Regulation of Rat Pancreatic CCKB Receptor and Somatostatin Expression by Insulin

  1. Sophie Julien,
  2. Jean Laine and
  3. Jean Morisset
  1. Gastroenterology Service, Department of Medicine, Faculty of Medicine, Université de Sherbrooke, Sherbrooke, Quebec, Canada
  1. Address correspondence and reprint requests to Jean Morisset Gastroenterology Service, Department of Medicine, Faculty of Medicine, Université de Sherbrooke, Sherbrooke, Quebec, Canada, J1H 5N4. E-mail: jean.morisset{at}usherbrooke.ca

Abstract

The cholecystokinin B receptor (CCKBR) is localized on pancreatic endocrine somatostatin δ-cells. Pancreatic somatostatin content was increased in diabetic rats. The mechanisms involved in this phenomenon are unknown, and we believe insulin is involved. In this study, four groups of rats were used: controls, streptozotocin-induced diabetic, streptozotocin-induced diabetic with insulin, and streptozotocin-induced diabetic with insulin and its cessation. Rats were killed after 7–28 days of treatment for diabetes, and somatostatin mRNA expression and pancreatic somatostatin content, CCKBR mRNA and protein expression evaluation in total pancreas and purified islets, and the cellular localization of somatostatin and CCKBR in islets was measured. Data indicate that diabetes is established after 7 days, is controlled by insulin, and reappears after treatment cessation. Pancreatic somatostatin mRNA expression and somatostatin content were increased during diabetes, normalized during insulin treatment, and reaugmented after treatment cessation. Gland and islet CCKBR mRNA and protein almost disappeared during diabetes; CCKB mRNA reappeared in response to insulin, but the protein did not. Confocal microscopy confirmed data obtained on somatostatin and CCKBR as established biochemically in the course of the treatments. In conclusion, these data strongly suggest that insulin can negatively control pancreatic somatostatin mRNA and hormone content and positively control CCKBR mRNA; the CCKBR protein appears to be delayed.

During the 1970s, major changes were observed in the metabolism of pancreatic somatostatin during diabetes development in human and experimental animals; these modifications included increased secretion, tissue contents, and δ-cell population (112). On the contrary, it was also reported (13,14) that in diabetic mice mutants (ob/ob and db/db), pancreatic somatostatin content was decreased, along with a reduction in somatostatin cells within the islet. It was later suggested that in streptozotocin (STZ)-induced diabetic rats, regulation of somatostatin gene transcription was targeted to the pancreas and stomach but not to the other somatostatin-producing tissues (15).

The role played by insulin in somatostatin release remains controversial. Indeed, insulin can stimulate somatostatin release from perfused chicken pancreas-duodenum (16); however, data from monolayer cultures of neonatal rat pancreas (17) and isolated dog pancreas (18) clearly show that insulin fails to induce somatostatin release. In anesthetized normal and diabetic dogs, insulin infusion or injection was associated with an immediate reduction of the venous pancreaticoduodenal release of somatostatin (19). All of these differences could be explained by the different models used to study somatostatin release.

Cholecystokinin (CCK), a duodenal hormone released into the bloodstream after meal ingestion, is recognized as the major hormonal factor involved in the regulation of pancreatic exocrine secretion, gallbladder contraction, gastric emptying, and small bowel motility. CCK is also involved in the regulation of the endocrine pancreas; indeed, it can stimulate insulin secretion from an in vitro rat perfused pancreas (20) and in vivo in the rat (21), pig (22), mouse (23), and human (24). In humans, the insulinotropic effect of CCK was attenuated by the specific CCK-A receptor antagonist l-364718 (25). Finally, it was recently observed (26,27) that a defect in the CCK-A receptor gene OLETF (Otsuka Long-Evans Tokushima Fatty) rats led to obesity and diabetes.

With regard to pancreatic somatostatin δ-cells, we recently demonstrated (28,29) that these cells specifically bear the CCKB receptor (CCKBR) as established by RT-PCR, Western blotting, and confocal microscopy in rat, mouse, dog, pig, horse, calf, and human. This new discovery may indicate that the CCKBR could be involved in somatostatin metabolism and/or control of δ-cell growth.

