Advertisement

Inhibition of Preproinsulin Gene Expression by Leptin Induction of Suppressor of Cytokine Signaling 3 in Pancreatic β-Cells

  1. Katharina Laubner1,
  2. Timothy J. Kieffer2,
  3. Ni T. Lam2,
  4. Xinjie Niu1,
  5. Franz Jakob1 and
  6. Jochen Seufert1
  1. 1Division of Metabolism, Endocrinology and Molecular Medicine, Medizinische Klinik and Poliklinik II, University of Würzburg, Würzburg, Germany
  2. 2Laboratory of Molecular and Cellular Medicine, the Departments of Cellular and Physiological Sciences and Surgery, University of British Columbia, Vancouver, British Columbia, Canada
  1. Address correspondence and reprint requests to Jochen Seufert, MD, Division of Metabolism, Endocrinology, and Molecular Medicine, Medizinische Klinik und Poliklinik II, University of Würzburg, Klinikstraβe 6-8, 97070 Würzburg, Germany. E-mail: j.seufert{at}mail.uni-wuerzburg.de

Abstract

Leptin inhibits insulin secretion and preproinsulin gene expression in pancreatic β-cells, but signal transduction pathways and molecular mechanisms underlying this effect are poorly characterized. In this study, we analyzed leptin-mediated signal transduction and preproinsulin gene regulation at the molecular level in pancreatic β-cells. Leptin stimulation led to janus kinase (JAK)2-dependent phosphorylation and nuclear translocation of the transcription factors signal transducer and activator of transcription (STAT)3 and STAT5b in INS-1 β-cells. Leptin also induced mRNA expression of the JAK-STAT inhibitor suppressor of cytokine signaling (SOCS)3 in INS-1 β-cells and human pancreatic islets in vitro and in pancreatic islets of ob/ob mice in vivo. Transcriptional activation of the rat SOCS3 promoter by leptin was observed with concomitant leptin-induced STAT3 and STAT5b DNA binding to specific promoter regions. Unexpectedly, SOCS3 inhibited both basal and STAT3/5b-dependent rat preproinsulin 1 gene promoter activity in INS-1 cells. These results suggest that SOCS3 represents a transcriptional inhibitor of preproinsulin gene expression, which is induced by leptin through JAK-STAT3/5b signaling in pancreatic β-cells. In conclusion, although SOCS3 is believed to be a negative feedback regulator of JAK-STAT signaling, our findings suggest involvement of SOCS3 in a direct gene regulatory pathway downstream of leptin-activated JAK-STAT signaling in pancreatic β-cells.

The hormone leptin is the product of the obese (ob) gene, primarily produced by white adipose tissue (1) and typically circulates in proportion to body fat mass (2). Leptin acts on specific regions in the hypothalamus to inhibit food intake and raise energy expenditure. Elevated leptin levels in obese subjects are believed to be indicative of resistance to leptin. Leptin has also been shown to inhibit insulin secretion and preproinsulin gene expression in pancreatic β-cells (36), thereby establishing an adipoinsular feedback loop in concert with stimulatory action of insulin on leptin secretion from the adipose tissue (7,8). Dysregulation of this adipoinsular axis with the establishment of leptin resistance in pancreatic β-cells may lead to hyperinsulinemia, which could contribute to obesity and insulin resistance.

Leptin signal transduction occurs through a distinct receptor of the class 1 cytokine superfamily of receptors (9), which is intracellularly coupled to the janus kinase (JAK)-signal transducer and activator of transcription (STAT) signaling pathway (10). Several leptin receptor (ObR) isoforms are known, but the majority of physiological effects appear to be mediated via the longest form (ObRb) (11,12). In previous experiments, we and others have demonstrated that ObR isoforms, including ObRb, are expressed and functional in pancreatic β-cell lines and primary pancreatic islets (3,13). Binding of leptin to ObRb activates the receptor-associated kinase JAK2 via transphosphorylation and phosphorylates tyrosine residues on ObRb. Subsequently, transcription factors of the STAT family are recruited to the receptor and also phosphorylated. Phosphorylated STATs dimerize and translocate to the nucleus to regulate gene transcription (14). STATs have mainly been shown to transcriptionally enhance gene expression. However, we previously determined that leptin increases binding of STAT5b to the upstream sequences of the rat preproinsulin 1 promoter (6) and inhibits insulin biosynthesis via transcriptional repression (5). In this study, we sought to characterize this apparent contradiction at the molecular level.

Suppressors of cytokine signaling (SOCS) belong to a family of molecules that inhibit cytokine signaling by inhibiting JAK-STAT signal transduction. These molecules contain a central Src-homology 2 domain and a conserved COOH-terminal SOCS box. Through the Src-homology 2 domain, they bind directly to tyrosine-phosphorylated residues on the cytokine receptor–associated kinase JAK2, which blocks the access of STATs to receptor binding sites and leads to inactivation of the JAKs (15). Expression of SOCS proteins is induced by various cytokines and hormones, including interleukin-6, leukemia inhibitory factor, erythropoietin, growth hormone, and leptin (1618). Accumulating evidence suggests that SOCS3 is a leptin-induced negative feedback regulator of leptin receptor signaling that may be involved in the development of leptin resistance in the hypothalamus (1622).

