Diabetes
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published online January 26, 2007
Diabetes 56:1436-1444, 2007
DOI: 10.2337/db06-1199
© 2007 by the American Diabetes Association
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
db06-1199v1
56/5/1436    most recent
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, R.
Right arrow Articles by Shen, G. X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, R.
Right arrow Articles by Shen, G. X.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Involvement of Heat Shock Factor-1 in Glycated LDL–Induced Upregulation of Plasminogen Activator Inhibitor-1 in Vascular Endothelial Cells

Ruozhi Zhao, and Garry X. Shen

From the Departments of Internal Medicine and Physiology, University of Manitoba, Winnipeg, Manitoba, Canada

Address correspondence and reprint requests to Garry X. Shen, MD, PhD, Diabetes Research Group, University of Manitoba, 835-715 McDermot Ave., Winnipeg, Manitoba, Canada R3E 3P4. E-mail: gshen{at}ms.umanitoba.ca

Abbreviations: BHT, butylated hydroxytoluene; BHT-gLDL, LDL glycated with the presence of 80 µmol/l BHT; CAD, coronary artery disease; EMSA, electrophoretic mobility shift assay; HCAEC, human coronary artery endothelial cell; HSE, heat shock responsive element; HSF1, heat shock factor-1; Hsp, heat shock protein; HUVEC, human umbilical vein endothelial cell; PAI-1, plasminogen activator inhibitor-1; ROS, reactive oxygen species; siRNA, small interference RNA; SOD, superoxide dismutase


    ABSTRACT
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Coronary artery disease is the predominant cause of death in diabetic patients. Plasminogen activator inhibitor-1 (PAI-1) is the major physiological inhibitor of plasminogen activators. Heat shock protein (Hsp) was upregulated in uncontrolled diabetic patients. Our previous studies demonstrated that glycated LDL stimulated the generation of PAI-1 from vascular endothelial cells. The present study examined the effect of glycated LDL on the expression of heat shock factor-1 (HSF1), a physiological transcription factor of Hsp, and the involvement of HSF-1 in glycated LDL–induced production of PAI-1 in cultured human umbilical vein endothelial cells (HUVECs) and coronary artery endothelial cells (HCAECs). Treatment with glycated LDL increased the expression of HSF1 and Hsp-70 compared with LDL in subconfluent HCAECs or HUVECs, and that was associated with an increase of PAI-1 expression. The transfection of HSF1 gene enhanced the expression of PAI-1 in endothelial cells. Small interference RNA against HSF1 prevented glycated LDL–induced upregulation of PAI-1 in HCAECs or HUVECs. Glycated LDL increased the binding of a nuclear protein to the PAI-1 promoter. The nuclear protein–DNA complex was supershifted by HSF1 antibody. The presence of an antioxidant, butylated hydroxytulene, during the glycation of LDL prevented glycated LDL–induced increases of the expression of HSF1 or PAI-1 in endothelial cells. The results suggest that HSF-1 is involved in glycated LDL–induced upregulation of PAI-1 in subconfluent vascular endothelial cells through the binding of HSF1 to PAI-1 promoter. Glyco-oxidation may contribute to glycated LDL–induced expression of HSF1 and PAI-1 in endothelial cells.

The incidence of diabetes in North America has rapidly increased during the last three decades, and the trend is expected to continue (1). The most common cause of death in diabetic patients is coronary artery disease (CAD). Acute coronary syndrome is often associated with thrombosis at the lesions of atherosclerotic plaques (2,3). Thrombogenesis depends on an imbalance between coagulation and fibrinolysis in local blood circulation. Attenuated fibrinolytic activity has been detected in peripheral circulation of type 1 or type 2 diabetic patients (4,5). Plasminogen activator inhibitor-1 (PAI-1) is the major physiological inhibitor for fibrinolysis, which modulates the activity of tissue and urokinase plasminogen activators on the formation of plasmin. PAI-1 is also implicated in inflammation, endothelial dysfunction, and extracellular matrix remodeling (6). An elevated level of PAI-1 in plasma has been considered as a nontraditional risk factor for CAD and a marker of endothelial dysfunction (7).

Hyperglycemia and dyslipoproteinemia are two major biochemical markers of diabetes. Elevated LDL is a classical risk factor for atherosclerotic cardiovascular disease. LDL clearance via the LDL receptor is attenuated by glycation (8). Elevated levels of small, dense LDL and glycated LDL were frequently detected in diabetic patients (911). Previous studies in our laboratory demonstrated that glycated LDL increased the production of PAI-1 in cultured venous or arterial endothelial cells. LDL isolated from diabetic patients or glycated LDL modified in vitro enhanced the activity of PAI-1 promoter in endothelial cells (1215). Glycated LDL stimulated the generation of reactive oxygen species (ROS) and decreased the abundance of reduced glutathione in endothelial cells (16). The findings imply that glycated LDL may induce oxidative stress in vasculature. Heat shock, mechanical shear, or oxidative stress induces stress responses in cells, which are mediated by heat shock proteins (Hsps). The transcription of Hsp is mediated by heat shock factor (HSF) (17). HSF1 is the most widely distributed form of HSF in human body (1820). The activation of HSF1 is detected during embryo growth (21) or in diet-induced atherosclerotic animal models (22). The levels of Hsp-70 were increased in the peripheral circulation of diabetic patients with ketoacidosis (23). Neither the impact of glycated LDL on HSF1 nor the relationship between HSF1 and PAI-1 has been documented. The present study investigated the effect of glycated LDL on HSF1 expression and the involvement of HSF1 in glycated LDL–induced PAI-1 production in cultured human arterial and venous endothelial cells.