Therefore, knowing that diabetes causes modifications in the pancreatic δ-cell metabolism and that these cells express the CCKBR, the objectives for this study are to characterize the changes in somatostatin mRNA expression and contents along with those of the CCKBR in normal and diabetic rats and to determine whether insulin treatment can normalize the modifications observed during diabetes development.

RESEARCH DESIGN AND METHODS

Male Sprague-Dawley rats, purchased from Charles River Laboratories (St. Constant, Canada), were housed in a light- and humidity-controlled room and given free access to food and water.

After an overnight fast, rats (200–220 g) were rendered diabetic (group STZ-D, n = 160) by a single intraperitoneal injection of 65 mg/kg body wt STZ (Sigma, St. Louis, MO) dissolved in 0.1 mol/l citrate buffer, pH 4.5. Controls received the same volume of citrate buffer alone (nondiabetic, group ND, n = 40). Animals were studied for 7 (group STZ-D7, n = 20), 14 (group STZ-D14, n = 20), 21 (group STZ-D21, n = 20), or 28 (group STZ-D28, n = 20) days after diabetes induction. Seven days after STZ injection, 80 diabetic rats received twice daily subcutaneous injections of Novolin ge NPH insulin (Novo Nordisk, Bagsvaerd, Denmark; 3 units at 8:00 a.m., 5 units at 8:00 p.m.) (group STZ-I) and were killed 7 (group STZ-I7, n = 20), 14 (group STZ-I14, n = 20), or 21 (group STZ-I21, n = 20) days after the initial insulin injection. Twenty other insulin-treated rats were denied insulin after 21 days and were killed 21 days later (group STZ-I21/D21). Before killing them, all animals were fasted except the group I rats. Under anesthesia, blood was collected from the inferior vena cava and the pancreas was excised. Plasma was separated by centrifugation at 4°C and stored at −20°C for measurement of glucose and triglycerides. These studies were performed according to our institutional animal care policies.

Tissue preparations.

Once excised, pancreata were quickly frozen in liquid nitrogen and kept frozen at −80°C until they were processed for receptor protein analysis by Western blotting or for total pancreas RNA extraction to determine CCK receptor and somatostatin expression by RT-PCR.

Glycemia and lipidemia determinations.

Plasma glucose and triglycerides were measured according to the Vitros GLU slide and Vitros TRIG slide test methodologies (Ortho-Clinical Diagnostics, Rochester, NY), respectively. Both analyses are based on enzymatic methods as described by Curme (30) and Spayd (31).

Rat islet isolation.

Islets were purified from diabetic and control rats according to the modified method of Lacy and Kosianovsky (32) as recently described (33). Yields were ∼350–400 islets from each diabetic pancreas and ∼650–800 islets from a normal pancreas.

RIN-14B cells.

The RIN-14B cells were obtained from American Type Culture Collection (ATCC). These cells are of a secondary clone derived from the RIN-m rat islet cell line (34), and they do not produce insulin. Cells were grown in RPMI 1640 medium according to ATCC specifications.

Somatostatin and amylase content determinations.

Tissue samples were rapidly frozen in liquid nitrogen until used. For somatostatin determination, a 10% homogenate was made in CH3COOH 2N, boiled for 15 min, and centrifuged for 20 min at 12,000g. The supernatants (3 ml) were extracted using Waters Sep-Pak C18 cartridges (Waters Associates, Milford, MA) that were prewetted with 100% acetonitrile followed by 0.05% trifluoroacetic acid (15 ml). The cartridges were loaded with extract, washed with 0.05% trifluoroacetic acid (15 ml), and eluted with 80% acetonitrile in 0.05% trifluoroacetic acid (4 ml). The elutates were dried in a vacuum concentrator and stored at −80°C. Somatostatin immunoreactivity was determined by enzyme-linked immunosorbent assay (Peninsula Laboratories, San Carlos, CA). Amylase activity was determined directly from homogenates according to the procedure described by Laine, Beattie, and Lebel (35), and the Western blot was performed with an amylase antibody (a gift from G. Grondin, Department of Biology, Université de Sherbrooke).

Membrane preparation, gel electrophoresis, and immunoblotting.

