Advertisement

Effect of the (C825T) Gβ3 Polymorphism on Adrenoceptor-Mediated Lipolysis in Human Fat Cells

  1. Mikael Rydén,
  2. Gary Faulds,
  3. Johan Hoffstedt,
  4. Anders Wennlund and
  5. Peter Arner
  1. From the Department of Medicine, Karolinska Institutet and Clinical Research Center at the Center of Metabolism and Endocrinology, Huddinge Hospital, Huddinge, Sweden

    Abstract

    A common Gβ3 gene polymorphism (C825T) influences G protein receptor-mediated signal transduction. We investigated whether this polymorphism influences lipolysis in isolated subcutaneous fat cells from 114 healthy obese subjects. The Gβ3 protein content was markedly decreased in adipocytes of TT carriers, but the alternatively spliced short form of Gβ3 previously shown in platelets of 825T carriers was not detected. Fat cells of TT carriers showed a significant 10-fold decrease in the half-maximum effective concentration of agonists selective for lipolytic β1- and β2-adrenoceptors as well as for the antilipolytic α2A-adrenoceptor. In TT carriers, maximum β-adrenoceptor agonist-stimulated lipolysis was decreased, but the maximum antilipolytic effect of α2-adrenoceptors was less marked. Norepinephrine induced adipocyte lipolysis and circulating fasting levels of free fatty acids and glycerol were reduced by half in TT carriers. The polymorphism did not influence the adipocyte content of α2A-adrenoceptors, β2-adrenoceptors, Gαi, or Gαs. In conclusion, the C825T variant of Gβ3 influences lipolysis. Adipocytes of TT carriers have a lower Gβ3 protein content and a decreased function of native Gs- as well as Gi-coupled adrenoceptors, which reduces the lipolytic effect of catecholamines. These data differ from those obtained in other cell systems that have shown increased expression of an alternative spliced Gβ3 variant and enhanced G protein signaling in 825T carriers, indicating that the polymorphism has cell type-specific effects that may be of importance for type 2 diabetes and other insulin-resistant conditions.

    Polymorphisms in genes for proteins involved in G protein receptor signaling pathways may alter corresponding hormone function and therefore be involved in the pathogenesis of several endocrine disorders, including diabetes and obesity. G proteins are composed of three subunits—α, β, and γ-with each having a number of isoforms (1). These interact in different combinations that in turn determine the nature of the downstream signal. The β and γ subunits form heterodimers that interact with different α components. After ligand receptor binding, the α component dissociates from the β and γ dimers and initiates distinct downstream signaling cascades. Several of these pathways affect cAMP formation and regulate metabolic processes related to diabetes, such as fat cell lipolysis. A common polymorphism (C825T) in the gene coding an isoform of the β subunit, Gβ3 and located in exon 10, has been reported to cause variation in protein expression (2). Because of a paradoxical alternative splicing of exon 9, an additional 41-amino-acid shorter form (Gβ3-s) is produced. Functional studies on transformed lymphoblasts and transfected insect cells have suggested that Gβ3-s enhances G protein signaling, possibly by formation of a tighter Gαi-βγ complex than full-length Gβ3 (2). It has been suggested that the Gβ3 polymorphism is a genetic component of hypertension (3), although the hypertensive effect could be mediated by indirect effects (2). It is also possible that the Gβ3 polymorphism plays a role in the development of obesity and type 2 diabetes. Several studies have shown increased 825T allele frequency among obese or type 2 diabetic subjects (46). Women with this allele are also at high risk for postpregnancy weight retention (7). Because the frequency of the 825T allele is much higher among African and Asian than among Caucasian populations, it has been suggested that Gβ3 is a “thrifty gene” that may contribute to obesity, diabetes, and hypertension if Westernization of lifestyle continues (8)

    So far, information is available only about the effect of C825T on the function of signaling pathways that involve Gαi (1). It is not known whether this Gβ3 gene polymorphism also influences signal transduction through Gαs. The β subunit of the G protein complex is common for both Gαi and Gαs, and Gβ3 is ubiquitously expressed (1). Therefore, a functional variation in the protein may influence the action of Gαs- as well as Gαi-coupled receptors. Furthermore, the silent C825T polymorphism may have different effects on Gβ3 mRNA splicing and protein production among specific native cell types