Here, we provide evidence that leptin induces SOCS3 expression in pancreatic β-cells by transcriptional mechanisms involving transcription factors of the STAT family. Moreover, we discovered that SOCS3 reduces preproinsulin gene expression in pancreatic β-cells that was previously attributed directly to leptin activation of STAT molecules. Thus, we provide a molecular mechanism by which leptin confers inhibitory effects at the level of preproinsulin gene promoter activity, and we thereby extend the function of SOCS3 beyond that of a feedback inhibitor of JAK-STAT signaling.

RESEARCH DESIGN AND METHODS

Cell lines and culture conditions.

The rat insulinoma cell line INS-1 was obtained from Dr. Claes B. Wollheim (University of Geneva, Switzerland) and grown as reported previously (23). Cells were deprived of serum and antibiotics for a 12- to 15-h period before they were stimulated with murine leptin (Recombinant Mouse Leptin; R & D Systems, Minneapolis, MN) at concentrations of 0.625 nmol/l (10 ng/ml) for different time periods.

RNA isolation and RT-PCR for STAT mRNA in pancreatic β-cells.

Total RNA from the INS-1 rat pancreatic β-cell line was extracted using TRIZOL reagent (Invitrogen Life Technologies, Gaithersburg, MD) and subjected to DNase I digest. Digested RNA was reverse transcribed by oligo-dT priming with reverse transcriptase (Superscript; Invitrogen Life Technologies). After reverse transcription, the cDNA was subjected to PCR amplification for STAT1, -2, -3, -4, -5a, -5b, and -6 using sequence-specific oligonucleotides (STAT1: sense, 5′-TGAACTCCATCGAGCTCACTCAGAACACT-3′, and antisense, 5′-AGAGGACGAAGGTGCGATCGGATAAC-3′ [264-bp PCR product; GenBank accession number AF053767]; STAT2: sense, 5′-GAAGGGGGCATTACTTGTTCTTGGGTGGAG-3′, and antisense, 5′-GCGGATGATCTCTGCCAGTGGGAGTGAC-3′ [140-bp PCR product; GenBank accession number BC064827]; STAT3: sense, 5′-TGGAAGAGGCGGCAGCAGATAGC-3′, and antisense, 5′-GCACGGCCCCCATTCCCACAT-3′ [545-bp PCR product; GenBank accession number X91810]; STAT4: sense, 5′-AAACTATGGCAACAATTCTCCTTCAAAAC-3′, and antisense, 5′-GCCGCAGCCAGTATTCTCCTCTC-3′ [208-bp PCR product; GenBank accession number AF055291]; STAT5a: sense, 5′-GCAACATTTCCCCATCGAGGTCCGGCACTACC-3′, and antisense, 5′-GTGGCCTGGCCTCGGTCCTGGGGATTG-3′ [105-bp PCR product; GenBank accession number U24175]; STAT5b: sense, 5′-GCCAGCATTTCCCCATCGAGGTGCGACATTATTTA-3′, and antisense, 5′-GTCATACGTGTTCTGGAGCTGCGTGGCATAGTGC-3′ [230-bp PCR product; GenBank accession number X97541]; STAT6: sense, 5′-CCAGCCGGGGACTGCTACCAGAACACTTC-3′, and antisense, 5′-CCGGATGACATGGGCAATGGTGATGC-3′ [341-bp PCR product; GenBank accession number AF055292]) according to the following conditions: 2 min at 94°C (1 cycle), 30 s at 94°C, 30 s at 55°C, and 30 s at 72°C (36 cycles). Identity of the PCR products was confirmed by sequencing (data not shown).

Immunoprecipitation and Western blotting.

After stimulation of INS-1 cells with leptin (10 ng/ml) at 30 min, 3 h, and 6 h, whole-cell extracts were prepared in ELB buffer (100 mmol/l NaCl, 0.1% NP-40, 50 mmol/l Hepes, 1 mmol/l phenylmethylsulfonyl fluoride, 5 mmol/l EDTA, and 0.5 mmol/l dithiothreitol). Equal amounts of protein were immunoprecipitated at 4°C with antisera specific for JAK2, STAT3, or STAT5b (Santa Cruz Biotechnology, Santa Cruz, CA) overnight followed by incubation with protein A-Sepharose for 1 h. Immunoprecipitated proteins were separated by a 12% SDS polyacrylamide gel and transferred to nitrocellulose membranes. The membranes were probed with a mouse monoclonal anti-phosphotyrosine antibody (clone 4G10; Upstate Biotechnology, Lake Placid, NY) or antisera specific for STAT3 or STAT5b, respectively.