All procedures were carried out at 4°C. Freshly removed pancreata were minced and disrupted in a homogenization buffer (10 mmol/l HEPES, pH 7.5, 250 mmol/l sucrose, 1 mmol/l EGTA, 1 mmol/l EDTA, 0.5 mmol/l diisopropylfluorophosphate, 20 μmol/l leupeptin, and 1.5 μmol/l aprotinin) with the use of five passes through a Potter-Elvehjem homogenizer. Unbroken cells and nuclei were removed by centrifugation at 500g for 5 min. Membranes were collected by centrifugation at 100,000g for 1 h using a Beckman TLS-55 rotor (Buckinghamshire, U.K.). The supernatants were removed, and membranes were resuspended at a dilution of 15–30 mg/ml in the homogenization buffer and stored at −80°C until used. A similar procedure was performed to prepare membranes from the RIN-14B cells. The procedures for gel electrophoresis and immunoblotting were performed as previously described (29), with the CCKBR antibody 9262. The IGF-1 receptor antibody was a rabbit polyclonal from Santa Cruz, a gift from Dr. M. Korc, Dartmouth Medical School, Lebanon, New Hampshire. It was used at a 1/1,000 dilution.

Islets and pancreas total RNA extraction and RT-PCR.

Total RNAs from rat purified islets were extracted by the method of Chomczynski and Sacchi (36). Total RNAs from rat pancreata were isolated according to a modification of the procedure of Chirwing et al. (37) as described by Calvo et al. (38). Total RNA concentration was determined by absorbance at 260 and 280 nm. RT-PCR was performed using the Titanium One-Step RT-PCR kit (Clontech Laboratories, Palo Alto, CA) from 500 ng of purified total RNA from total pancreas or purified islets. The PCR primers were designed from human somatostatin (forward: CCCCAGACTCCGTCAGTTTC, position 144–163, and reverse: GCAGCCAGCTTTG-CGTTCTC, position 375–358) with a 231-bp cDNA fragment amplified. The PCR primers for the rat CCKBR were: forward: CTTCATCCCGGGTGTGGTTA-TTGCG, position 725–749, and reverse: CCCCAGTGTGCTGATG-GTGGTATAGC, position 13941–369, with a 669-bp cDNA fragment amplified. PCR primers for the rat 18S were: forward: TCAAGAACGAAAGTCGGAGG, position 1038–1057, and reverse, GGACATCTAAGGGCATCAC, position 1516–1498, with a 478 bp cDNA fragment amplified. Reverse transcription was performed for 1 h at 50°C, and PCR amplifications were performed under the following conditions: somatostatin: 60 s 94°C, 45 s 60°C, and 45 s 72°C (35 cycles); CCKBR: 30 s 94°C, 30 s 57°C, and 30 s 72°C (35 cycles); 18S: 60 s 94°C, 45 s 47°C, and 45 s 72°C (30 cycles). PCR samples were electrophoresed on a 1% agarose gel, and DNA was visualized with ethidium bromide.

Immunochemistry and image analysis by confocal microscopy.

These procedures were extensively described recently (29,39) with regard to the antibodies used, their dilution, and their specificity.

Statistical analysis.

Results represent means ± SE. The statistical analysis was done using a Student’s t test (two tailed). A P value of <0.05 was considered significant.

RESULTS

Body weight, plasma glucose, triglycerides, and pancreatic amylase.

As shown in Fig. 1A, body weights of the diabetic animals (STZ-D) exhibited significant early decreases of 18% at day 7, down to 29.6% at day 28 when compared with their respective controls. Treatment of the diabetic animals with insulin (STZ-I) immediately reversed the losses in body weight; a 15% increase was observed after 7 days, up to 28.4% after 3 weeks, thus indicating a return to control values. Cessation of insulin for 21 days caused a new drop of 14.2% in body weight when group STZ-I21/D21 is compared with group STZ-I21.

The STZ-induced diabetic rats (STZ-D) presented severe hyperglycemia after 7 days (182%), up to 286% after 28 days when compared with their respective controls (Fig. 1B). Under insulin, a gradual recovery was observed and glycemia reached control values after 14 days (ND-28 versus STZ-I28). Cessation of insulin resulted in a significant 173% increase in glycemia after 21 days (STZ-I21 versus STZ-I21/D21). Diabetes was also assessed by measurement of plasma triglycerides. As shown in Fig. 1C, triglyceridemia was already increased by 332% 7 days after STZ injection, and these large increases remained until day 28. Insulin restored plasma triglycerides back to control levels within 1 week. Contrary to glycemia, which returned to high values after cessation of the insulin treatment, triglycerides remained at control values (STZ-I21/D21 versus ND28).

