the pathophysiology of insulin resistance (9,10).

Substantial interindividual variability exists in the change of fat oxidation during adaptation to a HFD (11). Impaired fat oxidation during adaptation to a HFD is observed in restrained eaters (12), postobese (13) and obese (14) individuals, and in individuals with a family history of obesity (15), pointing toward a possible genetic basis for reduced fat oxidation (1). Impaired substrate switching in response to insulin (metabolic inflexibility) and dietary stimuli (attenuated adaptation to a HFD) are hypothesized to contribute to obesity and insulin resistance (1,16).

Metabolic inflexibility, as defined by Kelley and Mandarino (17), represents impaired substrate switching in skeletal muscle in insulin resistance. Healthy lean individuals who are flexible rely on lipids as a main source of fuel under fasting conditions and readily switch to carbohydrate oxidation in response to insulin infusion (18). On the contrary, the inflexible muscle of an insulin-resistant individual is characterized by lower fasting lipid utilization and lacks the ability to switch to carbohydrate oxidation in the insulin-stimulated state (18). Substrate competition in skeletal muscle and its role in systemic fatty acid utilization has been explored by a number of investigators (18,19).

Mitochondrial oxidative enzyme activity is reduced in skeletal muscle in obesity and insulin resistance (20). Bruce et al. (21) found that skeletal muscle oxidative capacity was a better predictor of insulin sensitivity than intramyocellular lipids. A higher fasting respiratory quotient (RQ), indicating decreased fat oxidation, is a predictor of weight gain (22). We showed that dynamic changes in fat oxidation in primary human muscle cells exposed to increased concentrations of fatty acid or glucose in vitro were closely related to metabolic flexibility, insulin sensitivity, and other clinical phenotypes of young, healthy donors in vivo (23), suggesting the importance of intrinsic, genetically, or epigenetically determined characteristics of fat oxidation for the flexible, insulin-sensitive phenotype. Decreased mitochondrial ATP synthesis in the offspring of patients with type 2 diabetes (24) supports the hypothesis that genetic factors control the reduced mitochondrial oxidative phosphorylation of insulin-resistant individuals.

Type 2 diabetes is largely a genetic disorder with a strong environmental influence (25). The concordance for type 2 diabetes in siblings is very high (26), and offspring of a parent with type 2 diabetes have reduced insulin sensitivity (27) and increased risk of type 2 diabetes (28). The difference in weight gain during a HFD (15) and in overfeeding twin studies (29) supports the role of genetic make-up in the adaptation to a HFD.

Taken together, these data suggest that the ability to oxidize dietary fat plays a role in the pre-diabetic condition and has a genetic predisposition. The aim of this study was to test the hypothesis that impaired substrate switching from carbohydrate to fat oxidation in response to a HFD is, together with metabolic inflexibility and reduced mitochondrial content, manifestation of an underlying disorder intrinsic to skeletal muscle, which contributes to the pathogenesis of diabetes. We measured these three parameters in 50 healthy sedentary young men with a range of body compositions and with family history of type 2 diabetes. In subjects with a family history of type 2 diabetes, before overt hyperglycemia, these three defects cluster together, forming a triad that may increase the risk of diabetes.


    RESEARCH DESIGN AND METHODS
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The ADAPT Study is a short-term, cross-sectional interventional study designed to examine interindividual differences in fat oxidation on an iso-energetic HFD. The protocol was approved by the Institutional Review Board of the Pennington Biomedical Research Center. All volunteers gave written informed consent. Healthy young sedentary men, aged 18–29 years, with a BMI 20–35 kg/m2 underwent complete physical examination, routine medical laboratory tests, and anthropometry. After completing the screening process, participants presented at the Pennington In-Patient Unit on day –4 and ate a weight-maintaining diet consisting of 35% fat, 16% protein, and 49% carbohydrate. On day –3, a euglycemic-hyperinsulinemic clamp was performed. On day 1, participants entered a respiratory chamber and ate the same weight-maintaining 35% fat diet. On days 2–4 (3 days) in the respiratory chamber, participants were fed an iso-energetic HFD (50% fat, 16% protein, and 34% carbohydrate). Total daily energy expenditure, fat oxidation, protein oxidation, and carbohydrate oxidation were measured at energy balance using an algorithm to balance intake and expenditure within the day (30). A family history of diabetes was determined by questionnaire.

Euglycemic-hyperinsulinemic clamp.
Insulin sensitivity was measured by euglycemic-hyperinsulinemic clamp (31) before a HFD. Subjects were asked to refrain from vigorous physical activity for 48 h before the clamp. After an overnight fast, insulin (80 mU/m2 per min) and 20% glucose (to maintain plasma glucose at 90 mg/dl) were administered for 3 h. Glucose and insulin were measured in triplicate blood samples 5 min apart at baseline and during steady-state insulin from 165 to 180 min. The glucose disposal rate, a measure of insulin sensitivity, was adjusted for kilograms of lean body mass determined by dual-energy X-ray absorptiometry. Fasting RQ, postinsulin steady-state RQ (clamp RQ), and substrate oxidation of fat and carbohydrate were calculated from O2 consumption and CO2 production, measured before the clamp (fasting values) and during the steady state of the clamp by indirect calorimetry and corrected for nitrogen excretion. A total of 48 individuals completed the clamp. Due to problems during the clamp procedure, such as failed intravenous needle insertions, three outliers with fasting RQ >3 SD were excluded from the analysis of the clamp RQ. The insulin-stimulated change in RQ ({Delta}RQ clamp = clamp RQ – fasting RQ), a measure of metabolic flexibility, represents the ability to switch from fasting fat oxidation to insulin-stimulated carbohydrate oxidation and is decreased in insulin-resistant states (17). Subjects were divided into three categories based on the work of Kelley et al. (18): flexible {Delta}RQ >0.13 (n = 10), inflexible {Delta}RQ <0.06 (n = 12), and intermediate {Delta}RQ 0.06–0.13 (n = 23).