    RESEARCH DESIGN AND METHODS
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Isolation and modification of LDL.
LDL (density 1.019–1.063) was isolated from the plasma of healthy donors using sequential floatation density ultracentrifugation. LDL was glycated by incubation with 50 mmol/l glucose and 50 mmol/l sodium cyanoborohydride for 2 weeks at 37°C in the dark and overlaid with nitrogen as previously described (12). In a parallel preparation, LDL was glycated with the presence of 80 µmol/l butylated hydroxytulene (BHT) (BHT-gLDL) (16). Free glucose was removed from glycated LDL through dialysis. The extent of glycation in glycated LDL was estimated using trinitrobenzenesulfonic acid assay (24). Lysine residues (~60%) were glycated in the preparations of glycated LDL used in the following experiments. Endotoxin level in lipoproteins was monitored using E-Toxate kit with a threshold of 0.05 ng/ml (Sigma, St. Louis, MO). LDL and its modified forms were stored in sealed tubes under a layer of nitrogen at 4°C in the dark to prevent auto-oxidation (25).

Cell culture.
Seed human umbilical vein endothelial cells (HUVECs) were obtained from American Type Culture Collection (Manassas, VA). Cells were grown in F12K medium (Gibco, Burlington, ON, Canada) containing 10% FCS, 0.1 mg/ml heparin, and 30 µg/ml endothelial cell growth supplements (Sigma) (15). Seed human coronary arterial endothelial cells (HCAECs) and cultured supplements were obtained from Clonetics (San Diego, CA). Subconfluent endothelial cell cultures within eight passages from the seed cells were treated with or without an addition of lipoproteins or serum as indicated. No obvious cytotoxicity was detected in endothelial cells treated with LDL or glycated LDL in tested conditions using morphological observation or leucine incorporation assay (25).

Western blotting assay.
Western blotting analysis was performed as previously described (25) using monoclonal antibodies against human HSF1, Hsp-70, PAI-1, ß-actin, nonspecific mouse IgG, or anti-mouse IgG antibody conjugated with horseradish peroxidase obtained from Santa Cruz Biotechnology (Santa Cruz, CA) or Sigma. Enhanced chemiluminescence reagents (Amersham, Piscataway, NJ) were used for detecting targeted antigens on nitrocellulose membrane. The densities of the antigens were detected using Chemi-Doc system and Quantity One software (Bio-Rad, Hercules, CA). The abundance of targeted proteins was normalized with the level of ß-actin in corresponding samples.

PAI-1 antigen and activity measurements.
The levels of PAI-1 antigen and activity in experimental medium of endothelial cell cultures were analyzed using PAI-1 enzyme-linked immunosorbent assay or PAI activity assay kits (American Diagnostic, Stamford, CT) as previously described (26).

Measurement of hydrogen peroxide.
The levels of hydrogen peroxide (H2O2) in the conditioned media of endothelial cells were analyzed using PeroxiDetect kit (Sigma) as previously described (16).

RT-PCR.
The levels of HSF1 and PAI-1 mRNA were assessed using RT-PCR and justified with the level of ß-actin mRNA in corresponding samples. Primers for HSF1 mRNA (sense, 5'-GACATAAAGATCCGCACGGA; and antisense, 5'-CTGCACCAGTGAGATCAGGA) were designed according to the sequence of HSF1 cDNA from GenBank (NM_005526). Primers for PAI-1 mRNA (sense, 5'-CAGACCAAGAGCCTCTCCAC; and antisense, 5'ATCACTTGGCCCATGAAAAG) and ß-actin gene (sense, 5'-CGTGGGCCGCCCTAGGCACCA; and antisense, 5'-TTGGCCTTAGGGTTCAGGGGGG) were synthesized according to their reported cDNA sequences (27,28). PCR was performed at 95, 60, and 72°C for 1, 2, and 3 min for 35 cycles. HSF1 (210 bp), PAI-1 (202 bp), and ß-actin (300 bp) mRNA fragments were visualized on ethidium bromide–stained 1% agarose gel and were semiquantified using the Chemi-Doc system.

Gene silence.
Small interference RNA (siRNA) targeting HSF1 mRNA (5'-GGAAAGUGACCAGUGUGUCtt) was obtained from Ambion (Autsin, TX). HSF1 siRNA was transfected to endothelial cells in serum-free medium using Silence siPort Lipid kit (Ambion). siRNA for ß-actin or negative control siRNA (Ambion) was transfected in parallel cultures to verify the methodology.

Overexpression of HSF1 gene.
The full-length HSF1 gene in pCMVHuHSFB plasmid (a kind gift from Dr. Carl Wu, National Cancer Institute, Bethesda, MD) (29) was excised using EcoRI and BglII. The insert was amplified via PCR, and the product was inserted into pcDNA3.1 vector/V5-His-TOPO expression vector (Invitrogen, San Diego, CA). The sequence of HSF1 gene was confirmed by DNA sequencing. HCAECs were transfected with HSF1/pcDNA3.1 or empty vector using CaCl2 (125 mmol/l) as previously described (30).

Transfection assay.
PAI-1 promoter (–1,528/55)/luciferase reporter vector was constructed for transfection assay as previously described (13). Two additional PAI-1 promoter fragments (–1,197/55 and –1,105/55 bp) were generated through 5' deletion. The products were inserted into the pXP1/luciferase vector to generate pPAI-1(–1,197/55)/luciferase and pPAI-1(–1,105/55)/luciferase vector. PAI-1 promoter/reporter constructs were precipitated with HEPES buffer (pH 7.05) containing 125 mmol/l CaCl2 for 20 min. Cells were incubated with calcium phosphate–precipitated DNA as previously described (13). Chlormaphenicol acetyltransferase/pcDNA3 expression vector (31) was cotransfected as an internal control.