Immunocytochemistry and green fluorescent protein studies.

INS-1 cells were grown on coverslips, serum deprived overnight, stimulated with leptin (10 ng/ml) for different time periods, fixed with 4% paraformaldehyde, and permeabilized with −20°C methanol. Slides were then incubated with STAT3 or STAT5b rabbit antisera (Santa Cruz Biotechnology) for 1–2 h at room temperature and then incubated with a fluorescent secondary antiserum coupled to indocarbocyanide. Microscopic imaging was performed on a Zeiss epifluorescent microscope coupled to an Optronics TEC-470 CCD camera interfaced with digital imaging analysis software (IP-Lab Spectrum; Signal Analytics, Vienna, VA) on a power Macintosh computer.

For green fluorescent protein (GFP) studies, INS-1 cells were stably transfected (Transfast; Promega, Mannheim, Germany) with a cDNA encoding a GFP-Stat5b fusion protein (provided by Dr. Carter-Su, Baylor College of Medicine, Houston, TX) (24). Cells were incubated at 37°C in serum-free media for 30 min before incubation with vehicle or murine leptin (10 ng/ml; PeproTech, Rocky Hill, NJ) for 15 min. Imaging was performed by exciting GFP at 488 nm using a Leica DMIRB microscope. For every dish, ∼20 cells were imaged. For quantitative analysis of fluorescence distribution, images were captured via a CoolSnap camera (RS Photometrics, Tucson, AZ), and intensity values of neighboring nuclear and cytosolic regions were calculated using IP-Lab software. The nuclear-to-cytosol ratio of fluorescence was calculated in images captured from four separate experiments. Statistical significance was determined by ANOVA analysis.

Expression of SOCS3 mRNA in INS-1 cells, human pancreatic islets, and pancreatic islets of ob/ob mice.

mRNA was extracted from rat INS-1 pancreatic β-cells after incubation with 10 ng/ml murine leptin (Recombinant Mouse Leptin; R & D Systems) for the indicated time periods. Human pancreatic islet cDNA was reverse transcribed from mRNA that was extracted from human islets after incubation with 10 ng/ml human leptin (PeproTech) or vehicle for the indicated time period during an earlier study (5). Ob/ob mice (n = 4 per time point) were injected intraperitoneally in vivo with murine leptin (Recombinant Mouse Leptin; R & D Systems) at 1 μg/g body wt or vehicle, and pancreatic islets were isolated at different time points after intraperitoneal injection for mRNA extraction as previously described (6). Semiquantitative RT-PCR for rat, human, and mouse SOCS3 mRNA and β-actin were performed as described previously (5,25). The primers used for amplification of rat SOCS3 were sense, 5′-GCTCCGTGCGCCATGGTCACCCACAG-3′, and antisense, 5′-CTTTGCTCTTTAAAGTGGAGCATCATACTG-3′; 699-bp PCR product (GenBank accession number AJ249240). Primer oligonucleotides used for amplification of human SOCS3 were sense, 5′-CGCCACTTCTTCACGCTCAG-3′, and antisense, 5′-AGGGGCCGGCTCAACACC-3′; 317-bp PCR product (GenBank accession number AF159854). The primer oligonucleotides for murine SOCS3 were sense, 5′-GACACCAGCCTGCGCCTCAAGAC-3′, and antisense, 5′-CCGGAACTTCGGACGAGGGTTCC-3′; 397-bp PCR product (GenBank accession number AF314501). PCR conditions were 2 min at 94°C (1 cycle), 30 s at 94°C, 30 s at 57°C (30 s at 60°C for human SOCS3), and 30 s at 72°C (18 cycles, 22 cycles for human SOCS3). All results are derived from at least three independent experiments.

Nuclear extracts and electrophoretic mobility shift assay.