Maximal aerobic capacity.
Maximal oxygen uptake (VO2max) was determined by a progressive treadmill test to exhaustion in accordance with the recommendations described by the American College of Sports Medicine (32). The volume of O2 and CO2 were measured continuously using a metabolic cart (V-Max29 Series; SensorMedics, Yorba Linda, CA). Heart rate was continuously monitored using a portable heart rate monitor (Polar S-610; Polar Beat).

Body composition.
Body fat mass and lean body mass were measured on a Hologic Dual Energy X-ray Absorptiometer in the fan beam mode (QDR 4500; Hologic, Waltham, MA). Coefficient of variation for the measurement of the lean body mass, fat mass, and percentage of body fat is 0.8, 1.6, and 1.7%, respectively. Visceral fat was measured by computed tomography scanning using a GE High Speed CT scanner under an established protocol (33).

Respiratory chamber.
The 24-h energy expenditure and RQ were determined in a whole-room respiratory calorimeter as previously described (30). O2 and CO2 concentrations were measured using a Magnos 4G magneto-pneumatic oxygen analyzer and Uras 3G infrared CO2 analyzer (Hartmann and Braun). Energy expenditure and substrate oxidations were calculated from O2 consumption, CO2 production, and 24-h urinary nitrogen excretion using the equations of Acheson et al. (34). Sleep RQ, a measure of maximal fat oxidation, was measured from 2:00 to 5:00 A.M. Fat balance was calculated as a difference between fat intake and fat oxidation measured over the 3 days of a HFD. The reproducibility of RQ measurements was tested in 17 subjects who had a 24-h RQ measured on two different admissions. Interindividual variability of 24-h RQ and sleep RQ in 49 individuals was compared with intraindividual variability in 17 individuals (online appendix Figure [available at http://dx.doi.org/10.2337/db06-0521]), as described by Zurlo et al. (22). Intraindividual variability was in all cases lower than interindividual variability.

Triaxial accelerometry.
Free-living energy expenditure was assessed by accelerometer (Actigraph, Fort Walton Beach, FL). The participant wore the device on the wrist for 3 consecutive days, including 2 weekdays and 1 weekend day. The device was validated against doubly labeled water showing an R2 of 0.65 (P < 0.001) between the two methods (J. Delany, L.d.J., unpublished observation). Measurements were completed for 24 subjects (n = 15 for family history negative and n = 9 for family history positive subjects). Energy spent by habitual physical activity was calculated as 24-h energy expenditure by accelerometer/resting energy expenditure by indirect calorimetry.

Skeletal muscle biopsy was performed before (day –2, on a standard diet) and after 3 days on a HFD (day +5). Samples of vastus lateralis muscle, weighing 60–100 mg, were obtained by muscle biopsy using the Bergstrom technique (35) and snap frozen in liquid nitrogen.

DNA extraction.
DNA from 50–100 mg of vastus lateralis muscle was extracted with phenol-chloroform, after separation of protein and RNA with Trizol reagent. The total amount of DNA recovered was determined by spectrophotometry.

Real-time PCR for mitochondrial DNA.
Relative amounts of nuclear DNA and mitochondrial DNA (mtDNA) were determined by quantitative real-time PCR as previously described (36). The sequences for the primer/probe sets used in TaqMan analysis of mtDNA content for NADH dehydrogenase subunit 1 are forward primer CCCTAAAACCCGCCACATCT, probe CCATCACCCTCTACATCACCGCCC, and reverse primer GAGCGATGGTGAGAGCTAAGGT and for lipoprotein lipase (accession no. NM_000237) are forward primer CGAGTCGTCTTTCTCCTGATGAT, probe ACATTCACCAGAGGGTC, and reverse primer TTCTGGATTCCAATGCTTCGA.

Statistical analysis.
All clinical data were entered into the Pennington Biomedical Research Center database, extracted and combined with a database that included mtDNA data, and analyzed using SAS (version 8.2) and JMP version 5.0.1a (SAS, Cary, NC). Since all variables were normally distributed, correlations were performed in a pairwise fashion using the Pearson product-moment statistic. A two-sample t test was performed to compare subjects with a negative and positive family history of diabetes. Regression analysis with stepwise model selection was used to determine the best determinant of sleep fat oxidation on the 3rd day of a HFD. All values are presented in figures and tables as sample (raw) means ± SD or SE. The type II error rate was set a priori at P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The characteristics of the study population are presented in Table 1. In general, subjects were young, healthy, sedentary men with a broad range of BMI (20.1–34.7 kg/m2), fatness (10.5–32.3%), and insulin sensitivity (glucose disposal rate 4.03–24.5 mg/kg lean body mass/min). Sixteen subjects had a parent (n = 9) or a grandparent (n = 7) with diabetes, while 34 subjects had no family history of diabetes.