    The subcutaneous fat cell is a useful and relatively easily available cell type for studying native human receptors that signal through G proteins (9). β1- and β2-adrenoceptors (Gαs coupled and stimulatory) and α2A-adrenoceptors (Gαi coupled and inhibitory) coexist in human fat cells, where they can fully activate or inhibit lipolysis, respectively, as a primary event in these cells. Human fat cells also contain a β3-adrenoceptor that is not fully active in the subcutaneous adipose region (9,10)

    It is not known whether the C825T Gβ3 gene polymorphism influences adrenoceptor-mediated lipolysis in fat cells. This question is of considerable clinical relevance because of the putative role of catecholamines in regulating lipolysis in insulin-resistant subjects (10). A functional polymorphism in a gene controlling early events in adipocyte receptor signaling, such as Gβ3, might have consequences for the final, and physiologically most important, metabolic event—namely, stimulation/inhibition of lipolysis in adipocytes. However, a change in G protein signal transduction might also be compensated for at a distal step in the lipolysis cascade, resulting in a normal lipolysis phenotype. As part of a study to characterize adrenergic regulation of lipolysis in isolated subcutaneous adipocytes in obesity, we identified 114 obese but otherwise healthy subjects with the C825T polymorphism in the Gβ3 gene. The in vitro effects of norepinephrine and selective lipolysis acting agents were compared between carriers of the C and T alleles. We hypothesized that if the polymorphism is important for lipolysis regulation in native human fat cells, then it would be accompanied by variations in the activity of selective β- as well as α2-adrenoceptor agonists and also perhaps of natural catecholamines. The protein content of Gβ3 and other key elements in the G protein signaling system in fat cells was also assessed by Western blot analysis

    RESEARCH DESIGN AND METHODS

    Subjects

    We investigated 114 obese subjects (21 men and 93 women) of Scandinavian origin who were consecutively recruited to study adrenergic regulation of lipolysis in subcutaneous fat cells. The subjects were obese healthy volunteers or obese otherwise healthy subjects who were referred to our obesity unit for treatment for being overweight. None of the subjects was completely sedentary or involved in sporting activities. None had undertaken a weight-reduction diet during the 6 months before the study. Obesity was defined using World Health Organization criteria (BMI >30 kg/m2). The BMI of the subjects ranged from 30.4 to 53.4 kg/m2. None of the subjects was on regular medication. Their ages ranged from 20 to 72 years, and 12 women were menopausal. (It has recently been shown that menopause does not influence lipolysis regulation in human subcutaneous fat cells [11]). The study was approved by the ethics committee of Huddinge Hospital. The procedure was initially explained to each subject, and his or her consent was then obtained

    The subjects came to the laboratory at 8:00 a.m. after an overnight fast. Height and weight were determined and a fasting venous blood sample was obtained for the determination of plasma glycerol, glucose, insulin, triglycerides, cholesterol, HDL cholesterol, and serum-free fatty acids, as previously described (12). Thereafter, a subcutaneous fat biopsy (∼1–2 g) was obtained under local anesthesia from the umbilical region (13)

    Fat cell experiments

    The methods to perform and analyze fat cell experiments have been described in detail elsewhere (14,15). In brief, isolated fat cells were prepared and their average size, volume, and weight were determined. Diluted fat cell suspensions (2%, vol/vol) were incubated in duplicate for 2 h at 37°C in a Krebs-Henseleit phosphate buffer (pH 7.4) containing bovine albumin (20 g/l), glucose (1 mg/ml), and ascorbic acid (0.1 mg/ml). At the end of the incubation, an aliquot of the medium was removed for glycerol analysis (lipolysis index) and analysis of the amount of glycerol release related to the number of incubated fat cells