Point mutagenesis.
Point mutagenesis of the PAI-1 promoter within the –1,139/–1,126-bp region was generated using QuickChange Site-Directed Mutagenesis kits (Stratagene, La Jolla, CA) and the –1,528/55 PAI-1 promoter/luciferase reporter gene vector was used as the template. The sequences of mutants were verified through DNA sequencing.

Electrophoretic mobility shift assay and supershift.
Nuclear proteins were extracted from endothelial cells as previously described (32). A double-strand oligonucleotide corresponding to the –1,141/–1,126 bp (AATAGAAATAAAGCAC) of the PAI-1 promoter (GenBank no. J03764) was synthesized as a probe for electrophoretic mobility shift assay (EMSA). The probe was labeled with [32P]dNTP at the single end. The labeled probe was incubated with nuclear extracts at 4°C for 15 min. DNA-protein complexes were analyzed using 5% nondenatured acrylamide gel electrophoresis and visualized using autoradiography. Monoclonal antibody against HSF1 (0.5 µg/µl; Santa Cruz Biotechnology) was used in supershift assay. Nonspecific mouse IgG was used as an antibody control for the supershift assay.

Statistics.
Student's t test was used for the determination of probabilities between two groups. One-way ANOVA analysis was performed for comparisons among multiple groups. The level of significance was defined as P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Effects of glycated LDL on HSF1 and Hsp-70 in cultured venous and arterial endothelial cells.
The effect of glycated LDL on cell-associated HSF1 was characterized using Western blotting in HUVECs treated with physiologically relevant concentrations of glycated LDL or LDL (50–150 µg protein/ml) for up to 24 h compared with vehicle control. The maximal effect of glycated LDL or LDL on HSF1 expression was detected in HUVECs treated with 100 µg/ml glycated LDL or LDL for 6 h (Fig. 1A and B). The stimulating effect of glycated LDL (100 µg/ml for 6 h) on HSF1 expression in HCAECs was similar to that in HUVECs (Fig. 1C and D). The abundance of Hsp-70 was examined in HUVECs and HCAECs exposed to 100 µg/ml glycated LDL or LDL for 6 h. Significant increase in cell-associated Hsp-70 was detected in HUVECs or HCAECs treated with glycated LDL compared with LDL (P < 0.05, Fig. 1E and F).


Figure 1
View larger version (38K):
[in this window]
[in a new window]

 
FIG. 1. Effect of glycated LDL (gly-LDL) on the expression of HSF1 and HSp-70 in arterial and venous endothelial cells. A and B: Subconfluent HUVECs were treated with 50–150 µg/ml glycated LDL, LDL, or vehicle (control) for 1–24 h. HSF1 and ß-actin in cellular proteins were determined using Western blotting. A: Time course. B: Dose response. CF: Subconfluent HUVECs or HCAECs were treated with 100 µg/ml glycated LDL, LDL, or vehicle (control) for 6 h. C and D: Western blots and integrative data for HSF1. E and F: Western blots and integrative data for Hsp-70. Values are expressed in the folds of control after normalization with ß-actin (means ± SD, n = 3 experiments). *,**P < 0.05 or 0.01, respectively, vs. control; +P < 0.05 vs. LDL.

 
Effect of glycated LDL on PAI-1 protein and activity.
Previous studies in our laboratory demonstrated that glycated LDL increased the mRNA and protein release of PAI-1 from endothelial cells (12). The effect of glycated LDL on cell-associated PAI-1 in endothelial cells has not been characterized. The present study examined the effect of glycated LDL and LDL on abundance of PAI-1 in HUVECs exposed to 50–150 µg/ml lipoproteins for 12–72 h. The maximal increase of PAI-1 was detected in HUVECs treated with 100 µg/ml glycated LDL or LDL for 24 h (Fig. 2A and B). The effect of 100 µg/ml glycated LDL or LDL for 24 h on cell-associated PAI-1 in HCAECs was similar to that in HUVECs. Glycated LDL induced significantly greater expression of PAI-1 than LDL in HCAECs or HUVECs (P < 0.05; Fig. 2C and D). The levels of PAI-1 antigen and activity released from endothelial cells were examined in postcultural medium of HCAECs treated with 100 µg/ml glycated LDL or LDL for up to 72 h. The maximal increase of PAI-1 antigen or activity was detected in the media of HCAECs exposed to glycated LDL or LDL for 48 h. The level of PAI activity but not of PAI-1 antigen was attenuated after 72 h of incubation with glycated LDL, LDL, or vehicle (Fig. 2E and F).


Figure 2
View larger version (32K):
[in this window]
[in a new window]

 
FIG. 2. Effect of glycated LDL (gly-LDL) on PAI-1 protein and activity. A and B: Subconfluent HUVECs were treated with medium without addition (control) or with 50–150 µg/ml glycated LDL or LDL for 12–72 h. PAI-1 and ß-actin in cellular proteins were determined using Western blotting. A: Time course. B: Dose response. C and D: Subconfluent HUVECs or HCAECs were treated with 100 µg/ml glycated LDL, LDL, or vehicle (control) for 24 h. Values are expressed in the folds of control after normalization with ß-actin (means ± SD, n = 3 experiments). E and F: Subconfluent HCAECs were treated with vehicle (control), 100 µg/ml glycated LDI, or LDL for 12–72 h. The levels of PAI-1 and its activity in the postcultural medium were measured using enzyme-linked immunosorbent assay or activity assay kits. E: PAI-1 antigen. F: PAI activity. Values are expressed in µg/mg or units/mg total cellular proteins (means ± SD, n = 3 experiments). *,**P < 0.05 or 0.01, respectively, vs. control; +P < 0.05 vs. LDL.