View this table:
[in this window]
[in a new window]

 
TABLE 1 Clinical characteristics of the study population

 
Relationship between metabolic flexibility and insulin sensitivity.
As expected, glucose disposal during the clamp, a measure of insulin sensitivity, correlated negatively with BMI, fat mass, and percent body fat and visceral fat but correlated positively with VO2max and mtDNA (Table 2), confirming the well-documented relationship between body fatness, fitness, and insulin sensitivity (37). A negative correlation was observed between insulin sensitivity and fasting levels of both insulin and free fatty acids (FFAs) on a 35% fat diet (Table 2). Fasting RQ, a measure of fasting substrate utilization before the clamp, was only related to fasting FFA but not to insulin sensitivity or percent body fat. Metabolic flexibility, defined as the insulin-stimulated change in RQ during the clamp ({Delta}RQ; Fig. 1A), was negatively correlated with body fat, indicating a lower capacity for substrate switching in subjects with higher fat mass, specifically with higher visceral fat (38) (Table 2). On the other hand, {Delta}RQ was positively correlated with insulin sensitivity and VO2max, demonstrating the relationship between metabolic flexibility, insulin sensitivity, and aerobic fitness, respectively (Table 2). Sleep RQ on a 35% fat diet was inversely related to insulin sensitivity (r = –0.32, P = 0.03), indicating a link between insulin action and impaired fat oxidation. The relationship was weakened after adjustment of insulin sensitivity to body fat (P = 0.1, data not shown).


View this table:
[in this window]
[in a new window]

 
TABLE 2 Insulin sensitivity, metabolic flexibility, and maximal HFD-induced fat oxidation; relationship to clinical characteristics and mtDNA content in skeletal muscle

 

Figure 1
View larger version (18K):
[in this window]
[in a new window]

 
FIG. 1. A: Metabolic flexibility, an insulin-stimulated change in RQ during the clamp (n = 45). {Delta}RQ = clamp RQ – baseline RQ. B: Metabolic flexibility in subjects with • or without {circ} a family history of diabetes. C: Maximal HFD-induced fat oxidation (n = 49), the decrease in sleep RQ measured from 2:00 to 5:00 A.M. during the 3rd day of a HFD (chamber). D: Higher sleep RQ on the 3rd day of a HFD points to lower maximal HFD-induced fat oxidation in subjects with • versus without {circ} a family history of diabetes.

 
Adaptation to an iso-energetic high-fat, low carbohydrate diet.
As expected, we found a decrease in 24-h RQ (P < 0.0001) and a decrease in sleep RQ (P < 0.0001) on the 3rd day of the HFD (Fig. 1B), demonstrating substrate switching toward fat oxidation. Sleep RQ, measured from 2:00 to 5:00 A.M., is undisturbed by physical activity and food intake/thermic effect of food. Thus, the sleep RQ measures the minimal RQ and the maximal sleep fat oxidation.

Maximal fat oxidation after 3 days of a HFD (sleep RQ) is correlated with metabolic flexibility.
To determine whether there is a relationship between fat oxidation on a HFD and metabolic flexibility (clamp), we examined substrate oxidation, measured by 24-h RQ and sleep RQ, both measured on the last day of the 50% fat diet and cumulative fat balance over 3 days of the HFD in relation to metabolic phenotypes. We found that sleep RQ during the HFD was inversely related to metabolic flexibility ({Delta}RQ clamp) (Fig. 2), identifying a link between an insulin-stimulated change in substrate switching and sleep fat oxidation. This relationship remained significant after eliminating an outlier with {Delta}RQ clamp 0.25 (>3 SD) (r = –0.31, P = 0.03). Sleep RQ during the HFD was positively correlated with the aerobic capacity (VO2max) (r = –0.28, P < 0.05). Total (oxidative and nonoxidative) glucose disposal during the clamp did not correlate with sleep RQ during the HFD (P = 0.15), suggesting that insulin-stimulated changes in substrate oxidation (oxidative glucose disposal) rather than total insulin-stimulated glucose uptake links sleep RQ with metabolic flexibility. We did not find a significant relationship between 24-h RQ on a HFD and metabolic phenotypes (metabolic flexibility P = 0.32; insulin sensitivity P = 0.8; VO2max P = 0.8).


Figure 2
View larger version (9K):
[in this window]
[in a new window]

 
FIG. 2. A: Maximal HFD-induced fat oxidation (sleep RQ on the 3rd day of a HFD) is related to metabolic flexibility ({Delta}RQ clamp). B: Maximal HFD-induced fat oxidation is lower in individuals with metabolic inflexibility ({Delta}RQ clamp <0.06) (n = 12) compared with more flexible individuals (0.06 < {Delta}RQ clamp > 0.13, n = 23; {Delta}RQ clamp >0.13, n = 10) (18). •, subjects with a family history of diabetes; {circ}, subjects without a family history of diabetes.

 
As expected, cumulative fat balance over 3 days of a HFD correlated positively with 24-h RQ and sleep RQ on the 3rd day of a HFD (Table 3), demonstrating increased fat storage in response to a HFD in less adaptable subjects who are unable to increase fat oxidation (and to decrease RQ) sufficiently to match the fat content of the diet. We did not find any significant relationships between the change in 24-h RQ or sleep RQ on a HFD, calculated as the difference between RQ on a 35% fat diet and RQ on the 3rd day of a 50% fat diet, and insulin sensitivity, metabolic flexibility, VO2max, body fat, et cetera.