As previously observed (40), diabetes is also associated with a complete loss of pancreatic amylase activity (Fig. 1D) and content (Fig. 1E). A return to control values was observed after insulin treatment, and a new drop occurred upon cessation of the insulin treatment. It is important to notice that losses in activity also corresponded to losses in protein.

Variations in pancreatic somatostatin mRNA and hormone content.

As shown in Fig. 2A, somatostatin mRNA exhibited a significant increase of 23% over control values 28 days after diabetes induction (STZ-D versus ND) when RNA from the total pancreas was used. Insulin given for 21 days returned somatostatin mRNA to control values (STZ-I versus ND), whereas its cessation caused a new significant increase of 10% in somatostatin mRNA (STZ-I21/D21 versus STZ-I21). Because pancreatic somatostatin is exclusively located in the δ-cells of the islet (28), we decided to verify if alterations of somatostatin mRNA expression observed in whole pancreas were also present in RNA extracted from purified islets. RNAs were then extracted from pools of five to seven islet preparations as indicated in Fig. 2B. In control rats (ND), a constant expression of somatostatin mRNA can be observed. Diabetes was associated with a fourfold increment in somatostatin mRNA 7 days after its induction, an elevation that remained for 28 days. Insulin treatment caused a prompt return of somatostatin mRNA to control values after 7 days, which remained throughout treatment. However, cessation of insulin resulted in a new increase in somatostatin mRNA to levels comparable with those in the initial diabetic animals. These variations in somatostatin mRNA were accompanied by comparable changes in total pancreatic somatostatin content, as is shown in Fig. 2C. Indeed, although somatostatin content remained at control values after 14 days of diabetes (data not shown), a significant 97% increase was observed 14 days later. A 21-day insulin treatment resulted in a significant decrease of 36% in somatostatin total contents below control values. Interestingly, cessation of this insulin treatment for a further 21 days resulted in a significant 140% increase in somatostatin content when compared with insulin treatment (STZ-I21/D21 versus STZ-I21) as observed for its mRNA.

Mode of insulin action: direct or indirect?

To answer this question, we first investigated the effects of diabetes and insulin treatment on IGF-1 receptor protein expression. Secondly, we determined the effects of insulin on somatostatin mRNA expression in RIN-14B cells. As shown in Fig. 3A, the IGF-1 receptor proteins are expressed in control islets, in those of the diabetic rats, and in islets of insulin-treated rats. However, 14 days of diabetes resulted in an important reduction in IGF-1 receptors in the islet, which seems to be accentuated by 14-day insulin treatment. It is important that the IGF-1 receptors are present on the remaining islet cells and can thus still carry the insulin messages. The direct effect of insulin on somatostatin expression is unequivocally demonstrated by the observation that within 8 h insulin can repress somatostatin mRNA expression by 62% in RIN-14B cells, which synthesize somatostatin (Fig. 3B). These data clearly establish the direct inhibitory effect of insulin, probably through the IGF-1 receptor that is also present on these cells, as is shown in Fig. 3A.

Variations in CCKBR mRNA and protein.

Because the CCKBR was previously shown (29) to colocalize with somatostatin in pancreatic endocrine δ-cells, we investigated the potential relationship that might exist between alterations in somatostatin expression and the behavior of the CCKBR in the course of diabetes development, during insulin treatment, and after its cessation. As shown in Fig. 4A, expression of the CCKBR mRNA evaluated from total pancreas RNA was dramatically and significantly reduced by 72% after 28 days of diabetes when compared with controls (STZ-D versus ND). By contrast, insulin given for 21 days significantly enhanced CCKBR mRNA by 60% when compared with diabetic animals (STZ-I21 versus STZ-D28) and with control levels (STZ-I21 versus ND). Cessation of insulin resulted in another drop of 40.5% in CCKBR mRNA when compared with the insulin-treated rats (STZ-21/D21 versus STZ-I21). As shown in Fig. 4B, the CCKBR proteins present in total pancreas membrane proteins followed a pattern of expression comparable with its mRNA except in the diabetic group, which did not experience as dramatic a drop as its mRNA content. The receptor is visualized as an 80-kDa protein.