 
Impact of the overexpression of HSF1 gene on PAI-1 expression.
Potential relationship between HSF1 and PAI-1 expression was determined in HCAECs transiently transfected with HSF1 gene. The abundance of HSF1 was apparently increased in endothelial cells transfected with HSF1 gene (Fig. 3A). The overexpression of HSF1 significantly increased the abundance of cell-associated Hsp-70 and PAI-1 in HCAECs compared with cells transfected with empty pcDNA3.1 vector (vector) or untransfected endothelial cells treated with vehicle control (Fig. 3B). The transfection of HSF1 did not substantially alter the abundances of ß-actin in corresponding cells (Fig. 3A). The transfection of HSF1 gene also increased the expression of HSF1, Hsp-70, and PAI-1 in HUVECs (data not shown). The results indicate that the overexpression of HSF1 gene enhances the expression of PAI-1 in vascular endothelial cells.


Figure 3
View larger version (42K):
[in this window]
[in a new window]

 
FIG. 3. Impact of overexpression of HSF1 gene on PAI-1 expression. Subconfluent HCAECs were transfected with empty pcDNA3.1 vector (vector) or HSF1/pcDNA3.1 expression vector (HSF1) for 6 h (for HSF1 or Hsp-70) or 24 h (for PAI-1). Total cellular proteins from endothelial cells without transfection (control), transfected with HSF1, or empty vector were analyzed using Western blotting with antibodies against HSF1, Hsp-70, PAI-1, or ß-actin. A: Western blots. B: Integrative data. Values are presented in the folds of control after normalization with ß-actin (means ± SD, n = 3 experiments).*P < 0.05 vs. control; +P < 0.05 vs. vector.

 
Impact of HSF1 siRNA on glycated LDL–induced PAI-1 expression.
We hypothesize that HSF1 mediates the increase of the expression of PAI-1 induced by glycated LDL in endothelial cells. The hypothesis was examined using siRNA against HSF1 mRNA in both venous and arterial endothelial cells. HSF1 siRNA efficiently blocked glycated LDL–or LDL-induced increases of HSF1 and PAI-1 protein or mRNA in HUVECs (Fig. 4). HSF1 siRNA also effectively prevented glycated LDL–or LDL-induced increase in cell-associated HSF1 or PAI-1 in HCAECs (Fig. 5). In endothelial cells transfected with HSF1 siRNA but without an addition of the lipoproteins, the expression of HSF1 and PAI-1 was partially inhibited. HSF1 siRNA did not evidently affect the abundance of ß-actin protein or mRNA in endothelial cells with or without lipoprotein treatment (Figs. 4 and 5). Negative control siRNA or siRNA against ß-actin did not noticeably alter the expression of HSF1 or PAI-1 protein or mRNA in endothelial cells (data not shown). The results suggest that the expression of HSF1 is required for the upregulation of PAI-1 expression in arterial or venous endothelial cells induced by glycated LDL.


Figure 4
View larger version (53K):
[in this window]
[in a new window]

 
FIG. 4. Effect of HSF1 siRNA on glycated LDL–induced HSF1 and PAI-1 protein and mRNA in HUVECs. Subconfluent HUVECs transfected with siRNA against HSF1 gene for 48 h (first 4 h in serum-free medium, in the presence of 10% serum during the rest of incubation) were treated with vehicle (control) or with an addition of 100 µg/ml LDL or glycated LDL (gly-LDL) for 6 h (for HSF1) or 24 h (for PAI-1). A: Western blots for HSF1, PAI-1, and ß-actin. B: Integrative data of Western blotting. C: RT-PCR for HSF1, PAI-1, and ß-actin mRNA. D: Integrative data of mRNA. Values are presented in the folds of control after normalization with ß-actin protein or mRNA (means ± SD, n = 3 experiments). *,**P < 0.05 or 0.01, respectively, vs. control without HSF1 siRNA; ++P < 0.01 vs. LDL without HSF1 siRNA; x,xxP < 0.05 or 0.01, respectively, vs. glycated LDL without HSF1 siRNA.

 

Figure 5
View larger version (44K):
[in this window]
[in a new window]

 
FIG. 5. Effect of HSF1 siRNA on glycated LDL–induced HSF1 and PAI-1 protein in HCAECs. Subconfluent HCAECs were transfected with siRNA against HSF1 gene and then treated with glycated LDL (gly-LDL), LDL, or vehicle as described in the legend of Fig. 4. The abundance of HSF1, PAI-1, or ß-actin protein was detected using Western blotting. A: Western blots. B: Integrative data. Values are presented in the folds of control after normalization with ß-actin (means ± SD, n = 3 experiments). *,**P < 0.05 or 0.01, respectively, vs. control without HSF1 siRNA; +,++P < 0.05 or 0.01 vs. LDL without HSF1 siRNA; xP < 0.05 vs. glycated LDL without HSF1 siRNA.

 
Location of responsive element in PAI-1 promoter.
We speculate that a responsive element within the PAI-1 promoter may indirectly mediate glycated LDL–induced activation of the PAI-1 promoter. The hypothesis was examined using transfection assay in HUVECs transiently infected with a battery of 5'-deletion PAI-1 promoter fragment/reporter gene vectors. Treatment with glycated LDL or LDL (100 µg/ml for 24 h) significantly increased the activity of –1,528/55- and –1,197/55-bp PAI-1 promoter but not that of –1,105/55-bp PAI-1 promoter in comparison with control (P < 0.05 or 0.01). The effects of glycated LDL on the activation of the PAI-1 promoter were significantly greater than LDL at comparable conditions (P < 0.05; Fig. 6A). The transfection of empty vector did not substantially alter in PAI-1 promoter activity compared with no-transfection cultures (data not shown). The results suggest that a responsive element activated by glycated LDL or LDL locates between –1,197 and –1,105 bp of the PAI-1 promoter. A homolog of heat shock–responsive element (HSE) was detected within the –1,140/–1,127-bp region of the PAI-1 promoter (TAGAAATAAAGCA) using a transcription factor searching tool (http://www.cbrc.jp/research/tfsearch.html). The results of point mutagenesis assay within the region confirmed that the –1,137/–1,128-bp region of the PAI-1 promoter was required for the activation of PAI-1 promoter induced by glycated LDL or LDL (Fig. 6B).