View this table:
[in this window]
[in a new window]

 
TABLE 3 The 24-h RQ and sleep RQ on day 3 of an iso-energetic HFD are positively correlated to cumulative fat balance over 3 days of a HFD

 
Metabolic phenotypes are linked to mtDNA content in skeletal muscle.
As expected, mtDNA content in skeletal muscle, normalized to nuclear DNA, did not change with a short 3-day 50% fat diet (P = 0.54). A positive correlation between mtDNA content before and after the HFD (r = 0.84, P < 0.0001, n = 30) demonstrated the reproducibility of the assay. mtDNA content was inversely associated with BMI (r = –0.37, P = 0.01) and body fatness (r = –0.33, P = 0.025), illustrating the lower mitochondrial number in skeletal muscle from subjects with a higher fat mass. There was a positive correlation between mtDNA content and aerobic capacity (VO2max) (r = 0.41, P = 0.005). mtDNA content also correlated positively with metabolic flexibility and insulin-stimulated glucose disposal (Fig. 3A and B; Table 2) and correlated inversely with sleep RQ during a HFD (Fig. 3C), pointing out the importance of mitochondria for insulin responsiveness, as well as the role of mitochondria in substrate switching from fat to carbohydrate oxidation in response to a HFD. Fasting RQ before the clamp was not related to mtDNA content (P = 0.58). Multiple stepwise regression analysis, with sleep RQ during a HFD as the dependent variable and mtDNA content, VO2max, {Delta}RQ, percent body fat, fasting insulin, and FFAs as independent variables, identified mtDNA content as the primary determinant of sleep RQ during a HFD (P = 0.003), explaining 49% of the variance. mtDNA was inversely related to insulin and leptin before and after a HFD (insulin 35% fat diet: r = –0.45, P = 0.002; insulin 50% fat diet: r = –0.46, P = 0.0016; leptin 35% fat diet: r = –0.43, P = 0.003; leptin 50% fat diet: r = –0.37, P = 0.01), fasting FFAs (clamp) (r = –0.31, P = 0.06), FFAs during insulin infusion (clamp) (r = –0.33, P = 0.06), and FFAs on a 35% fat diet (r = –0.31, P = 0.04). mtDNA content was positively associated with plasma adiponectin after a HFD (r = 0.36, P = 0.036). No significant relationship was observed between mtDNA content, glucose, and fasting FFAs on a HFD.


Figure 3
View larger version (15K):
[in this window]
[in a new window]

 
FIG. 3. mtDNA content in skeletal muscle is related to metabolic flexibility ({Delta}RQ clamp) (A), insulin sensitivity (clamp) (B), and maximal HFD-induced fat oxidation (C), a decrease in sleep RQ on the 3rd day of a HFD (chamber). DNA was isolated from vastus lateralis muscle. mtDNA content was normalized to nucleic DNA (qt PCR). •, subjects with a family history of diabetes; {circ}, subjects without a family history of diabetes.

 
Subjects with a family history of diabetes have impaired substrate switching, insulin resistance, and reduced mtDNA content in skeletal muscle.
To test the contribution of genetic background to substrate switching and mtDNA content, we divided the study population into two groups: subjects with a family history of diabetes in a parent or grandparent (n = 16) and subjects without a family history of diabetes (n = 34). To check for the between-group differences, we used the unpaired t test (Table 1). Subjects with a family history of diabetes had a trend toward reduced metabolic flexibility (P = 0.07) (Fig. 4A) and had significantly higher sleep RQ on the 3rd day of a HFD (P = 0.004; P = 0.012 when adjusted for VO2max), indicating lower maximal HFD-induced fat oxidation (Fig. 4C). We found a decrease in mtDNA content in subjects with a family history of diabetes (P = 0.018; P = 0.06 when adjusted for VO2max) (Fig. 4D). We did not find a significant difference between the groups in BMI, body fat, or 24-h RQ before or after HFD (Table 1). Using triaxial accelerometry, we did not observe differences in habitual physical activity level (P = 0.2) in subjects with compared with those without a family history of type 2 diabetes.


Figure 4
View larger version (18K):
[in this window]
[in a new window]

 
FIG. 4. Subjects with a family history of type 2 diabetes (FH) have reduced metabolic flexibility ({Delta}RQ clamp) (A); insulin sensitivity (IS) (B); maximal HFD-induced fat oxidation, demonstrated by a higher sleep RQ on the 3rd day of a HFD (C); and mtDNA content in skeletal muscle, normalized to nucleic DNA (D). Unpaired t test was performed to compare the groups with and without a family history of diabetes. {blacksquare}, subjects with a family history of diabetes; {square}, subjects without a family history of diabetes.

 

    DISCUSSION
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Skeletal muscle displays a considerable plasticity in substrate switching between oxidation of carbohydrate and fat (39). In obesity, diabetes, and insulin resistance, patterns of substrate selection are altered and include metabolic inflexibility and defects of fat oxidation (16,17). Our studies indicate that defects in substrate switching, which cluster together with mitochondrial defects in young, sedentary, healthy men with a family history of type 2 diabetes, might be a manifestation of an underlying mitochondrial disorder(s) and intrinsic to skeletal muscle. This occurs before the onset of impaired glucose tolerance, suggesting that these defects are one of the primary factors implicated in the pathophysiology of type 2 diabetes.

Kelley and Mandarino (17) defined metabolic flexibility as the "acute" switch in substrate from fasting fat oxidation to insulin-stimulated carbohydrate oxidation during an insulin infusion. Our results demonstrate that defects in substrate switching, when dietary fat is increased, are linked to metabolic inflexibility. Furthermore, these two aspects of substrate switching, namely metabolic inflexibility and defects in substrate switching when dietary fat is increased, are linked with lower insulin sensitivity and lower mtDNA content in skeletal muscle; this forms a cluster of defects in subjects with a family history of type 2 diabetes.