INS-1 cells were serum deprived overnight before stimulation with 10 ng/ml leptin. Nuclear extracts were prepared as described previously (26). In vitro–translated STAT5b was obtained from the plasmid STAT5bpcDNA3.1- using the TNT Coupled Reticulocyte Lysate System (Promega) according to the manufacturer’s protocol. Ten micrograms nuclear extract or 5 μl TNT in vitro translation reaction were added to 5× electrophoretic mobility shift assay buffer (100 mmol/l KPO4, pH 7.9, 5 mmol/l EDTA, 5 mmol/l dithiothreitol, and 20% glycerol), 50 mmol/l KCl, 1 μg poly-dIdC, and 40,000 cpm/μl 32P-labeled double-stranded oligonucleotide. DNA probes were generated by annealing two oligonucleotides, followed by a fill-in reaction with Klenow polymerase and dGTP, dCTP, dTTP, and [α-32P]dATP. The oligonucleotide sequence corresponding to a sequence from −363 to −332 bp of the rat SOCS3 promoter, containing a −351- to −344-bp putative STAT binding site, named A-STAT, was 5′-363AGAAACCAGCCTTCTTAGAAGGGAGGGGGTGG−332-3′. The oligonucleotide sequence corresponding to a sequence from −107 to −75 bp of the rat SOCS3 promoter, containing a −95- to −87-bp putative STAT binding site, named B-STAT, was 5′-−107AGTGACTAAACATTACAAGAAGACCGGCCGCGC−75-3′. The oligonucleotide sequence corresponding to a sequence from −82 to −52 bp of the rat SOCS3 promoter, containing a −72- to −64-bp putative STAT binding site, named C-STAT, was: 5′-−83CGGCCGCGCAGTTCCAGGAATCGGGGGGGCGG−52-3′ (GenBank accession number AJ249240). After incubation on ice for 15 min, the samples were loaded onto a 5% polyacrylamide gel and run in 0.5× Tris-borate-EDTA buffer for 2 h. For supershift assays, 4 μl of STAT1, STAT3, or STAT5b antisera (Santa Cruz Biotechnology) was added before samples were loaded onto the gel.

Plasmids, transient DNA transfection, and luciferase assays.

The plasmid −1054rSOCS3pGL3 contains a fragment of the rat SOCS3 promoter between base pairs −1,054 and 222. It was generated by PCR from rat genomic DNA and cloned into the luciferase reporter vector pGL3 (Promega). The plasmid −410rINS-1 contains 410 bp of the promoter region of the rat preproinsulin 1 gene also cloned into the luciferase reporter vector pGL3 (Promega) (27). The rSOCS3pcDNA3.1- expression plasmid contains the full-length coding sequence of rat SOCS3. Identity of all vectors has been confirmed by sequencing. Rat STAT5b pcDNA3.1- was a gift from Dr. L.-Y. Yu-Lee (Baylor College of Medicine, Houston, TX).

INS-1 β-cells were transfected using Lipofectamine (Invitrogen Life Technologies) and 2 μg −1054rSOCS3pGL3 vector in duplicate samples in serum-free medium and incubated with 10 ng/ml leptin or vehicle. For cotransfection experiments, INS-1 β-cells were cotransfected with 2 μg −410rINS-1pGL3 vector and 1,000 ng rSTAT5bpcDNA3.1- and rSOCS3pcDNA3.1- in duplicates. Luciferase expression was measured after 12 h as described previously (28). Data shown in each figure are mean values ± SE of at least six independent experiments and are normalized to protein concentrations.

RESULTS

Expression of STAT isoforms in pancreatic β-cells.

We found abundant mRNA expression for the isoforms STAT1 as well as STAT3, STAT5b, and STAT6 in this insulin-producing pancreatic β-cell line (Fig. 1), whereas mRNA expression for the isoforms STAT2, STAT4, and STAT5a was not detectable. These results indicate that constituents of the JAK-STAT signaling pathway that have been shown to be involved in leptin signaling in other tissues (10,29) are expressed in the INS-1 β-cell line.

Leptin induces phosphorylation of STAT3 and STAT5b through receptor-associated JAK2 in INS-1 β-cells.

To test whether the JAK-STAT signaling pathway is activated by leptin in insulin-producing cells, immunoprecipitation experiments were performed in leptin-treated INS-1 cells. As shown in Fig. 2A, leptin treatment of serum-deprived INS-1 β-cells induces tyrosine phosphorylation of leptin receptor–associated JAK2 in a time-dependent manner while the total amount of precipitated JAK2 protein remained constant (Fig. 2A, bottom panel). When JAK2 immunoprecipitates from leptin-treated INS-1 cells were immunoblotted with antisera specific for STAT3 (Fig. 2B, top panel) and STAT5b (Fig. 2C, upper panel), recruitment and association of STAT3 and STAT5b to JAK2 was observed as early as 30 min after leptin stimulation. Subsequent to the recruitment of STAT3 and STAT5b to JAK2, time-dependent tyrosine phosphorylation of these transcription factors was observed (Figs. 2B and C, middle panels). Immunoblotting of STAT3 and STAT5b immunoprecipitates from leptin-treated INS-1 cells with either STAT3-specific (Fig. 2B, bottom panel) or STAT5b-specific (Fig. 2C, bottom panel) antisera revealed equal total amount of STAT precipitates throughout the time course of the experiments. These results indicate that STAT3 and STAT5b coimmunoprecipitate with JAK2 in a phosphorylation-dependent fashion after leptin stimulation and suggest phosphotyrosine-mediated protein interaction of JAK2 and STAT3 and STAT5b in leptin-treated β-cells. Co-immunoprecipitation of the other isoforms of STAT molecules (STAT1 and STAT6), which are also expressed in INS-1 cells (Fig. 1), with JAK2 was not detected (data not shown).