Figure 6
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 6. Location of responsive element in the PAI-1 promoter activated by glycated LDL (gly-LDL). Subconfluent HUVECs were transfected with 5'-depletion PAI-1 promoter/reporter gene vector (–1,528/55, –1,197/55, or –1,105/55 bp), empty vector, wild-type (wt; –1,528/55 bp), or mutant PAI-1 promoter vectors (–1,139/–1,126 bp, sequence as indicated). Chlormaphenicol acetyltransferase (CAT) gene expression vector was cotransfected to the cells. Four hours after the transfection, the cells were treated with 100 µg/ml LDL or glycated LDL or vehicle (control) for 24 h. The luciferase activities of PAI-1 promoter were normalized with CAT activity and expressed in the folds of controls (means ± SD, averages of duplicates from three experiments). A: 5'-depletion transfection assay. B: Mutagenesis. M, mutants; Mut, mutants. Capital letters, wild-type sequence; lowercase letters, mutant sequence. *,**P < 0.05 or 0.01, respectively, vs. controls; +P < 0.05 vs. LDL.

 
Effect of glycated LDL on the binding of nuclear protein to the PAI-1 promoter.
HSF1 activates the transcription of multiple stress-response–related genes through its binding to HSE in the promoters of target genes (16). The effect of glycated LDL on the binding of nuclear proteins to the targeted region of PAI-1 promoter was investigated using EMSA. Treatment with glycated LDL or LDL visibly enhanced the binding of a nuclear protein to the labeled –1,141/–1,126-bp PAI-1 promoter fragment compared with control. Glycated LDL induced considerably greater binding of the nuclear protein to the PAI-1 promoter fragment compared with LDL. The addition of 50- or 200-fold of the unlabeled –1,141/–1,126-bp PAI-1 promoter fragment blocked the binding of the nuclear protein to undetectable level (Fig. 7A). Antibody against HSF1 induced a visible upward shift in the migration of the DNA-protein complex induced by glycated LDL or LDL or at basal condition (Fig. 7B). Nonspecific mouse IgG did not affect the migration of the nuclear protein (data not shown). The results were reproduced in four experiments. The findings suggest that glycated LDL increased the binding of HSF1 to a putative HSE in the PAI-1 promoter.


Figure 7
View larger version (55K):
[in this window]
[in a new window]

 
FIG. 7. Binding of nuclear protein to the PAI-1 promoter induced by glycated LDL (gly-LDL). Subconfluent HUVEC cultures were treated with vehicle (control) or 100 µg/ml LDL or glycated LDL for 24 h. A: Nuclear proteins extracted from LDL- or glycated LDL–treated or control endothelial cells were incubated with [32P]dNTP labeled –1,141/–1,126 bp of the PAI-1 promoter in the absence or presence of 50-fold (50x) or 200-fold (200x) excess unlabeled probe using EMSA. DNA-protein complexes were analyzed on 5% nondenatured acrylamide gel electrophoresis. B: Nuclear proteins extracted from LDL- or glycated LDL–treated or control cells were incubated with the labeled probe in the absence and presence of 0.5 µg/ml anti-HSF1 blocking antibody (HSFAb) or nonspecific mouse IgG (Ig G). Arrow indicates shifted DNA HSF1-antibody complex.

 
Effect of antioxidant on glycated LDL–induced HSF1 and PAI-1 expression.
Previous studies in our group demonstrated that 80 µmol/l BHT, a potent antioxidant, prevented glycated LDL–induced PAI-1 release from HUVECs or HCAECs (15). The effect of BHT on glycated LDL–induced HSF1 and PAI-1 expression in HCAECs was examined in the present study. BHT-gLDL significantly reduced glycated LDL–induced HSF1 and PAI-1 expression in HCAECs (P < 0.05 or 0.01; Fig. 8A). The levels of PAI-1 antigen or H2O2 in the conditioned media of HUVECs treated with BHT-gLDL were significantly lower than those treated with glycated LDL without BHT treatment (P < 0.05 or 0.01; Fig. 8B and C).


Figure 8
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 8. Effect of BHT on the expression of HSF1 and PAI-1 expression and the release of PAI-1 or H2O2. A: Subconfluent HCAECs were treated with vehicle (Ctr), 80 µmol/l BHT, 100 µg/ml LDL, glycated LDL (gLDL), or 100 µg/ml BHT-gLDL for 6 h (for HSF1) or 24 h (for PAI-1). The abundance of HSF1, PAI-1, and ß-actin was analyzed using Western blotting. Values are presented in means ± SD after normalization with ß-actin (n = 3 experiments). B and C: HUVECs were treated with lipoproteins as described in A for 48 h (for PAI-1) or for 2 h (for H2O2). B: PAI-1 levels in postcultural medium. C: H2O2 levels in postcultural medium. Values are presented in fold of control (means ± SD, n = 3 wells) after normalization with total cellular proteins (for PAI-1 antigen) or cell numbers (for H2O2). *,**P < 0.05 or 0.01, respectively, vs. control; +,++P < 0.05 or 0.01, respectively, vs. LDL; x,xxP < 0.05 or 0.01, respectively, vs. glycated LDL.