An iso-energetic, high-fat, low-carbohydrate diet induces slow adaptive changes in substrate switching, as previously shown (11). We found that both sleep and 24-h fat oxidation after 3 days of a HFD were negatively correlated with fat balance over 3 days of a HFD. This leads to increased fat storage, a finding that is consistent with previous reports (11,22). A slower rate of adaptation to a HFD might translate into differences in weight gain over time, especially when combined with a sedentary lifestyle. Flatt (40) proposed that subjects who continue to oxidize carbohydrate in the postabsorptive state deplete carbohydrate stores; this leads to increased food intake to replace the diminished carbohydrate stores and lipid storage. This is consistent with other prospective data (22). Through these mechanisms, interindividual differences in substrate selection might play a role in the development of obesity and subsequently type 2 diabetes.

In insulin resistance, skeletal muscle displays metabolic inflexibility, described as the impaired ability to switch from fat oxidation during fasting to insulin-stimulated carbohydrate oxidation (17). We show that metabolic flexibility parallels insulin-mediated glucose disposal and VO2max and is inversely associated with body fat, demonstrating a link between insulin sensitivity, metabolic flexibility, aerobic capacity, and fatness (18,23). Sleep RQ on a standard 35% fat diet was inversely correlated with insulin sensitivity, pointing to a greater reliance on glucose as a fuel in insulin-insensitive subjects. This is consistent with previous reports (18) that measured fasting fat oxidation before a clamp in limb-balance studies. In our population, fasting fat oxidation during a clamp was not related to insulin sensitivity or body fat but was related to fasting FFAs. Taken together, these data demonstrate that defects in metabolic flexibility are present in healthy young men and mirror the defects seen in older subjects with obesity and type 2 diabetes (18).

There are several explanations for an impaired adaptive response to a HFD. First, it is possible that the fat oxidative machinery is not sufficient to match the fat load. Our results are consistent with this hypothesis. We found that mtDNA content in skeletal muscle was the best predictor of sleep fat oxidation after 3 days of a HFD. Second, an iso-energetic, high-fat, low-carbohydrate diet is known to increase fat oxidation (41) and decrease glucose metabolism in skeletal muscle (42). It is possible that differences in the ability of muscle to switch the substrate oxidative machinery in response to a HFD may contribute to the variability in adaptation to a HFD. Third, the endocrine signal(s) necessary to activate fat oxidation might be delayed or absent. Our results do not support this view, since adaptation to a HFD was not associated with changes in adiponectin, leptin, or FFAs, factors that are known to influence fat oxidation in skeletal muscle (43).

Mitochondrial mass, structure, and function are altered in insulin resistance (44,45). Defects of mitochondria are believed to contribute to impaired fat oxidation and to the accumulation of intramyocellular lipid intermediates, which contribute to the pathogenesis of insulin resistance (16). Mitochondrial dysfunction in the elderly and in the offspring of diabetic patients is well documented (24,46,47). Ritov et al. (45) demonstrated a reduction in mtDNA content in skeletal muscle in obese and type 2 diabetic subjects. Similarly, we show that mtDNA content in skeletal muscle is inversely correlated with BMI and body fat and is positively associated with insulin sensitivity, metabolic flexibility, aerobic capacity, and maximal HFD-induced fat oxidation, measured as sleep RQ, in healthy young adults. Skeletal muscle mitochondrial content may link these metabolic phenotypes, supporting the hypothesis that reduced mitochondrial mass is a common underlying disorder of inflexible/inadaptable/insulin-resistant skeletal muscle, before the known changes associated with aging and the development of type 2 diabetes. The importance of a genetic predisposition in this scenario is supported by our observation that a decrease in mtDNA content is observed in subjects with a family history of diabetes, consistent with findings in Mexican Americans with a family history of diabetes (A. Civitarese, unpublished data). Intrinsic defects of mitochondrial mass and function might be further diminished by environmental factors, such as a sedentary lifestyle, and a long-term HFD via mechanisms involving lipid peroxidation (48), decreased mitochondrial transcription factors (6), and reduced oxidative capacity (5,6). These cellular changes lead to type 2 diabetes when the ß-cell ultimately fails.

There is good evidence to support a role for a genetic predisposition in the reduced fat-oxidative capacity of skeletal muscle. Muscle cells from morbidly obese subjects and type 2 diabetic subjects display defects in fat oxidation in vitro (49,50). We previously found that differences in fat oxidation are present in primary myotubes from young healthy individuals and correlate with clinical phenotypes of their donors, such as insulin sensitivity and metabolic flexibility (23). The estimated heritability of 24-h RQ is 20–30% (51). Individuals with a family history of diabetes were shown to have lower fat oxidation and higher RQ (52). Here, we demonstrate for the first time that maximal HFD-induced fat oxidation was significantly reduced in subjects with a family history of diabetes. This supports the hypothesis that patterns of fat oxidation are genetically or epigenetically determined, which is consistent with our in vitro studies (23). The lower rate of maximal HFD-induced fat oxidation was paralleled by a reduction in metabolic flexibility. The differences in metabolic phenotypes between subjects with and without a family history of diabetes were independent of body fat, suggesting that factors other than fatness per se are important in the pathogenesis of insulin resistance.

Regular exercise increases mitochondrial biogenesis and aerobic fitness. As such, the observed differences in mtDNA between subjects with a positive versus negative family history of diabetes could be due to differences in habitual physical activity. Using triaxial accelerometry, we did not observe differences in habitual physical activity level between subjects with a positive or negative family history of diabetes. VO2max and the capacity to increase VO2max with increasing physical activity both have a strong genetic component (53,54). One of the most striking differences between men with a positive versus negative family history of diabetes was a decrease in mtDNA and maximal fat oxidative capacity. The difference in maximal fat oxidative capacity remained significant after adjusting for VO2max. This suggests that other factors with a genetic component contribute to mitochondrial mass and, therefore, the reduced capacity to adapt to a HFD in young men with a family history of diabetes.