    The following agents were added (at concentrations of 10−10 to 10−4 mol/l, depending on the type of agent) to the incubation medium at the start of the experiment; norepinephrine (a natural catecholamine), isoprenaline (a nonselective β-adrenergic agonist), dobutamine (a selective β1-adrenoceptor agonist), terbutaline (a selective β2-adrenoceptor agonist), clonidine (a selective α2-adrenoceptor agonist), and dibutyryl cyclic AMP (dcAMP; a phosphodiesterase-resistant cyclic AMP analog). The basal condition was defined as that with no agonist present. In the clonidine experiments, adenosine deaminase (1 unit/ml) was added to the incubation medium to avoid the influence of adenosine on the antilipolytic effect of clonidine

    Because human subcutaneous fat cells have functional spare α2- and β-adrenergic receptors (16), it is possible to use classical pharmacological methods to evaluate receptor function (17). The individual concentration response curves were linearized by log-logit transformation and analyzed for pD2 (negative logarithm of half-maximum effective concentration [EC50]). Furthermore, responsiveness (glycerol release at maximum effective drug concentration) was determined from the original curves. Changes in pD2 reflect receptor events (binding and coupling to effector), whereas changes in responsiveness reflect receptor events as well as more distal and postreceptor-related events (17). The intrinsic activity of dobutamine and terbutaline was also determined according to the following formula: lipolysis at maximum effective dobutamine/terbutaline concentration minus basal lipolysis divided by lipolysis at maximum effective isoprenaline concentration minus basal lipolysis. Although the β1- and β2-adrenoceptor agonists used might be less selective in other systems, we have previously demonstrated the selectivity of dobutamine and terbutaline on β-adrenoceptor-mediated lipolysis in isolated human fat cells (15). A plateau of response was reached at the highest concentrations in all cases and with all drugs. Thus, it was possible to get an accurate measure of pD2, intrinsic activity, and the responsiveness of the different drugs in each of the subjects investigated

    Genotyping

    DNA was prepared from frozen (−20°C) venous blood. The C825T polymorphism in the Gβ3 gene was determined exactly as previously described (2). A combination of PCR and digestion of the PCR product with the restriction enzyme BseD1 (to obtain restriction fragments of various lengths) was used. The accuracy of the method was confirmed by direct sequencing (Cybergene, Stockholm, Sweden)

    Protein isolation and immunodetection

    Because the amount of adipose tissue available was limited and priority was given to lipolysis experiments, cells for subsequent protein analysis could be saved only from a limited number of subjects. Aliquots (300 μl) of packed cells were lysed in protein lysis buffer (1% Triton X-100, Tris-HCl [pH 7.6], 150 mmol/l NaCl) supplemented with protease inhibitors (1 mmol/l phenylmethylsulfonyl fluoride and Complete [Boehringer Mannheim, Mannheim, Germany]), and homogenized using a microtome. The homogenate was centrifuged at 14,000 rpm for 30 min, and the infranatant was removed and saved. All steps were performed at 4°C to minimize the risk of protein degradation. The protein content in each sample was determined using a kit of reagents from Pierce Biotech (Rockford, IL). For detection of total intracellular Gβ content, 100 μg total protein were directly loaded onto 12% polyacrylamide gels and separated by standard SDS-PAGE. To specifically detect Gβ3, 100 μg total protein were immunoprecipitated overnight at 4°C in the presence of anti-Gβ3 antibody (1:200; Santa Cruz Biotechnology, Santa Cruz, CA). Samples were then incubated with protein-A-Sepharose beads (Pharmacia, Uppsala, Sweden), washed, boiled, and loaded in parallel with the samples for total Gβ content. To control for differences in gel migration, exposure time, antibody incubation, and so on, all samples were run on the same gels and transferred to the same polyvinylidine fluoride membranes (Amersham, Little Chalfont, U.K.). Blots were blocked for 1 h at room temperature in Tris-buffered saline with 0.1% Tween-20 and 5% non-fat dried milk. This was followed by an overnight incubation at 4°C in the presence of antibodies against all isoforms of Gβ (Santa Cruz Biotechnology). To confirm antibody specificity, positive controls provided by the manufacturer were included in all experiments. Secondary antibodies conjugated to horseradish peroxidase were obtained from Sigma (St Louis, MO) (α-rabbit 1:4,000). Antigen-antibody complexes were detected by chemiluminescence using a kit of reagents for enhanced chemiluminescence (Amersham) and blots were exposed to high-performance chemiluminescence film (Amersham). Films were scanned and the optical density (OD) of each specific band was analyzed using the program Image (National Institutes of Health, Bethesda, MD) and expressed as OD · mm−2 · 100 μg−1 total protein. Additional proteins were measured on the same samples as were used for Gβ using antibodies (all from Santa Cruz Biotechnology) directed toward the following: α2A-adrenoceptor, β2-adrenoceptor, Gαi, and Gαs