 

    DISCUSSION
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The major findings of the present study include that 1) glycated LDL stimulated the expression of HSF1 and Hsp-70 in cultured arterial or venous endothelial cells, 2) overexpression of the HSF1 gene upregulated the expression of PAI-1 in endothelial cells, 3) HSF1 siRNA blocked glycated LDL–induced PAI-1 expression in endothelial cells, and 4) glycated LDL enhanced the binding of HSF1 to a PAI-1 promoter fragment containing a HSE homolog. The findings suggest that HSF1 is involved in the upregulation of PAI-1 induced by glycated LDL in vascular endothelial cells.

Previous studies reported that proliferating endothelial cells responding to oxidized LDL on the expression of Hsp-70 were more active than nonproliferating endothelial cells (33). The results provided additional evidence that glycated LDL increased the expression of HSF1 in subconfluent human arterial or venous endothelial cells. The stimulating effect of glycated LDL on HSF1 was weaker in confluent endothelial cells compared with that in subconfluent endothelial cells (data not shown). The collection of these findings suggests that growing vascular endothelial cells may actively respond to hyperglycemia or oxidative stress–associated hyperbetalipoproteinemia on the expression of stress-response mediators.

Previous studies demonstrated that H2O2 activated HSF1 (34). H2O2 is derived from superoxide under the influence of superoxide dismutase (SOD) in cells. H2O2 is more stable than other ROS; therefore, it may function as an intracellular signal of oxidative stress (35,36). Our recent studies demonstrate that glycated LDL is a potent agonist for the generation of superoxide and H2O2 from endothelial cells compared with LDL, which implies that glycated LDL, a diabetes-associated lipoprotein, may lead to endothelial oxidative stress. The effect of glycated LDL on H2O2 generation from endothelial cells reached a peak after 2 h of incubation, which was associated with an elevated activity of SOD in endothelial cells (16). The results of the present study demonstrate that the expression of HSF1 in endothelial cells is significantly increased by glycated LDL after 4–6 h of incubation. The presence of antioxidant during the glycation suppressed the generation of H2O2 and the expression of HSF1 or PAI-1 in endothelial cells induced by glycated LDL. The combination of findings suggests that glyco-oxidation in glycated LDL and endothelial cell–derived ROS may contribute to glycated LDL–induced expression of HSF1 and PAI-1 in endothelial cells.

The increased expression of HSF1 was detected in human atherosclerotic lesions (37). The levels of circulating Hsp-72, an important member of inducible 70-kDa Hsp family, were significantly higher in type 1 diabetic patients with ketoacidosis compared with age-matching type 1 diabetic patients without ketoacidosis (22). The results of the present study indirectly support the hypothesis that diabetes-associated metabolic disorders may enhance stress responses in vascular endothelial cells. The upregulation of HSF1 in endothelial cells by glycated LDL may contribute to the upregulation of Hsp detected in endothelial cells or in the circulation of uncontrolled diabetic patients.

PAI-1 is an acute-phase reactant (38). Increased levels of PAI-1 have been observed in patients with sepsis (39) or recurrent myocardial infarction (40). During certain stresses, including wounding or bleeding, the increased generation of PAI-1 from endothelial cells may play a protective role through maintaining fibrin clots or the integrity of the extracellular matrix. Rücker et al. (41) demonstrated that heat shock increased the expression of PAI-1 in vascular tissue of rat muscle. Uchiyama et al. (42) reported that adenovirus vector-mediated overexpression of HSF1 gene reduced PAI-1 expression in cultured arterial endothelial cells, but the finding was not verified using any gene knockdown approach. The present study provided multiple lines of evidence for the involvement of HSF1 in glycated LDL–induced upregulation of PAI-1 in endothelial cells, including the inhibition of PAI-1 expression in arterial or venous endothelial cells by HSF1 siRNA and the suppression of PAI-1 promoter activity via mutagenesis of a HSE homolog in the PAI-1 promoter. The results suggest that HSF1 upregulates PAI-1 production through the binding of HSF1 to the PAI-1 promoter. The sequence of the –1,137/–1,128 bp of the PAI-1 promoter partially, but not completely, matches the authentic HSE. Considerable variations of HSE homologs have been described (43). HSF1 may interact with a homolog of HSE, the –1,137/–1,128 bp of PAI-1 promoter, which further enhances the transcription of the PAI-1 gene in endothelial cells.

The results of the present study demonstrated that LDL moderately increased the expression of HSF1 and cell-associated PAI-1 in endothelial cells. LDL may be oxidatively modified by a prolonged incubation with endothelial cells (44). A previous study in our group demonstrated that antioxidants reduced the abundance of lipid peroxides in LDL and prevented LDL-induced release of PAI-1 from endothelial cells (15). The effects of LDL on HSF1 and PAI-1 after a prolonged incubation with endothelial cells may result, at least in part, from cell-mediated oxidative modification on LDL.

In conclusion, glycated LDL stimulates the expression of HSF1 in vascular endothelial cells. HSF1 mediates glycated LDL–induced expression of PAI-1 in endothelial cells through enhancing the binding of HSF1 to the PAI-1 promoter. Glyco-oxidation of LDL and endothelial cell–derived ROS may play crucial roles in the upregulation of HSF1 and PAI-1 induced by glycated LDL. The findings from the present study provide a potential linkage between glycated LDL, stress response, and hypofibrinolysis. The results of the present study are generated from cultured endothelial cells. Subsequent studies in animal models potentially provide additional useful information on interrelationships between diabetes-associated lipoproteins and stress-response–or fibrinolysis-related proteins.


    ACKNOWLEDGMENTS
 
G.X.S. has received support from the Canadian Diabetes Association, the Canadian Institute of Health Research, Manitoba Health Research Council, the Innovation Fund through the province of Manitoba, and the Health Sciences Centre Foundation.