In conclusion, our results link metabolic inflexibility of skeletal muscle, impaired adaptation to a HFD, and reduced mtDNA content in skeletal muscle. The constellation of these metabolic derangements with reduced mtDNA content in skeletal muscle in subjects with a family history of diabetes might act in concert with a HFD and low physical activity, favoring lipid/energy storage and progression to obesity and diabetes.


    ACKNOWLEDGMENTS
 
This work was supported by U.S. Department of Agriculture Grant 2003-34323-14010 and the National Institutes of Health Clinical Nutrition Research Unit 1 P30 DK072476-01.

We thank Michele McNeil for the coordination of biopsies and for help and advice. Special thanks to Eric Ravussin for insightful discussions regarding the metabolic chamber data. We also thank volunteers for their hard work and commitment to the ADAPT Study.


    FOOTNOTES
 
B.U. is currently affiliated with the Diabetes Laboratory and DIABGENE Institute of Experimental Endocrinology, Slovak Academy of Sciences, Bratislava, Slovakia.

Additional information for this article can be found in an online appendix at http://dx.doi.org/10.2337/db06-0521.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received for publication April 18, 2006 and accepted in revised form November 23, 2006


    REFERENCES
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Astrup A: Macronutrient balances and obesity: the role of diet and physical activity. Public Health Nutr 2:341–347, 1999[Medline]
  2. Boden G: Role of fatty acids in the pathogenesis of insulin resistance and NIDDM. Diabetes 46:3–10, 1997[Abstract]
  3. Kraegen EW, Clark PW, Jenkins AB, Daley EA, Chisholm DJ, Storlien LH: Development of muscle insulin resistance after liver insulin resistance in high-fat–fed rats. Diabetes 40:1397–1403, 1991[Abstract]
  4. Ukropec J, Reseland JE, Gasperikova D, Demcakova E, Madsen L, Berge RK, Rustan AC, Klimes I, Drevon CA, Sebokova E: The hypotriglyceridemic effect of dietary n-3 FA is associated with increased beta-oxidation and reduced leptin expression. Lipids 38:1023–1029, 2003[Medline]
  5. Iossa S, Lionetti L, Mollica MP, Crescenzo R, Botta M, Barletta A, Liverini G: Effect of high-fat feeding on metabolic efficiency and mitochondrial oxidative capacity in adult rats. Br J Nutr 90:953–960, 2003[Medline]
  6. Sparks LM, Xie H, Koza RA, Mynatt R, Hulver MW, Bray GA, Smith SR: A high-fat diet coordinately downregulates genes required for mitochondrial oxidative phosphorylation in skeletal muscle. Diabetes 54:1926–1933, 2005[Abstract/Free Full Text]
  7. Mootha VK, Lindgren CM, Eriksson KF, Subramanian A, Sihag S, Lehar J, Puigserver P, Carlsson E, Ridderstrale M, Laurila E, Houstis N, Daly MJ, Patterson N, Mesirov JP, Golub TR, Tamayo P, Spiegelman B, Lander ES, Hirschhorn JN, Altshuler D, Groop LC: PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet 34:267–273, 2003[Medline]
  8. Patti ME, Butte AJ, Crunkhorn S, Cusi K, Berria R, Kashyap S, Miyazaki Y, Kohane I, Costello M, Saccone R, Landaker EJ, Goldfine AB, Mun E, DeFronzo R, Finlayson J, Kahn CR, Mandarino LJ: Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: potential role of PGC1 and NRF1. Proc Natl Acad Sci U S A 100:8466–8471, 2003[Abstract/Free Full Text]
  9. Kraegen EW, Cooney GJ, Ye JM, Thompson AL, Furler SM: The role of lipids in the pathogenesis of muscle insulin resistance and beta cell failure in type II diabetes and obesity. Exp Clin Endocrinol Diabetes 109 (Suppl. 2):S189–S201, 2001
  10. Unger RH: Lipid overload and overflow: metabolic trauma and the metabolic syndrome. Trends Endocrinol Metab 14:398–403, 2003[Medline]
  11. Smith SR, de Jonge L, Zachwieja JJ, Roy H, Nguyen T, Rood JC, Windhauser MM, Bray GA: Fat and carbohydrate balances during adaptation to a high-fat. Am J Clin Nutr 71:450–457, 2000[Abstract/Free Full Text]
  12. Verboeket-van de Venne WP, Westerterp KR, ten Hoor F: Substrate utilization in man: effects of dietary fat and carbohydrate. Metabolism 43:152–156, 1994[Medline]
  13. Astrup A, Buemann B, Christensen NJ, Toubro S: Failure to increase lipid oxidation in response to increasing dietary fat content in formerly obese women. Am J Physiol 266:E592–E599, 1994[Medline]
  14. Thomas CD, Peters JC, Reed GW, Abumrad NN, Sun M, Hill JO: Nutrient balance and energy expenditure during ad libitum feeding of high-fat and high-carbohydrate diets in humans. Am J Clin Nutr 55:934–942, 1992[Abstract/Free Full Text]