    Assessment of mRNA expression

    RT-PCR for Gβ3 and Gβ3-s mRNA transcripts was attempted as follows. For an individual reaction, 15 pmol oligo d(T) primer or a specific 3′ Gβ3 primer (either GAAGCAGATCAGCTCCTGGT or CCTCCTCAGTTCCAGATTTTGAGGA) was added to the RT mix, containing 1× reaction buffer (Promega), 6.5 mmol/l dNTPs, 1 mmol/l MnCl2, and 5 units rtTh RT (Promega) enzyme. The enzymatic reaction consisted of incubation at 25°C for 10 min, followed by incubations of 3 min at 60°C, 15 min at 72°C, and 5 min at 99°C. This cDNA synthesis procedure is standard in our laboratory. Then 4 μl of the reverse transcribed sample were used for the subsequent PCR reactions. An individual reaction comprised 45 pmol 5′ primer, 45 pmol 3′ primer, 2.5 units Thermophylus aquaticus (Taq) polymerase, 1 polymerase reaction buffer (Gibco), and 0.2 mmol/l dNTPs. MgCl2 was added at a range of concentrations (1–4 mmol/l). The PCR reaction proceeded according to two different protocols, either with a stepwise increase in annealing temperature from 37 to 72°C or by a stepwise reduction in temperature per cycle from 64 to 50°C. Positive controls (using oligonucleotides specific for either leptin or uncoupling protein 2) were used in parallel to control for cDNA quality and PCR efficiency. To detect the product, 5–10 μl of the PCR reaction were loaded onto a 2% agarose/Tris-acetate-EDTA (TAE) gel containing 0.5 μg/ml EtBr and run at 100 V for 1–2 h in 1× TAE buffer

    Drugs and chemicals

    BSA (fraction V) was obtained from Sigma (St Louis, MO), (-)-isoprenaline hydrochloride from Hässle (Mölndal, Sweden), terbutaline sulfate from Draco (Lund, Sweden), dobutamine hydrochloride from Lilly (Indianapolis, IN), clonidine from Boehringer-Ingelheim (Ingelheim, Germany), Taq polymerase from Perkin-Elmer/Cetus (Emeryville, CA), and the restriction enzyme BseD1 from New England Biolabs (Beverly, MA)

    Statistical analysis

    Analyses of phenotypic values included descriptive statistics (mean + SD by genotype or box plot) and were performed by ANOVA and post hoc test or ANCOVA adjusted for sex and, when stated, age and BMI. In some cases, χ2 and Student’s unpaired t tests were performed. A 5% significance level was used for hypothesis testing. The statistical software program used was Stat View (SAS Institute, Cary, NC)

    RESULTS

    Allelic frequencies

    We found 8 subjects who carried the T variant in the homozygous form; 45 subjects were heterozygous. The remaining 61 subjects were homozygous for the C allele. The observed genotype frequency was similar to that previously reported in other Caucasian populations (4) and is in Hardy-Weinberg equilibrium. The sex distribution (Table 1) did not differ significantly among genotypes, although there was a trend toward an increased number of males in the small TT group (P = 0.10). Therefore, all subsequent statistical analyses were corrected for sex using ANCOVA