Leptin induces nuclear translocation of STAT3 and STAT5b in INS-1 β-cells.

As shown in Fig. 3A, we find STAT3 (Fig. 3A, top panel) as well as STAT5b (Fig. 3A, bottom panel) molecules in the nucleus as early as 30 min after leptin treatment in the majority of cells. Nuclear predominance of STAT molecule localization continued up to 3 h after a single leptin application, whereas after 6 h, subcellular localization was predominantly cytoplasmic again in the majority of cells. In INS-1 cells stably overexpressing a GFP-STAT5b fusion protein, significant nuclear translocation of the fusion protein by leptin could also be demonstrated (Fig. 3B). These results demonstrate that leptin induces nuclear translocation of STAT3 and STAT5b molecules in insulin-producing INS-1 β-cells in response to activation of the JAK-STAT signaling pathway.

STAT3 and STAT5b transactivate, whereas leptin represses the rat preproinsulin 1 promoter.

We next examined whether leptin-mediated activation of STAT molecules directly exerts the previously demonstrated inhibitory transcriptional effects of leptin at the rat preproinsulin 1 promoter in INS-1 cells. Cotransfection of a STAT3 or STAT5b expression plasmid with a luciferase reporter gene under the control of the rat preproinsulin 1 promoter in INS-1 cells leads to enhanced transcriptional activity of the preproinsulin promoter in comparison with the empty expression plasmid pcDNA3.1- (Fig. 4A). In contrast, leptin treatment of INS-1 cells expressing the rat preproinsulin 1 promoter luciferase reporter lead to significant repression of preproinsulin promoter activity (Fig. 4B). These results suggest that leptin-dependent repression of preproinsulin promoter activity in insulin-producing cells is not mediated by direct interaction of STAT3 or STAT5b with the preproinsulin promoter.

Leptin induces SOCS3 expression in pancreatic β-cells by STAT-mediated promoter activation.

We detected induction of steady-state rat SOCS3 mRNA levels by leptin in a time-dependent fashion as early as 30 min after stimulation in INS-1 cells (Fig. 5A). Similarly, strong induction of human SOCS3 mRNA expression was observed in human pancreatic islets that were incubated with leptin for 12 h, whereas basal levels of SOCS3 mRNA in human islets were barely detectable (Fig. 5B). Finally, we observed a time-dependent increase in SOCS3 mRNA expression in islets sequentially isolated at different time points from ob/ob mice that were previously injected intraperitoneally in vivo with murine leptin (Fig. 5C). These results indicate that, similar to the hypothalamus, SOCS3 expression is induced by leptin in pancreatic β-cell lines and pancreatic islets in vitro, but also in vivo. The data further imply that SOCS3 may also be involved in leptin signaling in the human endocrine pancreas.

SOCS3 expression has been demonstrated to be regulated through the JAK-STAT signaling pathway. Thus, we tested putative STAT-dependent transcriptional effects of leptin on rat SOCS3 promoter activity. Leptin stimulated rSOCS3 promoter activity in INS-1 cells (Fig. 6A), indicating that induction of the JAK-STAT inhibitory molecule SOCS3 in INS-1 cells by leptin is mediated through transcriptional effects at the promoter level. When the luciferase reporter gene under the control of the rat SOCS3 promoter was cotransfected with expression vectors for the isoforms STAT3 (Fig. 6B) or STAT5b (Fig. 6C) in INS-1 cells, the activity of the rat SOCS3 promoter was strongly induced. These results support the notion that leptin-induced specific STAT activation may induce SOCS3 expression in pancreatic β-cells.

Leptin induces DNA binding of STAT3 and STAT5b to specific STAT-response elements in the rat SOCS3 promoter in pancreatic β-cells.

Because the rSOCS3 promoter contains DNA sequences homologous to STAT-responsive elements (STATREs) within other promoters (30), we investigated whether leptin induces specific DNA binding of STATs to these STATREs in the rSOCS3 promoter in insulin-producing pancreatic β-cells. When the most distal STATRE-containing oligonucleotide (A-STAT), corresponding to sequence of −363 to −332 bp of the rSOCS3 promoter, and the most proximal STATRE-containing oligonucleotide (C-STAT), corresponding to sequence of −83 to −52 bp of the rSOCS3 promoter, were incubated with in vitro–transcribed and translated pure STAT5b protein, specific retardation of the respective oligonucleotide was detected (Fig. 7A). The STAT protein–DNA complexes were abolished by competition with a 10-fold excess of unlabeled oligonucleotide, and complexes were supershifted by addition of STAT5b-specific antiserum, confirming specificity of binding. In similar experiments, no protein binding of in vitro–transcribed and translated STAT3 protein to A-STAT and C-STAT was detectable, indicating isoform specificity of these promoter regions (data not shown).

