Role of a Proline Insertion in the Insulin Promoter Factor 1 (IPF1) Gene in African Americans With Type 2 Diabetes

  1. Steven C. Elbein12,
  2. Xiaoqin Wang12,
  3. Mohammad A. Karim3,
  4. Barry I. Freedman4,
  5. Donald W. Bowden5,
  6. Alan R. Shuldiner67,
  7. Frederick L. Brancati89 and
  8. Wen Hong Linda Kao9
  1. 1Endocrinology Section, Central Arkansas Veterans Healthcare System, Little Rock, Arkansas
  2. 2Division of Endocrinology, Department of Medicine, College of Medicine, University of Arkansas for Medical Sciences, Little Rock, Arkansas
  3. 3Department of Pediatrics, College of Medicine, University of Arkansas for Medical Sciences, Little Rock, Arkansas
  4. 4Department of Medicine, Wake Forest University School of Medicine, Winston-Salem, North Carolina
  5. 5Center for Human Genomics, Wake Forest University School of Medicine, Winston-Salem, North Carolina
  6. 6Division of Endocrinology, Department of Medicine, University of Maryland School of Medicine, Baltimore, Maryland
  7. 7Geriatric Research and Education Clinical Center, Baltimore Veterans Administration Medical Center, Baltimore, Maryland
  8. 8Department of Medicine, Johns Hopkins School of Medicine, Baltimore, Maryland
  9. 9Department of Epidemiology, Johns Hopkins Bloomberg School of Public Health, Baltimore, Maryland
  1. Address correspondence and reprint requests to Steven C. Elbein, MD, Professor of Medicine, Division of Endocrinology 111J-1/LR, John L. McClellan Veterans Hospital, 4300 West 7th St., Little Rock, AR 72205-5446. E-mail: elbeinstevenc{at}uams.edu

Abstract

African Americans have twice the prevalence of type 2 diabetes as Caucasians and much greater genetic diversity. We identified an inframe insertion of a proline in the insulin promoter factor 1 (IPF1) gene (InsCCG243), which was relatively common (minor allele frequency ∼0.08) in African Americans and showed a trend to association with type 2 diabetes in preliminary studies. An earlier French study identified InsCCG243 as a cause of autosomal dominant diabetes. To determine the role of this variant in African Americans, we examined an additional population from North Carolina (n = 368) and a subset of African-American participants from the Atherosclerosis Risk in Communities (ARIC) study (n = 1,741). We also looked for segregation in 66 African-American families and for a role in insulin secretion in 112 nondiabetic subjects. InsCCG243 did not increase the risk of type 2 diabetes (P = 0.16 in North Carolina; P = 0.97 in the ARIC study) and did not segregate with type 2 diabetes in families. However, we found suggestive evidence for reduced insulin response to glucose (P = 0.05). Neither indirect measures of β-cell mass nor β-cell compensation were altered (P > 0.1). InsCCG243 does not act in a dominant, highly penetrant fashion in African Americans and is not a significant risk factor for type 2 diabetes in this population.

African-American individuals have twice the prevalence and between 1.5 and 2.4 times the incidence of type 2 diabetes as Caucasian individuals (1). Additionally, African and African-American populations have much greater genetic diversity than Caucasian populations (2). Together, these facts suggest that unique genetic susceptibility factors may exist in African-American individuals that contribute to the increased incidence of type 2 diabetes. We recently searched for genetic susceptibility factors in the insulin promoter factor 1 (IPF1) gene based on the considerable evidence that β-cell function is impaired early in type 2 diabetes, and this dysfunction is followed by an inexorable fall in insulin secretion and possibly β-cell mass (3). The IPF1 gene (also known as the pancreatic duodenal homeobox 1 [PDX1]) is required for both the differentiation and maintenance of the β-cell phenotype (4). Both humans and mice heterozygous for a defective IPF1 allele develop diabetes (4,5). However, human mutations causing early-onset, autosomal dominant, maturity-onset diabetes of the young (MODY) 4 are very rare. Coding variants in Caucasians with typical type 2 diabetes are unusual (6,7,8,9), and whether the most common of these variants (Asp76Asn) causes type 2 diabetes is uncertain (10,11).