    Clinical findings

    The clinical data for comparison among genotypes is shown in Table 1. No significant differences among TT, CT, and CC carriers were seen for age, BMI, fasting plasma levels of glucose, insulin, catecholamines, lipids, or fat cell volume. On the other hand, fasting circulating levels of glycerol and free fatty acids were significantly reduced by half in the TT group, but there were no apparent differences between CC and CT carriers

    pD2 for lipolysis of selective adrenergic agonists

    Mean concentration-response curves for the selective agonists are shown for illustrative purposes in Fig. 1. For terbutaline (β2 selective), dobutamine (β1 selective), and clonidine (α2 selective), the mean curves of TT carriers were shifted to the right of those for CC carriers. The pD2 values according to genotype for the whole cohort are shown in Fig. 2. A significant relationship between the polymorphism and pD2 for all selective agonists was observed. For terbutaline (P = 0.02) and clonidine (P = 0.004), the T homozygotes had ∼1 log unit lower mean pD2 values than the C homozygotes. Heterozygotes had intermediate values. This represents a 10-fold difference in EC50 between T and C homozygotes. For dobutamine (P = 0.007), the T homozygotes had ∼0.5 log unit lower mean pD2 values than C homozygous or heterozygous subjects, which represented about a sevenfold difference in EC50. Because pD2 appeared to be reduced in both CT and TT carriers, T heterozygotes and homozygotes were also combined into one group. The pD2 values for CT/TT carriers and CC carriers are shown in Table 2. For all three ligands, the pD2 values were ∼0.5 log unit higher among CC than CT/TT carriers. This difference was statistically significant (P from 0.007 to 0.019) and was observed in the whole (a correction for sex was made) as well as in the female subgroup. The analysis of data presented in Table 2 was not influenced in an important way if either BMI or age was included as a covariable in the statistical analysis

    Responsiveness for lipolysis

    Data on the maximum action of the lipolysis agents (responsiveness) are shown in Table 3. There was no significant difference among TT, CT, and CC carriers with regard to basal, lipolysis, adenosine deaminase-induced lipolysis, or maximally stimulated lipolysis by dcAMP. However, clonidine lipolysis was maximally inhibited to a significantly lower rate in CC than in TT or CT carriers. Furthermore, maximum isoprenaline-, terbutaline-, dobutamine-, or norepinephrine-induced lipolysis rates were significantly reduced in TT carriers by almost half (P from <0.01 to 0.02). On the other hand, CC and CT carriers had similar responsiveness for the different β-adrenergic agonists as well as for norepinephrine

    Intrinsic activity for lipolysis of selective β-adrenergic agonists

    We also investigated if terbutaline and dobutamine were full or partial agonists in the different genotype groups by measuring their lipolytic effect in relation to the nonselective full agonist isoprenaline. This intrinsic activity for terbutaline was 0.86 + 0.11, 0.88 + 0.21, and 0.84 + 0.14 in CC, CT, and TT carriers, respectively (P = 0.43). Corresponding values for dobutamine were 0.83 + 0.15, 0.83 + 0.23, and 0.75 + 0.15 (P = 0.49). The intrinsic activity values for the two agents did not differ among TT, CT, and CC carriers. In other words, terbutaline and dobutamine were to the same extent almost full agonists in all genotypes