When the oligonucleotide B-STAT corresponding to sequence −107 to −75 of the rSOCS3 promoter was incubated with nuclear extracts of leptin-treated INS-1 cells, a single protein-DNA complex was observed (Fig. 7B). This DNA-binding complex increased in a time-dependent manner upon leptin stimulation with a maximum after 6 h. In competition experiments with a 100-fold excess of unlabeled oligonucleotide, the complex disappeared, indicating specificity for the B-STAT oligonucleotide. In supershift experiments with specific antisera for STAT1, STAT3, and STAT5b, the DNA-binding complex was identified as endogenous STAT3 in INS-1 cells, because formation of the complex was abolished by the STAT3 antiserum. These results indicate that the STATRE within the promoter region comprising B-STAT exerts specificity exclusively for STAT3.

These results suggest that leptin induces expression of SOCS3 in pancreatic β-cells via transcriptional induction of rSOCS3 promoter activity that involves specific DNA binding of the transcription factors STAT3 and STAT5b. Although this remains to be definitively shown by detailed promoter analysis involving site-directed mutagenesis, it has previously been demonstrated that these multiple STAT binding sites are important for basal and stimulated SOCS3 promoter activity (30,31).

SOCS3 inhibits basal and STAT3- and STAT5b-dependent transactivation of the rINS-1 promoter.

In Fig. 4A, we demonstrate that STAT3 and STAT5b transactivate −410 bp of the rat preproinsulin 1 promoter in INS-1 cells. This is in contrast to studies in which leptin suppresses insulin secretion and preproinsulin gene expression (36), indicating that the inhibitory effects of leptin at the rat preproinsulin 1 promoter are not mediated by direct STAT3 or STAT5b action. However, we find that SOCS3 overexpression in INS-1 cells inhibits basal (Fig. 8A) and STAT3-dependent (Fig. 8B) as well as STAT5b-dependent (Fig. 8C) transactivation of the rat preproinsulin 1 promoter. These results provide evidence that in pancreatic β-cells, leptin induces SOCS3 expression by STAT3- and STAT5b-dependent transcriptional activation of the SOCS3 promoter, which in turn acts as an inducible negative regulator to restrict basal, but also STAT3- and STAT5b-dependent, activation of the rat preproinsulin 1 promoter.

DISCUSSION

Previous studies have identified STAT3 signaling in the hypothalamus as particularly essential for leptin regulation of energy balance (32,33). In INS-1 cells, a model for insulin-producing β-cells, we demonstrated that leptin leads to recruitment and phosphorylation of STAT3 and STAT5b by the leptin receptor–associated kinase JAK2 (Fig. 2). Consequently, we demonstrated leptin-mediated time-dependent nuclear translocation of STAT3 and STAT5b in INS-1 β-cells (Fig. 3), suggesting that in pancreatic β-cells, STAT3 and STAT5b seem to be the major mediators involved in leptin-induced JAK-STAT signaling.

Leptin inhibits insulin biosynthesis by transcriptional repression of the preproinsulin gene promoter, and it has been suggested that STAT molecules acting via STATREs within the rat preproinsulin 1 promoter may be directly involved (6). However, a previous study indicated that growth hormone–mediated STAT5b binding to the STAT element within the rat preproinsulin promoter causes activation (34). In agreement, we found that STAT5b and STAT3 activate the −410rINS-1 promoter in INS-1 cells, whereas leptin is inhibitory (Fig. 4). This suggests that transcriptional inhibition of insulin biosynthesis by leptin involves signaling molecules different from, or in concert with, STAT3 and STAT5b.

Expression of SOCS3, an inhibitor of the JAK-STAT signaling pathway, has been demonstrated to be induced in the hypothalamus of ob/ob mice after peripheral leptin administration (16). There are several putative STAT binding sites in the SOCS3 promoter, and expression of SOCS proteins is induced by cytokines and hormones via STAT activation (30). SOCS3 induced by leptin binds to the leptin receptor–associated kinase JAK2 in a leptin-dependent manner in vitro, antagonizes kinase activity, and thereby attenuates proximal leptin signaling through the JAK-STAT pathway (17). Intriguingly, another SOCS protein, SOCS7, has recently been shown to act as an inhibitor of leptin-activated STAT3 and STAT5 signaling by abolishing their translocation to the nucleus (35). We found that SOCS molecules may also represent candidate mediators of leptin-dependent inhibition of insulin promoter activity in pancreatic β-cells.

In accordance with the results obtained in the hypothalamus, we were able to demonstrate that leptin induces SOCS3 expression in pancreatic β-cells, mediated through transcriptional activation of the SOCS3 promoter by STAT3 and STAT5b. Thus, we identified SOCS3 as a leptin-induced signaling molecule in pancreatic β-cells. Intriguingly, we found that SOCS3 inhibits the basal activity of −410 bp of the rat preproinsulin 1 promoter in addition to the promoter activity stimulated by STAT3 and STAT5b in INS-1 β-cells. This raises the possibility that SOCS3 has signaling activities in β-cells beyond that of serving as a feedback inhibitor of leptin signaling. This notion is supported by our observation that leptin inhibits preproinsulin gene expression, whereas STAT3 and STAT5b are transcriptional activators. Thus, we propose that SOCS3 not only represents a leptin-induced negative regulator of proximal leptin receptor signaling in an autoregulatory feedback loop, but it is also an important mediator of more distal signaling pathways.