In a study of French-Caucasian families with type 2 diabetes, Hani et al. (7) identified two families that showed autosomal dominant segregation of a proline insertion in the IPF1 transactivation domain (InsCCG243) with typical type 2 diabetes. Among individuals who carried the variant, insulin secretion showed a progressive decline. Furthermore, when expressed in a pancreatic β-cell tumor cell line, the InsCCG243 variant of IPF1 showed impaired transactivation of the insulin gene (7). However, no subsequent study has reported this variant. We recently screened the IPF1 gene for variants in Caucasian and African-American subjects (12). Although we did not observe InsCCG243 among 768 Caucasian alleles, the in-frame proline insertion was relatively common among African-American subjects (minor allele frequency ∼0.08). Among 341 African-American subjects with type 2 diabetes and 186 African-American control subjects, we found a nonsignificant trend to an association with type 2 diabetes (frequency 0.09 in type 2 diabetic and 0.06 in control subjects).

The present study was designed to further examine the role of this previously rare amino acid insertion as an important African-American susceptibility variant. We conducted a series of studies to evaluate the role of InsCCG243 in type 2 diabetes and insulin secretion. First, we examined 112 glucose-tolerant African-American individuals who had undergone direct analysis of insulin sensitivity and insulin secretion to determine the impact of InsCCG243 on insulin secretion. Second, to examine the role of InsCCG243 as an autosomal dominant form of late-onset type 2 diabetes, we tested the segregation and sharing of InsCCG243 among affected siblings in 66 African-American families ascertained for at least two affected individuals. Third, we tested for an association between InsCCG243 and type 2 diabetes in two population-based studies of African Americans: 368 individuals ascertained in North Carolina (189 diabetic case subjects) and 1,741 individuals from the Atherosclerosis Risk in Communities (ARIC) study (591 prevalent and incident diabetic case subjects). Finally, we combined the data from these two population-based studies with the case-control set from our previous publication (12) to estimate the association between InsCCG243 and type 2 diabetes in African Americans.

RESEARCH DESIGN AND METHODS

We examined four study groups. Case-control association analyses were conducted in two populations. African-American subjects from North Carolina comprised 189 successfully typed case subjects ascertained for both diabetes and diabetic nephropathy. One hundred and seventy-nine subjects were randomly ascertained healthy individuals without known diabetes or renal disease and born in North Carolina (13). Details of the ARIC study have been previously published (14). Subjects for this study were mainly recruited from Jackson, Mississippi (∼86% of all African-American ARIC study participants) and from Forsyth County, North Carolina, and participated in four study visits scheduled ∼3 years apart. The present study was of a subset of 1,741 randomly selected, self-identified African-American ARIC study participants, including 339 diabetic case and 1,402 nondiabetic control subjects at baseline (prevalence of 19.4% compared with prevalence of 19.3% in the entire African-American ARIC study cohort of 791 diabetic case subjects and 4,095 African-American ARIC study participants). Among the 1,402 nondiabetic control subjects at baseline, 252 individuals developed incident diabetes during follow-up. For the ARIC study case-control analysis, diabetes was defined as the presence of any of the following at baseline (prevalent cases) or during follow-up (incident cases): 1) fasting glucose ≥7 mmol/l (126 mg/dl), 2) nonfasting glucose ≥11.1 mmol/l (200 mg/dl), 3) 2-h post–75-g postchallenge glucose ≥11.1 mmol/l at visit 4, and 4) self-report of physician-diagnosed diabetes or use of antidiabetes medication. For all studies, age of diagnosis was by self-report. For ARIC study participants without previously diagnosed diabetes, age of onset was taken as the age during the visit at which an elevated plasma glucose was noted. Characteristics of the ARIC study population are shown in the online appendix Table 1 (available at http://diabetes.diabetesjournals.org).

Segregation and affected sibpair analyses were conducted on 339 available members of 66 families ascertained in Arkansas as part of the GENNID (Genetics of Noninsulin Dependent Diabetes) study (15). Sibships were ascertained for at least two siblings with type 2 diabetes and of self-declared African-American ancestry. Relationships were confirmed or modified (full sibships split to half sibships) based on genome scan data (16).

Physiological studies were conducted on 112 African-American individuals who had normal 75-g oral glucose tolerance tests and who successfully completed either tolbutamide- or insulin-modified frequently sampled intravenous glucose tolerance tests (FSIGTs), as previously described (17,18). Because tolbutamide became unavailable during the study, 65 individuals were studied with tolbutamide and the remaining 47 subjects with insulin at 0.04 units/kg. For a subset of 45 subjects, a maximally stimulated insulin response was obtained. At the conclusion of the FSIGT, the glucose was raised over 10 min to 23–25 mmol/l, which was maintained for 30 min. At 30 min of hyperglycemia, a 5-g intravenous arginine challenge was given. Insulin response was measured at baseline (25 mmol/l glucose) and at 2, 3, 4, 6, 8, and 10 min after arginine. Characteristics of the study population are shown in Table 1.