    Protein determination

    To assess the amount of Gβ3 protein in isolated adipocytes, we measured the protein content of Gβ3 in frozen cell samples from four TT homozygotes, four CT heterozygotes, and seven CC homozygotes. Because of the relative scarcity of TT subjects, the four samples included were the only ones remaining. In contrast, the CT and CC samples were picked at random for analysis. First, 100 μg isolated protein was either loaded directly onto polyacrylamide gels or immunoprecipitated overnight with a commercially available antibody against Gβ3. Both samples were separated by standard SDS-PAGE on the same gels and transferred to membranes for Western blotting. Gβ proteins were then detected with an antibody that recognizes all forms of Gβ. Total Gβ protein content was not different in samples from the different genotypes (Fig. 3A, left). In contrast, Gβ3 protein content was markedly reduced in carriers of the T allele (Fig. 3A, right). Densitometric scanning and quantification demonstrated a statistically significant 80% reduction of Gβ3 content in T compared to C homozygotes (157 + 78 vs. 824 + 272 OD · mm−2 · 100 μg−1 total protein, respectively; P = 0.02) (Fig. 3B). CT heterozygotes displayed an intermediate 57% reduction of Gβ3 expression (351 + 129 OD · mm−2 · 100 μg−1 total protein). Combining the data from all T allele carriers revealed a significant difference in Gβ3 protein content as compared to CC subjects (824 + 272 vs. 254 + 79 OD · mm−2 · 100 μg−1 total protein for CC and CT/TT carriers, respectively;P = 0.015). We could not observe any expression of the previously described Gβ3-s protein in any of the samples. This could have been because of a low or absent expression of this splice variant in human adipocytes

    To determine whether the reduced protein expression of Gβ3 in TT carriers was specific, we ran additional Western blots on the same adipose samples described above (Fig. 4). Although the levels differed among subjects, the protein amount of α2A-adrenoceptor, β2-adrenoceptor, Gαi, or Gαs was not influenced in a significant way by the C825T polymorphism (OD values not shown)

    Gβ3 mRNA expression

    Attempts were made to detect Gβ3 and Gβ3-s mRNA transcripts in C and T allele carriers using RT-PCR. Although several different protocols were attempted, including that previously published by Siffert et al. (4) and novel modifications by the same group of investigators (W. Siffert and D. Rosskopf, personal communication), we could not detect a Gβ3 mRNA transcript in adipose tissue or in a number of other tissues, including platelets. Difficulties in detecting Gβ3 mRNA in native human tissues has been experienced by other investigators (D. Rosskopf, personal communication). Because previously published studies of Gβ3 mRNA have been performed only in cells overexpressing the Gβ3 gene (2), our results could indicate that Gβ3 mRNA is either highly unstable or is expressed at very small amounts, thereby preventing a reliable detection in native human tissue

    DISCUSSION

    This study demonstrated significant effects of the C825T polymorphism in the Gβ3 gene on the function of several different native adrenergic receptor subtypes in apparently healthy obese subjects, as assessed by lipolysis in freshly isolated subcutaneous adipocytes. Using immortalized lymphoblasts and transfected insect cells, it was previously found that the C825T polymorphism influences signaling through Gαi (2). However, the Gβ protein is a common pathway for both Gαi- as well as Gαs-coupled receptors. Therefore, if functional, a structural variation in the Gβ3 gene should influence both inhibitory and stimulatory G protein-coupled receptors. For lipolysis in fat cells, we found that the T variant of Gβ3 in its homozygous form was associated with a marked decrease in pD2 values for terbutaline (β2-adrenoceptor selective), dobutamine (β1-adrenoceptor selective), and clonidine (α2-adrenoceptor selective). The responsiveness for these agents and for the nonselective β-adrenergic agonist isoprenaline was also decreased. However, the polymorphism did not influence basal lipolysis, adenosine deaminase-induced lipolysis, or dcAMP-mediated lipolysis (the latter reflects actions at the most distal step in lipolysis action the protein kinase A hormone-sensitive complex). Our lipolysis data therefore suggest that the T-to-C substitution alters the Gβ3 protein in a way that decreases signaling of β1-, β2-, and α2-adrenoceptors for adipocyte lipolysis at some earlier steps above protein kinase A. The polymorphism may have a more marked effect on Gαs- than Gαi-coupling, as responsiveness for norepinephrine was decreased in adipocytes of TT carriers. Norepinephrine’s effects on lipolysis reflect the net sum of β- and α2- adrenoceptor signaling