Although, to date, the nature of alternative signaling pathways that may be affected by SOCS3 in pancreatic β-cells is unknown, SOCS molecules are emerging as constituents of signal transduction pathways different from JAK-STAT (36). For example, it has recently been shown that SOCS3 can interfere with insulin signaling in muscle, liver, and adipose tissue, possibly by inhibition of tyrosine phosphorylation of insulin receptor substrate proteins (37). In addition, SOCS3 recently has been demonstrated to complex with the insulin receptor in pancreatic β-cells, leading to reduced insulin receptor autophosphorylation and impaired signaling through the insulin receptor substrate/phosphatidylinositol 3-kinase pathway (38). Given that the insulin signaling pathway can regulate proinsulin gene expression, it is possible that leptin-induced SOCS3 expression in β-cells suppresses proinsulin gene expression by interfering with insulin signaling in the endocrine pancreas. This hypothesis, however, requires further proof by future experiments.

Whether SOCS3 has similar additional signaling roles downstream of JAK-STAT in the hypothalamus warrants investigation. This is particularly relevant given that, in light of the proposed role of SOCS3 in leptin resistance (16,17), SOCS3 inhibitors have been proposed as drug targets to improve leptin sensitivity and thereby treat obesity (19,39,40).

The results presented in this study provide a molecular mechanism by which leptin inhibits preproinsulin gene expression. In particular, we define a novel role for the signaling molecule SOCS3 as a key mediator of leptin action in β-cells. Whether inhibition of preproinsulin gene transcription through this signaling pathway also translates into reduction of insulin biosynthesis and secretion, which has been demonstrated before in pancreatic β-cells, remains to be shown. If so, attenuated signaling through this pathway in leptin-resistant individuals may contribute to hyperinsulinemia associated with obesity and the development of the metabolic syndrome and type 2 diabetes.

FIG. 1.

Expression of mRNAs of STAT1, STAT3, STAT5b, and STAT6 isoforms in INS-1 β-cells. RT-PCR in INS-1 β-cells for STAT1 to STAT6. WM, molecular weight marker; −, reverse transcription reaction without reverse transcriptase (control for DNA contamination).

FIG. 2.

Leptin-mediated phosphorylation of STAT3 and STAT5b by JAK2 in INS-1 β-cells. Immunoprecipitation (IP)-Western blot (IB) analysis of INS-1 whole-cell extracts after stimulation with 10 nmol/l leptin. A: Immunoprecipitation with JAK2 antiserum (αJAK2) and Western blot detection with anti-phosphotyrosine (αPY) antibody (top panel) or αJAK2 (loading control; bottom panel). B: Immunoprecipitation with αJAK2 and Western blot detection with STAT3 antiserum (αSTAT3) (top panel). Immunoprecipitation with αSTAT3 and Western blot detection with anti-phosphotyrosine (middle panel) or αSTAT3 (loading control; bottom panel). C: Immunoprecipitation with αJAK2 and Western blot detection with STAT5b antiserum (αSTAT5b) (top panel). Immunoprecipitation with αSTAT5b and Western blot detection with anti-phosphotyrosine (middle panel) or αSTAT5b (loading control; lower panel).

FIG. 3.

Leptin-induced nuclear translocation of STAT3 and STAT5b in INS-1 cells. A: Serum-deprived INS-1 cells were stimulated with leptin (10 ng/ml) or vehicle. STAT3 and STAT5b proteins were detected by fluorescence immuncytochemistry with primary antisera for STAT3 or STAT5b and fluorescent secondary antiserum coupled to indocarbocyanide. B: Fluorescence microscopy of INS-1 cells stably transfected with vectors coding for a STAT5b-GFP fusion protein and stimulation with leptin (10 ng/ml) or vehicle for 15 min (representative sections; left). Relative fluorescence intensity of cytosols and nuclei was quantified in 200 cells each (right). The values represent the results of four independent experiments ± SE. *P < 0.05.

FIG. 4.

Regulation of rat preproinsulin 1 promoter activity by STAT3, STAT5b, and leptin in INS-1 cells. Luciferase reporter gene assays in INS-1 β-cells. A: Cotransfection of the control vector pcDNA3.1- and STAT3 and STAT5b expression vectors with the reporter gene −410rINS1pGL3 or the empty reporter gene vector pGL3 basic. B: Treatment of INS-1 cells transfected with −410rINS1pGL3 or pGL3 basic with leptin (10 ng/ml) or vehicle for 12 h. The values represent the results of 9–11 independent experiments each ± SD. **P < 0.01.