Genotyping.

The proline insertion variant (InsCCG243) was typed in the family study, the FSIGT population, and the North Carolina samples using infrared dyes with detection on a LICOR GR4200 sequencer and scored using SAGAGT fragment analysis software (LICOR Biotech). Unique primer sequences were GAGACACATCAAGATCTGGTTCCAA and CAGCGGGCGGCACA. ARIC study samples were similarly typed using a FAM-labeled 5′ primer and detection on an Applied Biosystems ABI 3700 sequencer, with analysis using Genescan software (Applied Biosystems, Foster City, CA). Because the sequences in the exon 2 around the InsCCG243 variant are highly G-C rich, results were confirmed using the Advantage GC-2 PCR kit (BD Biosciences Clontech, Palo Alto, CA). Additionally, the simple tandem repeat UT1352, which is adjacent to the IPF1 gene, was typed in families to confirm the InsCCG243 transmission using similar methods. All genotypes in population samples were consistent with Hardy-Weinberg equilibrium.

Statistical analyses.

In both population-based case-control studies, allelic and genotypic frequencies of InsCCG243 were estimated and tested for an association with type 2 diabetes using the Fisher’s exact test, and multiple logistic regression was used to adjust for age and sex and to estimate odds ratios (ORs) and 95% CIs for prevalent type 2 diabetes. Since there was follow-up data in the ARIC study, the incidence of diabetes by InsCCG243 genotype was estimated in 1,042 individuals who were nondiabetic at baseline, and Cox proportional hazards models were used to estimate the relative hazards and 95% CIs for incident type 2 diabetes, as previously described (19). Analyses were stratified by obesity status (lean <25 kg/m2, overweight 25–30 kg/m2, and obese >30 kg/m2). Associations between genotype and metabolic traits and genotypes in the ARIC study were evaluated using multiple linear regression and the F test to assess significance of the single nucleotide polymorphism effect. Analyses for the ARIC study sample were performed using STATA (College Station, TX).

For the combined analysis of our previous case-control sample from Arkansas (12), the case-control sample from North Carolina, and the sample from the ARIC study, we used the Mantel-Haenszel method to estimate a pooled OR across studies. Affected sibpair linkage analysis was conducted using SPLINK under possible triangle constraints to test the null hypothesis that there was no excess sharing of InsCCG243 among affected siblings (20).

Insulin sensitivity (Si) was calculated from FSIGT data using MinMod Millenium (21). Acute insulin response to intravenous glucose (AIRG) was calculated as the area under the insulin curve from 2 to 10 min and the disposition index as Si × AIRG (22). Maximal insulin response (AIRMax) was calculated as the mean excursion above baseline at 2–10 min. InsCCG243 association with parameters of insulin secretion and insulin sensitivity was tested using mixed-effects regression models in SPSS for Windows version 12.0 (SPSS, Chicago, IL); skewed variables were ln transformed to normality, and age, sex, protocol type, and BMI were included as adjusted variables. Data are presented transformed back to the linear scale as geometric means and 95% CIs.

RESULTS

Case-control studies.

We first examined the association of InsCCG243 with type 2 diabetes in two population-based case-control studies of African-American individuals. Among 179 case subjects ascertained for type 2 diabetes and nephropathy in North Carolina, the allelic frequency of InsCCG243 was 0.034, which was less than the frequency in 189 healthy control subjects (0.056) and not consistent with an association (P = 0.16; OR 0.59). Table 1 summarizes the genotypic distribution by diabetes status in the ARIC study. There was also no association between InsCCG243 genotypes and prevalent type 2 diabetes (P = 0.59). The allele frequency of InsCCG243 was 0.077 and 0.089 in prevalent case and control subjects, respectively.