    FOOTNOTES
 
Published ahead of print at http://diabetes.diabetesjournals.org on 26 January 2007. DOI: 10.2337/db06-1199.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received for publication August 29, 2006 and accepted in revised form January 19, 2007


    REFERENCES
 TOP
 ABSTRACT
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Gregg EW, Cadwell BL, Cheng YJ, Cowie CC, Williams DE, Geiss L, Engelgau MM, Vinicor F: Trends in the prevalence and ratio of diagnosed to undiagnosed diabetes according to obesity levels in the U.S. Diabetes Care 27:2806–2812, 2004[Abstract/Free Full Text]
  2. Libby P, Theroux P: Pathophysiology of coronary artery disease. Circulation 111:3481–3488, 2005[Abstract/Free Full Text]
  3. Waddy SP: Disorders of coagulation in stroke. Semin Neurol 26:57–64, 2006[Medline]
  4. Carmassi F, Morale M, Puccetti R, De Negri F, Monzani F, Navalesi R, Mariani G: Coagulation and fibrinolytic system impairment in insulin dependent diabetes mellitus. Thromb Res 67:643–654, 1992[Medline]
  5. Juhan-Vague I, Roul C, Alessi MC, Ardissone JP, Heim M, Vague P: Increased plasminogen activator inhibitor activity in non insulin dependent diabetic patients: relationship with plasma insulin. Thromb Haemost 61:370–373, 1989[Medline]
  6. Alessi MC, Juhan-Vague I: Contribution of PAI-1 in cardiovascular pathology. Arch Mal Coeur Vaiss 97:673–678, 2004[Medline]
  7. Brodsky SV, Malinowski K, Golightly M, Jesty J, Goligorsky MS: Plasminogen activator inhibitor-1 promotes formation of endothelial microparticles with procoagulant potential. Circulation 106:2372–2378, 2002[Abstract/Free Full Text]
  8. Sasaki J, Cottam GL: Glycosylation of LDL decreases its ability to interact with high-affinity receptors of human fibroblasts in vitro and decreases its clearance from rabbit plasma in vivo. Biochim Biophys Acta 713:199–207, 1982[Medline]
  9. Meigs JB: Prevention of coronary heart disease in diabetes. Curr Treat Options Cardiovasc Med 7:259–271, 2005[Medline]
  10. Garber AJ: Cardiovascular complications of diabetes: prevention and management. Clin Cornerstone 5:22–37, 2003[Medline]
  11. Lyons TJ: Glycation and oxidation: a role in the pathogenesis of atherosclerosis. Am J Cardiol 71:26B–31B, 1993[Medline]
  12. Zhang J, Ren S, Sun D, Shen GX: Influence of glycation on LDL-induced generation of fibrinolytic regulators in vascular endothelial cells. Arterioscler Thromb Vasc Biol 18:1140–1148, 1998[Abstract/Free Full Text]
  13. Ren S, Lee H, Hu L, Lu L, Shen GX: Impact of diabetes-associated lipoproteins on generation of fibrinolytic regulators from vascular endothelial cells. J Clin Endocrinol Metab 87:286–291, 2002[Abstract/Free Full Text]
  14. Ma GM, Halayko AJ, Stelmack GL, Zhu F, Zhao R, Hillier CT, Shen GX: Effects of oxidized and glycated low-density lipoproteins on transcription and secretion of plasminogen activator inhibitor-1 in vascular endothelial cells. Cardiovasc Pathol 15:3–10, 2006[Medline]
  15. Ren S, Shen GX: Impact of antioxidants and HDL on glycated LDL-induced generation of fibrinolytic regulator in vascular endothelial cells. Arterioscler Thromb Vasc Biol 20:1688–1693, 2000[Abstract/Free Full Text]
  16. Zhao R, Shen GX: Functional modulation of antioxidant enzymes in vascular endothelial cells by glycated LDL. Atherosclerosis 179:277–284, 2005[Medline]
  17. Morano KA, Thiele DJ: Heat shock factor function and regulation in response to cellular stress, growth, and differentiation signals. Gene Expr 7:271–282, 1999[Medline]
  18. Sarge KD, Zimarino V, Holm K, Wu C, Morimoto RI: Cloning and characterization of two mouse heat shock factors with distinct inducible and constitutive DNA-binding ability. Genes Dev 5:1902–1911, 1991[Abstract/Free Full Text]
  19. Mivechi NF, Koong AC, Giaccia AJ, Hahn GM: Analysis of HSF-1 phosphorylation in A549 cells treated with a variety of stresses. Int J Hyperthermia 10:371–379, 1994[Medline]
  20. Hamilton KL, Gupta S, Knowlton AA: Estrogen and regulation of heat shock protein expression in female cardiomyocytes: cross-talk with NF kappa B signaling. J Mol Cell Cardiol 36:577–584, 2004[Medline]
  21. Christians ES, Zhou Q, Renard J, Benjamin IJ: Heat shock proteins in mammalian development. Semin Cell Dev Biol 14:283–290, 2003[Medline]
  22. Metzler B, Abia R, Ahmad M, Wernig F, Pachinger O, Hu Y, Xu Q: Activation of heat shock transcription factor 1 in atherosclerosis. Am J Pathol 162:1669–1676, 2003[Abstract/Free Full Text]
  23. Oglesbee MJ, Herdman AV, Passmore GG, Hoffman WH: Diabetic ketoacidosis increases extracellular levels of the major inducible 70-kDa heat shock protein. Clin Biochem 38:900–904, 2005[Medline]
  24. Duell PB, Oram JF, Bierman EL: Nonenzymatic glycosylation of HDL resulting in inhibition of high-affinity binding to cultured human fibroblasts. Diabetes 39:1257–1263, 1990[Abstract]
