Metformin Restores Leptin Sensitivity in High-Fat–Fed Obese Rats With Leptin Resistance
- Yong-Woon Kim1,
- Jong-Yeon Kim1,
- Yong-Hoon Park2,
- So-Young Park13,
- Kyu-Chang Won4,
- Kwang-Hae Choi2,
- Jung-Yoon Huh1 and
- Ki-Hak Moon5
- 1Department of Physiology, College of Medicine, Yeungnam University, Daegu, Republic of Korea
- 2Department of Pediatrics, College of Medicine, Yeungnam University, Daegu, Republic of Korea
- 3Aging-Associated Vascular Disease Research Center, College of Medicine, Yeungnam University, Daegu, Republic of Korea
- 4Department of Internal Medicine, College of Medicine, Yeungnam University, Daegu, Republic of Korea
- 5Department of Urology, College of Medicine, Yeungnam University, Daegu, Republic of Korea
- Address correspondence and reprint requests to Yong-Woon Kim, MD, PhD, Department of Physiology, College of Medicine, Yeungnam University, #317-1, Daemyungdong, Namgu, Daegu 705-717, Republic of Korea. E-mail: ywkim{at}med.yu.ac.kr
Abstract
To evaluate whether metformin enhances leptin sensitivity, we measured leptin sensitivity after 4 weeks of metformin treatment (300 mg/kg daily) in both standard chow and high-fat–fed obese rats. Anorexic and fat-losing responses after intracerebroventricular leptin infusion for 7 days (15 μg daily per rat) in standard chow rats were enhanced by metformin treatment, and these responses to leptin were attenuated in high-fat–fed obese rats compared with age-matched standard chow rats. However, these responses to leptin were corrected by metformin treatment in high-fat–fed obese rats. Moreover, serum concentrations of leptin and insulin were decreased dramatically by leptin in metformin-treated standard chow and high-fat–fed obese rats. The hypothalamic phosphorylated AMP-activated protein kinase level was decreased by lower leptin dose in metformin-treated rats than in untreated rats. In an acute study, metformin treatment also increased the anorexic effect of leptin (5 μg), and this was accompanied by an increased level of phosphorylated signal transducer and activator of transcription 3 in the hypothalamus. These results suggest that metformin enhances leptin sensitivity and corrects leptin resistance in high-fat–fed obese rats and that a combination therapy including metformin and leptin would be helpful in the treatment of obesity.
- AMPK, AMP-activated protein kinase
- CRF, corticotrophin releasing factor
- CSF, cerebrospinal fluid
- pACC, phosphorylated acetyl-CoA carboxylase
- pAMPK, phosphorylated AMPK
- pSTAT3, phosphorylated signal transducer and activator of transcription 3
- STAT, signal transducer and activator of transcription
Leptin, an adipocyte-derived hormone, contributes to body weight homeostasis by regulating food intake and energy expenditure (1). However, leptin is not widely used in the clinical field because obesity is accompanied by elevated serum leptin and responds poorly to the pharmacological administration of exogenous leptin, which ordinarily potently promotes fat mass loss and body weight reduction in lean subjects (2,3); moreover, this poor response of obese subjects is a characteristic of leptin resistance. Thus, the correction of leptin resistance in obese individuals would allow leptin to be used to treat obesity.
Metformin, an oral biguanide insulin-sensitizing agent, inhibits hepatic glucose production, enhances the effects of insulin on glucose uptake in skeletal muscles and adipocytes, and decreases intestinal absorption of glucose (4–7). It is also well known that metformin administration reduces body weight (8,9). Moreover, metformin decreases leptin concentration in morbidly obese subjects (9,10) and in normal-weight healthy men (11). Although leptin concentration is closely related to body fat mass, the leptin-reducing effect of metformin cannot be fully explained by body weight reduction because metformin reduces leptin level even without changing body weight in normal-weight healthy men (11). However, the mechanisms by which metformin reduces body weight and leptin concentration are poorly understood. In addition, it has been recently reported that metformin targets AMP-activated protein kinase (AMPK), which is also activated by leptin (12–14). The above findings imply that a more delicate interaction takes place between metformin and leptin. We hypothesized that metformin increases leptin sensitivity and that the anorexic and leptin-reducing effects of metformin are a result of increased leptin sensitivity.
RESEARCH DESIGN AND METHODS
Male Sprague-Dawley rats were purchased from the Daehan Experimental Animal Center (Seoul, Korea) in a postweaning state. After 1 week of adaptation, the rats were divided into two groups, i.e., standard chow and high-fat–fed groups. The animals were cared for in accordance with the principles of the Guide to the Care and Use of Experimental Animals of the Yeungnam Medical Center. The rats were housed individually under a 12-h light/dark cycle (from 0700 to 1900).