The lack of association was also observed in the analysis of incident cases (Table 1). Given the role of IPF1 in pancreas formation and MODY, we hypothesized that the association between variations in IPF1 and type 2 diabetes would be stronger among lean individuals, i.e., individuals who develop type 2 diabetes even without the extreme insulin resistance related to obesity (online appendix Table 2). Despite the large sample size of the ARIC study, we considered this analysis to be exploratory given the low frequency of InsCCG243. InsCCG243 was not associated with risk of diabetes among lean or obese individuals. However, among overweight individuals, those who were heterozygous for InsCCG243 were about twice as likely to have diabetes (hazard ratio 1.81 [95% CI 1.01–2.98]), while the relative hazard associated with homozygosity for InsCCG243 was 1.94 (0.26–14.27), but this was only based on one overweight case subject who was homozygous for InsCCG243 (P for interaction = 0.24). To test the hypothesis that the overweight diabetic individuals with the InsCCG243 variant may be different from their diabetic counterparts without the insertion, we also examined age of onset and several pre-diabetic metabolic traits, including waist circumference, fasting insulin, and homeostatis model assessment of insulin sensitivity or insulin secretion by InsCCG243 genotype among overweight individuals with incident diabetes in the ARIC study. We found no significant differences in these traits by genotype (online appendix Table 3). Table 2 summarizes the results from the present studies (North Carolina and the ARIC study) and the previous study from our laboratory (12), with a total of 1,505 diabetic case and 1,116 control subjects without diabetes. No evidence for an association of InsCCG243 with type 2 diabetes was seen in the combined sample.

Family studies.

Previous studies suggested a MODY-like, autosomal dominant transmission of diabetes with the InsCCG243 variant in two French families (7). Of 66 families examined, 30 had at least one InsCCG243 carrier and 25 families had at least one carrier among the affected siblings for whom the family was ascertained. Only 4 of 25 families were consistent with autosomal dominant transmission; in the remaining 21 families, transmission was from an unaffected parent, unaffected siblings carrying InsCCG243, or affected members who failed to carry the insertion allele. Furthermore, among 64 possible affected sibpairs (sibships with at least one parent inferred to carry an InsCCG243 allele), 24 sibling pairs shared at least one copy of InsCCG243 (37.5%). Sharing of the InsCCG243 variant among siblings under the possible triangle model using the SPLINK program (20) did not differ from the expected (P = 0.58).

Physiological studies.

To examine the physiological impact of InsCCG243 in nondiabetic African-American subjects, we examined 112 individuals with normal glucose tolerance tests who had undergone FSIGT tests (23). A subset of these individuals (n = 45) also underwent arginine stimulation tests at maximally potentiating glucose levels to estimate pancreatic β-cell mass (24). As shown in Table 3, the 20 InsCCG243 carriers did not differ in insulin sensitivity (Si) or ability to compensate for insulin sensitivity with increased insulin secretion from wild-type individuals, but AIRG was reduced by 35% in InsCCG243 carriers (P = 0.05) after adjusting for age, sex, BMI, and percent body fat. In contrast, the 13 carriers who underwent arginine stimulation tests at a glucose level exceeding 25 mmol did not show a difference in maximally stimulated insulin secretion (Table 3), suggesting no impact of InsCCG243 on β-cell mass, although our power to detect small changes in AIRMax was limited by the small sample size. Fasting triglyceride levels were significantly elevated among InsCCG243 carriers (P = 0.03; Table 3), perhaps reflecting the reduced insulin secretion although again the number of carriers was small and the distribution of triglyceride values among these healthy individuals was narrow.

DISCUSSION

IPF1 has a clear role in pancreatic β-cell development and function in both mice and humans (4). Complete absence of IPF1 (PDX1) results in pancreatic agenesis, whereas in mature β-cells IPF1 is a key transcription factor for multiple β-cell genes but most prominently the insulin gene. Heterozygous PDX1 knockout mice (4) and humans heterozygous for rare nonfunctional IPF1 alleles (5) develop glucose intolerance and diabetes, with increased islet apoptosis and reduced islet number (25). Furthermore, IPF1 (PDX1) haploinsufficiency limits the compensatory islet hyperplasia in genetically insulin-resistant mice (26). These facts and the known rare human mutations that cause MODY (27) argue for a potential role of IPF1 variants in common forms of human type 2 diabetes. In previous studies (7,9), four missense mutations were proposed to markedly increase the risk of type 2 diabetes in Caucasians, but subsequent studies (10,28,29) found that these single nucleotide polymorphisms were either rare or failed to associate with type 2 diabetes. The InsCCG243 variant was unique in showing autosomal dominant transmission, reduced insulin secretion in response to an oral glucose challenge, and reduced transactivation of an insulin promoter construct (7). However, despite the initial report in two families, INSCCG243 was not identified subsequently. We have identified this variant in up to 15% of African-American subjects (12). Hence, based on the studies of Hani et al. (7), we predicted that InsCCG243 would be a significant cause of type 2 diabetes among African-American individuals and might help explain the high prevalence of type 2 diabetes in this population.