  25. Ren S, Man RY, Angel A, Shen GX: Oxidative modification enhances lipoprotein(a)-induced overproduction of plasminogen activator inhibitor-1 in cultured vascular endothelial cells. Atherosclerosis 128:1–10, 1997[Medline]
  26. Cockell KA, Ren S, Sun J, Angel A, Shen GX: Effect of thrombin on release of plasminogen activator inhibitor-1 from cultured primate arterial smooth muscle cells. Thromb Res 77:119–131, 1995[Medline]
  27. Antalis TM, Clark MA, Barnes T, Lehrbach PR, Devine PL, Schevzov G, Goss NH, Stephens RW, Tolstoshev P: Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor. Proc Natl Acad Sci U S A 85:985–989, 1988[Abstract/Free Full Text]
  28. Ponte P, Ng SY, Engel J, Gunning P, Kedes L: Evolutionary conservation in the untranslated regions of actin mRNAs: DNA sequence of a human beta-actin cDNA. Nucleic Acids Res 12:1687–1696, 1984[Abstract/Free Full Text]
  29. Rabindran SK, Giorgi G, Clos J, Wu C: Molecular cloning and expression of a human heat shock factor, HSF1. Proc Natl Acad Sci U S A 88:6906–6910, 1991[Abstract/Free Full Text]
  30. Ding X, Tsokos GC, Kiang J: Overexpression of HSP-70 inhibits the phosphorylation of HSF1 by activating protein phosphatase and inhibiting protein kinase C activity. FASEB J 12:451–459, 1998[Abstract/Free Full Text]
  31. Nickel BE, Kardami E, Cattini PA: Differential expression of human placental growth-hormone variant and chorionic somatomammotropin in culture. Biochem J 267:653–658, 1990[Medline]
  32. Dawson SJ, Wiman B, Hamsten A, Green F, Humphries S, Henney AM: The two allele sequences of a common polymorphism in the promoter of the plasminogen activator inhibitor-1 (PAI-1) gene respond differently to interleukin-1 in HepG2 cells. J Biol Chem 268:10739–10745, 1993[Abstract/Free Full Text]
  33. Zhu W, Roma P, Pirillo A, Pellegatta F, Catapano AL: Human endothelial cells exposed to oxidized LDL express hsp70 only when proliferating. Arterioscler Thromb Vasc Biol 16:1104–1111, 1996[Abstract/Free Full Text]
  34. Giordano FJ: Oxygen, oxidative stress, hypoxia, and heart failure. J Clin Invest 115:500–508, 2005[Medline]
  35. Ardanaz N, Pagano PJ: Hydrogen peroxide as a paracrine vascular mediator: regulation and signaling leading to dysfunction. Exp Biol Med 231:237–251, 2006[Abstract/Free Full Text]
  36. Zou J, Salminen WF, Roberts SM, Voellmy R: Correlation between glutathione oxidation and trimerization of heat shock factor 1, an early step in stress induction of the Hsp response. Cell Stress Chaperones 3:130–141, 1998[Medline]
  37. Rocnik E, Chow LH, Pickering JG: Heat shock protein 47 is expressed in fibrous regions of human atheroma and Is regulated by growth factors and oxidized low-density lipoprotein. Circulation 101:1229–1233, 2000[Abstract/Free Full Text]
  38. Plow EF, Herren T, Redlitz A, Miles LA, Hoover-Plow JL: The cell biology of the plasminogen system. FASEB J 9:939–945, 1995[Abstract]
  39. Hermans PW, Hazelzet JA: Plasminogen activator inhibitor type 1 gene polymorphism and sepsis. Clin Infect Dis 41 (Suppl. 7):S453–S458, 2005
  40. Wiman B, Andersson T, Hallqvist J, Reuterwall C, Ahlbom A, deFaire U: Plasma levels of tissue plasminogen activator/plasminogen activator inhibitor-1 complex and von Willebrand factor are significant risk markers for recurrent myocardial infarction in the Stockholm Heart Epidemiology Program (SHEEP) study. Arterioscler Thromb Vasc Biol 20:2019–2023, 2000[Abstract/Free Full Text]
  41. Rücker M, Schafer T, Scheuer C, Harder Y, Vollmar B, Menger MD: Local heat shock priming promotes recanalization of thromboembolized microvasculature by upregulation of plasminogen activators. Arterioscler Thromb Vasc Biol 26:1632–1639, 2006[Abstract/Free Full Text]
  42. Uchiyama T, Atsuta H, Utsugi T, Oguri M, Hasegawa A, Nakamura T, Nakai A, Nakata M, Maruyama I, Tomura H, Okajima F, Tomono S, Kawazu S, Nagai R, Kurabayashi M: HSF1 and constitutively active HSF1 improve vascular endothelial function (heat shock proteins improve vascular endothelial function). Atherosclerosis 190:321–329, 2007[Medline]
  43. Amin J, Ananthan J, Voellmy R: Key features of heat shock regulatory elements. Mol Cell Biol 8:3761–3769, 1988[Abstract/Free Full Text]
  44. Steinbrecher UP, Parthasarathy S, Leake DS, Witztum JL, Steinberg D: Modification of low density lipoprotein by endothelial cells involves lipid peroxidation and degradation of low density lipoprotein phospholipids. Proc Natl Acad Sci U S A 81:3883–3887, 1984[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
db06-1199v1
56/5/1436    most recent
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, R.
Right arrow Articles by Shen, G. X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, R.
Right arrow Articles by Shen, G. X.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Diabetes Diabetes Care Clinical Diabetes Diabetes Spectrum