  15. Heitmann BL, Lissner L, Sorensen TI, Bengtsson C: Dietary fat intake and weight gain in women genetically predisposed for obesity. Am J Clin Nutr 61:1213–1217, 1995[Abstract/Free Full Text]
  16. Storlien L, Oakes ND, Kelley DE: Metabolic flexibility. Proc Nutr Soc 63:363–368, 2004[Medline]
  17. Kelley DE, Mandarino LJ: Fuel selection in human skeletal muscle in insulin resistance: a reexamination. Diabetes 49:677–683, 2000[Abstract]
  18. Kelley DE, Goodpaster B, Wing RR, Simoneau JA: Skeletal muscle fatty acid metabolism in association with insulin resistance, obesity, and weight loss. Am J Physiol 277:E1130–E1141, 1999[Medline]
  19. Boden G, Chen X, Ruiz J, White JV, Rossetti L: Mechanisms of fatty acid-induced inhibition of glucose uptake. J Clin Invest 93:2438–2446, 1994[Medline]
  20. Simoneau JA, Kelley DE: Altered glycolytic and oxidative capacities of skeletal muscle contribute to insulin resistance in NIDDM. J Appl Physiol 83:166–171, 1997[Abstract/Free Full Text]
  21. Bruce CR, Anderson MJ, Carey AL, Newman DG, Bonen A, Kriketos AD, Cooney GJ, Hawley JA: Muscle oxidative capacity is a better predictor of insulin sensitivity than lipid status. J Clin Endocrinol Metab 88:5444–5451, 2003[Abstract/Free Full Text]
  22. Zurlo F, Lillioja S, Esposito-Del Puente A, Nyomba BL, Raz I, Saad MF, Swinburn BA, Knowler WC, Bogardus C, Ravussin E: Low ratio of fat to carbohydrate oxidation as predictor of weight gain: study of 24-h RQ. Am J Physiol 259:E650–E657, 1990[Medline]
  23. Ukropcova B, McNeil M, Sereda O, de Jonge L, Xie H, Bray GA, Smith SR: Dynamic changes in fat oxidation in human primary myocytes mirror metabolic characteristics of the donor. J Clin Invest 115:1934–1941, 2005[Medline]
  24. Petersen KF, Dufour S, Befroy D, Garcia R, Shulman GI: Impaired mitochondrial activity in the insulin-resistant offspring of patients with type 2 diabetes. N Engl J Med 350:664–671, 2004[Abstract/Free Full Text]
  25. Bogardus C: Insulin resistance in the pathogenesis of NIDDM in Pima Indians. Diabetes Care 16:228–231, 1993[Abstract]
  26. Lillioja S, Mott DM, Zawadzki JK, Young AA, Abbott WG, Knowler WC, Bennett PH, Moll P, Bogardus C: In vivo insulin action is familial characteristic in nondiabetic Pima Indians. Diabetes 36:1329–1335, 1987[Abstract]
  27. Warram JH, Martin BC, Krolewski AS, Soeldner JS, Kahn CR: Slow glucose removal rate and hyperinsulinemia precede the development of type II diabetes in the offspring of diabetic parents. Ann Intern Med 113:909–915, 1990[Medline]
  28. Meigs JB, Cupples LA, Wilson PW: Parental transmission of type 2 diabetes: the Framingham Offspring Study. Diabetes 49:2201–2207, 2000[Abstract]
  29. Bouchard C, Tremblay A, Despres JP, Nadeau A, Lupien PJ, Theriault G, Dussault J, Moorjani S, Pinault S, Fournier G: The response to long-term overfeeding in identical twins. N Engl J Med 322:1477–1482, 1990[Abstract]
  30. Nguyen T, de Jonge L, Smith SR, Bray GA: Chamber for indirect calorimetry with accurate measurement and time discrimination of metabolic plateaus of over 20 min. Med Biol Eng Comput 41:572–578, 2003[Medline]
  31. DeFronzo RA, Tobin JD, Andres R: Glucose clamp technique: a method for quantifying insulin secretion and resistance. Am J Physiol 237:E214–E223, 1979[Medline]
  32. Tanaka H, Monahan KD, Seals DR: Age-predicted maximal heart rate revisited. J Am Coll Cardiol 37:153–156, 2001[Abstract/Free Full Text]
  33. Smith SR, Lovejoy JC, Greenway F, Ryan D, Dejonge L, De La Bretonne J, Volafova J, Bray GA: Contributions of total body fat, abdominal subcutaneous adipose tissue compartments, and visceral adipose tissue to the metabolic complications of obesity. Metabolism 50:425–435, 2001[Medline]
  34. Acheson KJ, Schutz Y, Bessard T, Ravussin E, Jequier E, Flatt JP: Nutritional influences on lipogenesis and thermogenesis after a carbohydrate meal. Am J Physiol 246:E62–E70, 1984[Medline]
  35. Bergstrom J: Percutaneous needle biopsy of skeletal muscle in physiological and clinical research. Scand J Clin Lab Invest 35:609–616, 1975[Medline]
  36. Bogacka I, Xie H, Bray GA, Smith SR: Pioglitazone induces mitochondrial biogenesis in human subcutaneous adipose tissue in vivo. Diabetes 54:1392–1399, 2005[Abstract/Free Full Text]
  37. Abate N, Garg A, Peshock RM, Stray-Gundersen J, Grundy SM: Relationships of generalized and regional adiposity to insulin sensitivity in men. J Clin Invest 96:88–98, 1995[Medline]
  38. Kelley DE, Williams KV, Price JC, McKolanis TM, Goodpaster BH, Thaete FL: Plasma fatty acids, adiposity, and variance of skeletal muscle insulin resistance in type 2 diabetes mellitus. J Clin Endocrinol Metab 86:5412–5419, 2001[Abstract/Free Full Text]