With RNA isolated from purified islets (Fig. 4C), we can appreciate the constancy over time in CCKBR mRNA expression in the control rats (ND). In the diabetic animals, a significant burst of the receptor mRNA was observed after 7 days of the initial STZ injection. Thereafter, a progressive decline was observed over the next 14 days, to a complete disappearance after 28 days. Insulin treatment brought CCKBR mRNA back to control values after 7 days of treatment, and after 21 days, we observed an eightfold increase in CCKBR mRNA. Cessation of the insulin treatment for 21 days drove CCKBR mRNA back to the levels of the 21-day diabetic animals.

With proteins extracted from purified islets (Fig. 4D), we can detect the CCKBR even if its concentration seems to be less abundant than that in total pancreas (Fig 4B). CCKBR expression remains quite constant with time in nondiabetic islets (ND), while it decreased dramatically over 7 days of diabetes (STZ-D) to a complete loss of the protein after 21 days of diabetes (STZ-D). As observed in total pancreas membranes (Fig. 4B), insulin failed to replenish the CCKBR protein in the purified islets (Fig. 4D), contrary to its effect on CCKBR mRNA expression (Fig. 4C).

Estimation of somatostatin, insulin, and CCKBR protein expression by confocal microscopy.

As shown in Fig. 5, under transmission, diabetes dramatically reduced the size of pancreatic islets by at least 10-fold. Insulin treatment increased their size over time but never to that of a control islet, even after 21 days of treatment. The specificity of the CCKBR and somatostatin antibody signals was demonstrated by the loss of immunofluorescence when the peptide antigen (CCKBR) and the hormone somatostatin were incubated in the presence of their respective antibody. In normal islets, colocalization of the CCKBR (green fluorescence) occurred with somatostatin (red fluorescence) as a yellow signal (merged). In the diabetic animals, the loss of β-cells resulted in increased concentration of the CCKBR and somatostatin after a week, followed by a reduction at 14 days and a loss after 28 days of diabetes, a confirmation of the Western blot data presented in Fig 4D. In response to insulin, the CCKBR protein reappeared slightly during the hormonal treatment and remained at a low level thereafter, a behavior totally different from its mRNA content (Fig. 4C). Because the diabetic islets did not recover their normal size during insulin treatment, it is difficult to estimate their somatostatin content. Indeed, the confocal images seem to indicate that the red immunofluorescence is not as bright during insulin treatment as it is in diabetic islets, a sign of reduced somatostatin content, as is observed with total pancreas content evaluation (Fig. 2C). Cessation of insulin did not change the pattern of CCKBR expression but increased somatostatin content when compared with 21 days of insulin treatment. Recovery of somatostatin after insulin cessation corresponds with the increased contents of the hormone observed in Fig. 2C. As shown in Fig. 5, diabetic animals lost their islet insulin early, and their hormone content did not recover during insulin treatment. The specificity of the insulin antibody is evident from the image obtained with preincubation of the antibody with insulin.

DISCUSSION

In this study, we show the importance of insulin as a regulator of pancreatic δ-cell activity focused on somatostatin and CCKBR metabolism. Our data confirm the initial observations that pancreatic somatostatin mRNA expression (15) and somatostatin content in STZ-induced diabetic animals (1,2,5) and in spontaneously diabetic mice (11,12) were significantly increased, with a return to control levels during insulin treatment (15). However, some spontaneous diabetic mice also exhibited decreased pancreatic somatostatin content (13,14), a finding that remains unexplained. Among our original data, it was demonstrated that 1) the major variations observed during the different treatments on somatostatin mRNA expression in total pancreas samples were identical to those obtained in purified islets, 2) the increases and decreases in somatostatin mRNA were comparable and in synchrony with those of total gland somatostatin content, 3) insulin negatively and directly modulated pancreatic somatostatin mRNA expression and its hormone contents, possibly through the IGF-1 receptor, 4) diabetes resulted in progressive losses in CCKBR mRNA and protein in total pancreas and purified islets, with return to control values in mRNA but not in receptor protein during insulin treatment, and 5) finally, the modifications observed at the biochemical level can be corroborated by our confocal microscopy analysis, which has never been done previously.