    The findings with lipolysis were surprising, as earlier studies on immortalized lymphoblasts have shown increased signal transduction, at least for Gαi-coupled receptors (2). An increased efficiency of the Gαi signaling complex in lipolysis experiments is predicted to increase clonidine pD2 and/or responsiveness in human adipocytes (16). To obtain a mechanistic insight, we studied Gβ3 protein content in fat cells from a subset of subjects. The total Gβ content was not influenced by the polymorphism. However, the amount of Gβ3 was markedly decreased in adipocytes of 825T allele carriers. Furthermore, there was no apparent presence of the proposed alternative splice variant Gβ3-s. This finding is in contrast to earlier findings with platelets that showed a normal content of full-length Gβ3 (2). We believe that this is unlikely to be attributable to methodological reasons, as we used the same antibodies as in previous studies (2). However, we cannot exclude the presence of very low levels of Gβ3-s protein in fat cells of 825T carriers that were below the detection limit of the present assays. The data are also at odds with earlier functional studies on the native protein. Thus, in vivo-stimulated coronary vasoconstriction through α2-adrenoceptors (Gαi-coupled) has been found to be enhanced in C825T carriers as compared to C825C carriers (18). Furthermore, stimulation of interleukin-8 receptors (Gαi-coupled) induced more prominent chemotaxis in neutrophils from individuals with the TC/TT genotypes than in those with the CC genotype (19). For the moment, we have no definite explanation for the divergence in these findings, although cell type-specific effects of the polymorphism are possible. For example, the 825T variation may cause alternative splicing in some cells (immortalized lymphoblasts, platelets), but decreased translational efficiency in other cells, such as fat cells. The complexity of G protein signaling, which involves numerous receptors and G protein subunit isoforms, allows for thousands of receptor-G protein combinations and variations in signal transduction (20,21). It is also possible that the splice variant influences other pathways involving G proteins in fat cells that were not investigated here (i.e., Gαq and Gαo). Furthermore, the alteration in adrenoceptor signal transduction in fat cells of T825T subjects was probably attributable to a selective alteration of Gβ3. The reason for this is that the protein levels of other key regulators, such as β2-adrenoceptor, α2-adrenoceptor, Gαi, and Gαs were not changed in TT carriers

    Our results suggest that the noncoding C825T polymorphism affects the production of full-length Gβ3 protein, possibly by affecting transcriptional and/or translational regulation. Unfortunately, it was not possible to study such events because of the lack of sufficient amounts of adipose tissue. We tried to measure Gβ3 mRNA but were not able to amplify the gene product by PCR. It is difficult to obtain quantitative measures of Gβ3 mRNA in native human cells and tissues (D. Rosskopf, personal communication). So far, only data with mRNA for Gβ3 have been reported for an artificial cell system (2)

    Whether the Gβ3 polymorphism is of pathophysiological importance for insulin resistant conditions such as obesity is controversial. An association to obesity has been demonstrated in some studies (4) but not in others (22). If, however, the Gβ3 polymorphism is a thrifty gene variation (8), it makes sense that the 825T allele is associated with impaired catecholamine-induced lipolysis in fat cells. A number of in vivo and in vitro studies have shown that catecholamine-induced lipolysis in subcutaneous adipose tissue is decreased in several insulin-resistant conditions, such as obesity, metabolic syndrome, familial combined hyperlipidemia, and polycystic ovary syndrome (10). The present results are also in line with studies on subjects with Gαs deficiency. Such subjects are obese and have resistance to the in vivo lipolytic action of catecholamines as compared to matched controls (23). Thus, a reduction in adipocyte protein content of different subunits in Gs signaling (Gαs and Gβ3) seems to impair lipolysis activation by catecholamines in human fat cells. The present observation of low circulating levels of fatty acids and glycerol in fasted T825T subjects further supports the role of Gβ3 in regulating lipolysis in man. We have previously shown that fasting circulating levels of glycerol and free fatty acids measured in the morning closely mirror the rate of lipolysis in subcutaneous adipose tissue (24)