Our present studies do not support the conclusions of the study of Hani et al. (7). First, analysis of 25 African-American families in which one diabetic member carried the InsCCG243 allele did not support autosomal dominant segregation, nor did a sibpair analysis suggest any increased sharing of this allele among diabetic individuals. Thus, InsCCG243 did not act in a MODY-like fashion. Second, in the two case-control studies considered here, the InsCCG243 allele neither increased diabetes risk nor decreased the age of diabetes onset. In total, we have studied 1,116 case and 1,505 control subjects when all three study populations are considered (ref. 12 and the two studies presented here). When all case-control samples were considered together, the frequency of InsCCG243 was 0.0784 in case and 0.0793 in control subjects. Thus, if InsCCG243 acts to increase diabetes risk, the effect must be influenced by the environment or other genes that considerably mitigate its impact in African-American populations. A combined Mantel-Haenszel test of all available case-control data did not suggest an association (P = 0.76, OR not different from 1). With this sample size, we had 92% power to detect a difference in allele frequencies of 4% (OR 1.5) but only 56% power to detect an OR of 1.3, assuming an allele frequency among nondiabetic individuals of 0.08. Whereas the OR of 1.3 is typical of other type 2 diabetes genes, and thus we cannot exclude a small role for InsCCG243 in type 2 diabetes risk, our results are clearly incompatible with the large effect size proposed by Hani et al. (7).

We found suggestive evidence that InsCCG243 reduced the insulin response to intravenous glucose by 35%, although compensation for insulin resistance (disposition index) was not reduced. The reduced insulin secretion is consistent with the observations of Hani et al. (7) based on the oral glucose response and suggests that InsCCG243 may have a minor role in reducing insulin secretion. Furthermore, these individuals had elevated triglyceride levels, suggesting a less favorable metabolic profile. However, the mechanism behind this elevation is obscure, and the findings may be spurious. The suggestive data from the ARIC study that overweight carriers were more likely to have diabetes (online appendix Table 2) might be consistent with reduced insulin secretion in the setting of high demand. Nonetheless, if we were to account for multiple testing, then these findings would not retain significance. The number of carriers in our physiologic study was relatively small (20); we would have had 80% power to detect a 50% reduction in disposition index but only 36% power to detect significance based on the observed 30% reduction in disposition index. Hence, we cannot exclude an important effect of InsCCG243 on disposition index.

In conclusion, InsCCG243 is common in African Americans; however, we cannot support earlier conclusions that this variant has MODY-like properties. The impact on type 2 diabetes risk was not detectable even in a relatively large combined sample. Our studies exclude an effect greater than an OR of 1.3 based on the relatively large sample typed for this variant, but we cannot exclude smaller effects of a magnitude similar to that of other type 2 diabetes susceptibility genes or gene-gene or gene-environment interactions in African-American subjects that mitigate the effect of this variant.

TABLE 1

Genotype counts and allele frequency of InsCCG243, by diabetes status in 1,741 African-American ARIC study participants

TABLE 2

Summary of results from three studies of InsCCG243 in African Americans

TABLE 3

Marginal means for normoglycemic subjects who underwent FSIGTs by genotype

Acknowledgments

This work was supported by grants R01 DK39311 and DK54636 (to S.C.E.), R01 DK53591 (to D.W.B.), and R01 DK53959 for ARIC study diabetes case-control analysis and K01 DK067207 (to W.H.L.K.) from the National Institutes of Health National Institute of Diabetes and Digestive and Kidney Diseases. Analyses and manuscript preparation were also supported by grants (to S.C.E.) from the American Diabetes Association and by the Department of Veterans Affairs (to S.C.E. and A.R.S.). Metabolic studies in Arkansas were conducted with the support of the General Clinical Research Center Grant MO1-RR14288 (National Center for Research Resources). The ARIC study is carried out as a collaborative study supported by National Heart, Lung, and Blood Institute contracts N01-HC-55015, N01-HC-55016, N01-HC-55018, N01-HC-55019, N01-HC-55020, N01-HC-55021, and N01-HC-55022.

The authors thank the staff and participants of the ARIC study for their important contributions and the staff and study participants at Wake Forest University and University of Arkansas for Medical Sciences. We thank Terri Hale and Judith Cooper for ascertainment of Arkansas subjects.

Footnotes

  • Additional information for this article can be found in an online appendix at http://diabetes.diabetesjournals.org.

  • The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

    • Accepted June 27, 2006.
    • Received April 3, 2006.

REFERENCES

« Previous | Next Article »Table of Contents