FIG. 5.

Leptin induction of SOCS3 mRNA expression in INS-1 β-cells and human pancreatic islets in vitro and in islets of ob/ob mice in vivo. A: RT-PCR for rat SOCS3 (rSOCS3) mRNA in leptin (10 ng/ml)-treated INS-1 β-cells. RT−, reverse transcription reaction without reverse transcriptase (control for DNA contamination); WM, DNA weight marker. B: RT-PCR for human SOCS3 (hSOCS3) and β-actin mRNAs in leptin (10 ng/ml)-treated human pancreatic islets. C, positive control PCR using a plasmid harboring the 317-bp hSOCS3 PCR product as template. C: Semiquantitative RT-PCR for murine SOCS3 (mSOCS3) and β-actin mRNAs in pancreatic islets of ob/ob mice after in vivo injection with leptin at 1 μg/g body wt or vehicle (n = 4 per time point). Representative gel (top panel). Densitometric quantitation of SOCS3 PCR products normalized to β-actin expression from three independent experiments ± SE (lower panel). *P < 0.05; **P < 0.01.

FIG. 6.

Leptin, STAT3, and STAT5b transactivation of the rat SOCS3 promoter in INS-1 cells. Luciferase reporter gene assay in INS-1 β-cells. A: Treatment of INS-1 cells transiently transfected with the luciferase reporter gene under the control of −1,054 bp of the rat SOCS3 promoter or the empty vector pGL3 basic with leptin (10 ng/ml) or vehicle for 12 h. B: Cotransfection of the empty vector or STAT3 expression vector with −1054rSOCS3 or pGL3 basic. C: Cotransfection of the empty vector or STAT5b expression vector with −1054rSOCS3 or pGL3 basic. The rSOCS3 promoter contains three putative STAT binding sites (A-STAT, B-STAT, and C-STAT; top panel). The values represent the results of eight to nine independent experiments each ± SD. **P < 0.01; ***P < 0.001.

FIG. 7.

DNA binding of STAT3 and STAT5b to specific STAT response elements in the rat SOCS3 promoter. Electrophoretic mobility shift assay with oligonucleotides comprising putative STAT-binding sites within the rSOCS3 promoter (A-STAT, B-STAT, and C-STAT). A: In vitro–translated STAT5b (IVT-STAT5b) protein was incubated with A-STAT and C-STAT. Competition with a 10-fold excess of unlabeled oligonucleotide (10× A-STAT and 10× B-STAT) and supershift with antiserum for STAT5b (αSTAT5b). B: Nuclear extracts of INS-1 cells treated with 10 ng/ml leptin were incubated with B-STAT. Competition with a 10-fold excess of unlabeled oligonucleotide (10× B-STAT) and supershift with antisera for STAT1 (αSTAT1), STAT3 (αSTAT3), and STAT5b (αSTAT5b). FP, free probe.

FIG. 8.

Inhibition of basal and STAT3- and STAT5b-dependent transactivation of the rINS-1 promoter by SOCS3. Luciferase reporter gene assays in INS-1 β-cells. A: Cotransfection of the empty vector or rSOCS3 expression vector with the luciferase reporter gene −410rINS1pGL3 or pGL3 basic. B: Cotransfection of the control vector (pcDNA3.1-) or rSOCS3 expression vector with −410rINS1pGL3 stimulated by cotransfection of the empty STAT3 expression plasmid (empty vector, □) or a STAT3 expression vector (STAT3, ▪). C: Cotransfection pcDNA3.1- or rSOCS3 expression vector with −410rINS1pGL3 stimulated by cotransfection of the empty STAT5b expression plasmid (empty vector, □) or a STAT5b expression vector (STAT5b, ▪). The values represent the results of six to eight independent experiments each ± SD. **P < 0.01; ***P < 0.001.

Acknowledgments

J.S. has received support from the German Diabetes Association (Deutsche Diabetes-Gesellschaft). X.N. has received support from the German Academic Exchange Service. T.J.K. has received support from the Canadian Institutes of Health Research, is a Michael Smith Foundation for Health Research Scholar, and has received a Career Development Award from the Juvenile Diabetes Research Foundation.

Rat STAT5b cDNA cloned into an expression plasmid pcDNA3.1- was a gift from Dr. L.-Y. Yu-Lee (Baylor College of Medicine, Houston, TX). The plasmid encoding a GFP-Stat5b fusion protein was provided by Dr. Carter-Su (Baylor College of Medicine). We thank J. Roller for expert technical assistance.

Footnotes

  • F.J. is currently affiliated with the Department of Experimental and Clinical Osteology, Orthopedic Department, University of Würzburg, Würzburg, Germany.

    • Accepted September 6, 2005.
    • Received May 24, 2005.

REFERENCES

| Table of Contents
Advertisement