Insulin and Leptin Resistance With Hyperleptinemia in Mice Lacking Androgen Receptor

TABLE 1

Primers used for real-time PCR assays of mRNA expression of genes related to lipid metabolism in WAT, liver, and skeletal muscle

Gene Access no. Forward primer Reverse primer Amplicon (bp)
aP2 M13385 AAGGAAAGTGGCAGGCATGG CACGCCCAGTTTGAAGGAAATC 118
C/EBPα BC028890 CAAGAACAGCAACGAGTACC AGGCGGTCATTGTCACTG 135
PPARα X57638 CGGGAAAGACCAGCAACAAC TGGCAGCAGTGGAAGAATCG 142
PPARγ NM011146 CGAGGACATCCAAGACAAC TGTGACGATCTGCCTGAG 124
SREBP1c NM011480 CTGGCTGAGGCGGGATGA TACGGGCCACAAGAAGTAGA 290

This Article

  1. Diabetes vol. 54 no. 6 1717-1725