The validity of our data on somatostatin and CCKBR variations observed in this study depends on the demonstration that diabetes occurred when induced, that it could be controlled by insulin treatment, and that it reappeared upon cessation of treatment. Our results on body weight decreases, hyperglycemia, and hypertriglyceridemia following STZ injection clearly indicate that diabetes was established early and sustained for 28 days. Furthermore, the observation that all of these parameters were normalized during insulin treatment and became abnormal again after insulin cessation stressed the diabetes status of these animals (41). Finally, the disappearance of pancreatic amylase during diabetes, its return to normal values during insulin treatment, and its loss again after ending insulin treatment support previous data on the effects of diabetes on the pancreas (40), along with the microscopy data showing shrinking of the islets and loss of insulin.

Our data clearly indicate that pancreatic somatostatin mRNA expression is strongly disturbed soon after diabetes induction, and evident more so when RNA samples were extracted from purified islets. These increased contents were also rapidly normalized within a week of insulin treatment and rebounded after insulin cessation. It is quite interesting to observe that the variations observed in the course of this study on somatostatin mRNA were paralleled by similar changes in somatostatin total pancreatic contents. This observation suggests that these modifications in contents reflect changes in somatostatin synthesis more than in somatostatin accumulation due to inhibition of secretion. This last possibility is doubtful because increased somatostatin secretion was previously observed (8) in alloxan-induced diabetic rats. Therefore, if controls occur at the somatostatin mRNA and protein synthesis level, then what factors are responsible? Earlier studies suggested that glucose could be involved; indeed, high glucose stimulated somatostatin release from monolayer cultures of neonatal rat pancreas (17) and from rat isolated islets (42), observations not confirmed in another study (43). Increased somatostatin secretion could trigger somatostatin synthesis, and glucose was shown (44) to regulate pancreatic preprosomatostatin I expression as it increased somatostatin release from rainbow trout Brockmann bodies. In normal and diabetic dogs, however, the intravenous administration of exogenous insulin immediately reduced basal somatostatin release, an effect that seems independent of blood glucose level because it occurred in both normal and hyperglycemic conditions and happened before any change in blood glucose level (19,45). Interestingly, long-term insulin treatment was associated with decreased pancreatic somatostatin content and somatostatin mRNA expression (15 and this study) in conditions of normalized glycemia; these data thus suggest that insulin is involved in the regulation of somatostatin gene transcription. Our data on the presence of IGF-1 receptors on normal and diabetic islets suggest that insulin may operate through this receptor. Its reduction during diabetes can be explained by the major loss in β-cells following STZ administration, confirmed by confocal microscopy (Fig. 5). The presence of the IGF-1 receptor on the RIN-14B cells and the drastic and rapid inhibitory effect of insulin on somatostatin mRNA expression in these cells strongly suggest a direct action of insulin.

Recently, it was shown for the first time that the CCKBRs were present on the endocrine somatostatin δ-cells in six different species (28,29). In this study, we present for the first time evidence that the CCKBR mRNA and protein expressions are modulated differently from somatostatin during diabetes, including receptors measured in total gland and in purified islets. The observations that the receptor protein remained in total pancreas membrane during insulin treatment while disappearing from purified islets strongly suggest that they are not uniquely localized on the δ-cells. Indeed, our most recent data indicate its presence on the rat pancreatic acinar cells (46); this receptor population could also be affected by diabetes. This needs to be verified on purified acinar cells that are free of islets. The loss of islet CCKBR protein during diabetes and its failure to reappear during insulin treatment could be explained according to the following two possibilities, which at the moment remain speculative. First, convertase enzymes could be activated during diabetes development and then digest the external NH2-terminal section of the receptor protein. If so, antibody 9262, which specifically recognizes this part of the protein, would fail to detect the receptor. Second, diabetes would destabilize the CCKBR mRNA due to defects in chaperone proteins. This could result in the translation of a CCKBR truncated protein. Such modifications in chaperone proteins have been previously observed (47) during diabetes and resulted in disturbed translation processes involving large mRNA.