  39. Randle PJ, Garland PB, Hales CN, Newsholme EA: The glucose fatty-acid cycle: its role in insulin sensitivity and the metabolic disturbances of diabetes mellitus. Lancet 1:785–789, 1963[Medline]
  40. Flatt JP: Glycogen levels and obesity. Int J Obes Relat Metab Disord 20 (Suppl. 2):S1–S11, 1996
  41. Cameron-Smith D, Burke LM, Angus DJ, Tunstall RJ, Cox GR, Bonen A, Hawley JA, Hargreaves M: A short-term, high-fat diet up-regulates lipid metabolism and gene expression in human skeletal muscle. Am J Clin Nutr 77:313–318, 2003[Abstract/Free Full Text]
  42. Peters SJ, Harris RA, Wu P, Pehleman TL, Heigenhauser GJ, Spriet LL: Human skeletal muscle PDH kinase activity and isoform expression during a 3-day high-fat/low-carbohydrate diet. Am J Physiol Endocrinol Metab 281:E1151–E1158, 2001[Abstract/Free Full Text]
  43. Muoio DM, Lynis Dohm G: Peripheral metabolic actions of leptin. Best Pract Res Clin Endocrinol Metab 16:653–666, 2002[Medline]
  44. Kelley DE, He J, Menshikova EV, Ritov VB: Dysfunction of mitochondria in human skeletal muscle in type 2 diabetes. Diabetes 51:2944–2950, 2002[Abstract/Free Full Text]
  45. Ritov VB, Menshikova EV, He J, Ferrell RE, Goodpaster BH, Kelley DE: Deficiency of subsarcolemmal mitochondria in obesity and type 2 diabetes. Diabetes 54:8–14, 2005[Abstract/Free Full Text]
  46. Petersen KF, Befroy D, Dufour S, Dziura J, Ariyan C, Rothman DL, DiPietro L, Cline GW, Shulman GI: Mitochondrial dysfunction in the elderly: possible role in insulin resistance. Science 300:1140–1142, 2003[Abstract/Free Full Text]
  47. Morino K, Petersen KF, Dufour S, Befroy D, Frattini J, Shatzkes N, Neschen S, White MF, Bilz S, Sono S, Pypaert M, Shulman GI: Reduced mitochondrial density and increased IRS-1 serine phosphorylation in muscle of insulin-resistant offspring of type 2 diabetic parents. J Clin Invest 115:3587–3593, 2005[Medline]
  48. Schrauwen P, Hesselink MK: Oxidative capacity, lipotoxicity, and mitochondrial damage in type 2 diabetes. Diabetes 53:1412–1417, 2004[Abstract/Free Full Text]
  49. Hulver MW, Dohm GL: The molecular mechanism linking muscle fat accumulation to insulin resistance. Proc Nutr Soc 63:375–380, 2004[Medline]
  50. Gaster M, Rustan AC, Aas V, Beck-Nielsen H: Reduced lipid oxidation in skeletal muscle from type 2 diabetic subjects may be of genetic origin: evidence from cultured myotubes. Diabetes 53:542–548, 2004[Abstract/Free Full Text]
  51. Bouchard C, Tremblay A, Nadeau A, Despres JP, Theriault G, Boulay MR, Lortie G, Leblanc C, Fournier G: Genetic effect in resting and exercise metabolic rates. Metabolism 38:364–370, 1989[Medline]
  52. De Pergola G, Pannacciulli N, Minenna A, Martina RA, Cannito F, Giorgino R: Fuel metabolism in adult individuals with a wide range of body mass index: effect of a family history of type 2 diabetes. Diabetes Nutr Metab 16:41–47, 2003[Medline]
  53. Bouchard C, Daw EW, Rice T, Perusse L, Gagnon J, Province MA, Leon AS, Rao DC, Skinner JS, Wilmore JH: Familial resemblance for VO2max in the sedentary state: the HERITAGE family study. Med Sci Sports Exerc 30:252–258, 1998
  54. Rico-Sanz J, Rankinen T, Rice T, Leon AS, Skinner JS, Wilmore JH, Rao DC, Bouchard C: Quantitative trait loci for maximal exercise capacity phenotypes and their responses to training in the HERITAGE Family Study. Physiol Genomics 16:256–260, 2004[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
DiabetesHome page
J. E. Galgani, L. K. Heilbronn, K. Azuma, D. E. Kelley, J. B. Albu, X. Pi-Sunyer, S. R. Smith, E. Ravussin, and and the Look AHEAD Adipose Research Group
Metabolic Flexibility in Response to Glucose Is Not Impaired in People With Type 2 Diabetes After Controlling for Glucose Disposal Rate
Diabetes, April 1, 2008; 57(4): 841 - 845.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Crunkhorn, F. Dearie, C. Mantzoros, H. Gami, W. S. da Silva, D. Espinoza, R. Faucette, K. Barry, A. C. Bianco, and M. E. Patti
Peroxisome Proliferator Activator Receptor {gamma} Coactivator-1 Expression Is Reduced in Obesity: POTENTIAL PATHOGENIC ROLE OF SATURATED FATTY ACIDS AND p38 MITOGEN-ACTIVATED PROTEIN KINASE ACTIVATION
J. Biol. Chem., May 25, 2007; 282(21): 15439 - 15450.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ukropcova, B.
Right arrow Articles by Smith, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ukropcova, B.
Right arrow Articles by Smith, S. R.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Diabetes Diabetes Care Clinical Diabetes Diabetes Spectrum