    It should be noted that in this study, only obese subjects were investigated, so we do not know the importance of the polymorphism in a lean population. Some attempts were made to analyze the clinical effects of C825T, bearing in mind that subjects with disorders comorbid with obesity, such as diabetes, hypertension, and dyslipidemia, were not included. The polymorphism had no apparent effect on BMI, insulin sensitivity, or plasma lipids. We included men and women in the study. It is unlikely that the findings were influenced to an important extent by sex, as we made statistical corrections for sex. Furthermore, in a subgroup analysis, the genotype effect on pD2 for all selective adrenergic agonists was statistically significant in women. It remains to be established, on the other hand, if the polymorphism is also functional in fat cells of obese men. Because of the paucity of obese men, it was not possible to make a reliable evaluation of the polymorphism in the male subgroup

    In conclusion, the results of this study suggest that the C825T polymorphism in the Gβ3 gene influences catecholamine-induced lipolysis in vitro and lipolysis in vivo. The polymorphism may regulate the content of Gβ3 protein in human fat cells and thereby cause variations in lipolysis mediated by native Gαi- as well as Gαs-coupled receptors. The 825T allele appears to decrease the amount of Gβ3 in fat cells and thereby inhibit signaling to lipolysis through β1-, β2-, and α2-adrenergic receptors, and the net effect is decreased catecholamine action. This effect may be a particular feature of the Gβ3 gene in adipocytes, as 825T has been reported to actually increase Gαi signal transduction in other native cells, possibly as a result of increased production of an alternative spliced short form of Gβ3

    FIG. 1.

    Mean concentration response curves for clonidine (A), dobutamine (B), and terbutaline (C) in C825C (○) and T825T (•) subjects.

    FIG. 2.

    Box plot of pD2 values for lipolysis induced by terbutaline (A), dobutamine (B), and clonidine (C) in CC carriers (□), CT carriers ([cjs2112]), and TT carriers ([cjs2108]) of the C825T gene polymorphism in the Gβ3 gene. Values on y-axes are the pD2 values. (For further details see research design and methods.) Values were compared by ANOVA with sex as a cofactor.

    FIG. 3.

    Gβ protein content as measured by Western blot in fat cell of CT, CC, or TT carriers of the C825T polymorphism in the Gβ3 gene. A: Total Gβ content (left) and Gβ3 content (right) in individual subjects. B: Box plot values of densitometric setting of right graph in A. The latter values were compared by ANOVA. IP, immunoprecipitation; WB, antibody for Western blot; Gβ3-s, expected position of the spliced variant of Gβ3.

    FIG. 4.

    Protein content (Western blot) of α2A-adrenoceptor (α2A-AR), β2-adrenoceptor (β2-AR), Gαs, and Gαi in adipose tissue of CC, CT, and TT carriers of the C825T polymorphism in the Gβ3 gene. The subjects are the same as in Fig. 3.

    TABLE 1

    Clinical characteristics of the C825T polymorphism in the Gβ3 gene

    TABLE 2

    pD2 for lipolytic action of selective adrenergic agonists in isolated human fat cells set in relation to the T allele of the C825T polymorphism in the Gβ3 gene

    TABLE 3

    Lipolysis in human fat cells by set in relation to the C825T polymorphism in the Gβ3 gene

    Acknowledgments

    This study was supported by grants from the Swedish Medical Research Council, Swedish Diabetes Association, Swedish Heart and Lung Foundation, and the Foundations of Novo Nordisk, Thuring and Söderberg, and the Swedish Medical Society

    The excellent technical assistance of Eva Sjölin, Kerstin Wåhlen, Britt-Marie Leijonhufvud, and Catharina Hertel is greatly appreciated. We thank Professor Stephan Rössner for help in recruiting the obese subjects

    Footnotes

    • Address correspondence and reprint requests to Peter Arner, MD, Professor the Center of Metabolism and Endocrinology, Huddinge Hospital, M63, 141 86 Huddinge, Sweden. E-mail: peter.arner{at}medhs.ki.se.

      Received for publication 20 November 2000 and accepted in revised form 11 January 2002

      dcAMP, dibutyryl cyclic AMP; EC50, half-maximum effective concentration; OD, optical density; pD2, negative logarithm of Ec50; TAE, Tris-acetate-EDTA; Taq, Thermophylus aquaticus.

    REFERENCES

    | Table of Contents
    Advertisement