If somatostatin secretion is stimulated by the CCK agonists gastrin and its analogs (48), accumulation of pancreatic somatostatin content in the diabetic animals (Fig. 2) could be partially explained by the drastic reduction in islet CCKBR protein, as is observed in Fig. 4. The observation that somatostatin content continued to be modulated under insulin treatment and its subsequent cessation in the absence of CCKBR proteins in islets strongly suggests that this receptor might not be directly involved in somatostatin synthesis and secretion, although this assumption remains to be investigated.

In conclusion, this study clearly demonstrated that the expression of pancreatic somatostatin and the CCKBR associated with islet δ-cells are closely regulated by insulin in diabetes. Insulin can at least negatively control somatostatin expression with positive action on CCKBR mRNA. Preliminary data presented in Fig. 3 on RIN-14B cells clearly establish a rapid and direct negative control of insulin on somatostatin mRNA expression in these somatostatin cells. An insulin-responsive element was also found on the rat somatostatin gene, and studies are underway to determine the effects of its deletion on somatostatin mRNA expression. The physiological importance of our data are the demonstration that insulin can control the expression and synthesis of one of its most potent inhibitors. Although we do not have any evidence yet, it remains possible that high pancreatic somatostatin levels are involved in the course of type 2 diabetes development as insulin becomes less and less efficient.

FIG. 1.
View larger version:
FIG. 1.

Effects of diabetes and insulin treatment on rat body weights, plasma glucose, triglycerides, and pancreatic amylase content. Control (ND), streptozotocin-induced diabetic (STZ-D), streptozotocin-induced diabetic with insulin (STZ-I), and streptozotocin-induced diabetic with insulin followed by cessation of insulin (STZ-I21/D21) rats were killed at different times after the beginning of each treatment. Before killing them, they were weighed (A) and blood was withdrawn for glucose (B) and triglyceride (C) determinations. Pancreatic amylase was also estimated after organ excision (D and E). Results represent the mean ± SE of the number of animals per group (data in parentheses). *P < 0.01; **P < 0.001; ‡P < 0.05.

FIG. 2.
View larger version:
FIG. 2.

Effects of STZ and insulin treatment on somatostatin mRNA expression and hormone contents. Total RNA (500 ng) extracted from whole pancreas (A) and purified islets (B) were processed for RT-PCR analysis. The different groups are described in the legend of Fig. 1. A: The histogram represents the number of animals per group (data in parentheses). B: Values represent data from a pool of several purified rats islets. The experiment was repeated twice. C: Data represent somatostatin pancreatic content of the different groups, with the number of rats per group shown in parentheses. Results are the means ± SE. Number of cell samples per group are shown in parentheses. *P < 0.01 compared with controls.

FIG. 3.
View larger version:
FIG. 3.

A: IGF-1 receptor protein expression was analyzed by Western blot from purified normal rat islet (ND), 14-day diabetic rats (STZ-D), 5-day diabetic rats treated for 14 days with insulin (STZ-I), and somatostatin RIN-14B cells. B: Effects of insulin on somatostatin mRNA expression in RIN-14B cells. Cells were treated with 100 nmol/l insulin for 8 h (I) or not (C). Results are the means ± SE. *P < 0.01 compared with controls.

FIG. 4.
View larger version:
FIG. 4.

Effects of diabetes insulin treatment on CCKBR mRNA and protein. Total RNA (500 ng) extracted from whole pancreas (A) and purified islets (C) were processed for RT-PCR analysis. Protein (30 μg) from whole pancreas membranes (B) and from purified islets (D) were subjected to electrophoresis. The different groups are described in Fig. 1. A and B: Values represent data collected from the number of rats per group (data in parentheses). C and D: Data represent CCKBR mRNA and protein expression from a pool of several purified rat islets; the experiment was repeated twice. Results are the means ± SE. *P < 0.01.

FIG. 5.
View larger version:
FIG. 5.

Colocalization of the pancreatic CCKBR with somatostatin and insulin localization in diabetic rats and following insulin treatment. Purified rat islets were incubated overnight at 4°C with the CCKBR antibody 9262 (1:1,000), with the somatostatin antibody (10 μg ml−1), or with insulin (1:50). Colocalization and localization were established by confocal microscopy as described in 29. Calibration bars: −100 μm and −10 μm (see transmission panels).

Footnotes

    • Accepted March 19, 2004.
    • Received November 11, 2003.

REFERENCES

« Previous | Next Article »Table of Contents