Experimental design
Experiment 1.
To evaluate the leptin sensitizing effect of metformin, the standard chow rats were divided into three groups at 4 months of age: ad libitum–fed (untreated) rats, metformin-treated (treated) rats, and a group of rats pair-fed with the treated rats. The pair-fed rats began the experiment 1 week later than the treated rats, and the amount of food consumed by the treated group was then provided to the pair-fed group in the morning. Each of these three animal groups were further divided into two experimental groups: the artificial cerebrospinal fluid (CSF)-infused group (vehicle) and the leptin-infused group, which were matched for body weight and daily caloric intake (n = 8 in each group). In addition to the above six experimental groups, different dosages of leptin (0, 0.6, 3, or 15 μg leptin daily for treated rats and 0, 0.6, or 15 μg leptin daily for untreated rats) were infused into standard chow rats to examine leptin dose responsiveness.
We also measured the effects of short-term metformin treatment (300 mg/kg s.c. daily for 2 days) on the anorexic effect of leptin. Leptin (5 μg) was injected into the lateral ventricle through a chronically implanted catheter in unrestrained rats on the second day of metformin treatment. Food intake was measured at 6, 12, and 24 h after leptin injection. The body weights before leptin injection in metformin-treated and untreated rats were 383 ± 7.7 and 392 ± 8.2 g, respectively.
To evaluate leptin signaling, the phosphorylated signal transducer and activator of transcription 3 (pSTAT3) level was measured in the hypothalamus 1 h after an intracerebroventricular injection of leptin (0, 0.1, or 1 μg) in rats treated with metformin (300 mg/kg s.c. daily, two consecutive mornings) or saline. Leptin was injected 2 h after the second treatment of metformin.
Experiment 2.
To evaluate whether metformin can correct leptin resistance in a leptin-resistant rat model, high-fat–fed obese rats were treated with metformin for 4 weeks. A leptin-resistant obese rat model was produced by a high-fat diet for 4 months. The high-fat diet was composed of butter, corn oil, sucrose, and casein (38, 21, 23, and 17%, respectively, of total calories) supplemented with vitamins (0.8%), minerals (1.9%), and methionine (0.15%). To confirm leptin resistance before starting metformin treatment, we took blood (∼400 μl) from a tail vein under ethrane anesthesia to measure the serum leptin level after 12 weeks on a high-fat or standard chow diet. The serum leptin concentration was significantly elevated in high-fat–fed obese rats compared with standard chow rats (10.54 ± 0.735 vs. 2.86 ± 0.519 ng/ml, respectively; P < 0.01). The high-fat–fed obese rats were then divided into three groups as described above for standard chow rats (i.e., untreated, treated, and pair-fed rats) and these three animal groups were similarly further divided into vehicle and leptin groups (n = 8 in each group).
Experiment 3.
To evaluate whether metformin has the same effect in a genetically obese animal model, metformin was administered to 7-month-old Otsuka Long-Evans Tokushima Fatty (OLETF) rats and their wild-type LETO rats for 3 weeks. Changes in food intake, body weight, leptin concentration were documented. The pathogenic defect in OLETF rats is a cholecystokinin A receptor defect in the hypothalamus, and these rats show severe fat depositions in visceral regions.
Metformin treatment.
Metformin (300 mg/kg daily) was dissolved in drinking water and administered orally for 4 weeks. Metformin concentrations in water were readjusted twice a week after measuring daily water intake. The untreated and pair-fed rats received drinking water without metformin ad libitum.
Leptin or vehicle administration.
Rats were infused with either vehicle or leptin (15 μg daily) for 7 days into the lateral ventricle, using an osmotic minipump. On the morning of the experiment, rats were anesthetized with xylazine hydrochloride (8 mg/kg s.c.) and ketamine (90 mg/kg i.p.). A brain infusion cannula (Alzet, Cupertino, CA) was stereotaxically placed into the lateral ventricle, using the following coordinates: 1.3 mm posterior to bregma, 1.9 mm lateral to the midsagittal suture, and to a depth of 4.0 mm. A subcutaneous pocket was created using blunt dissection on the dorsal surface and an osmotic minipump (Alzet) was inserted. A catheter tube was connected from the brain infusion cannula to the osmotic minipump, and the brain infusion cannula was secured to the surface of the skull using a jeweler’s screw and acrylic dental cement. The incision was closed with sutures, and rats were kept warm until fully recovered. The infusion rate used was 1 μl/h.
Tissue harvesting and preparation.
Rats were anesthetized with pentobarbital (85 mg/kg i.p.). CSF was taken through a puncture into the fourth ventricle under stereotaxic fixation, blood samples were collected by heart puncture, and serum was harvested by a 10-min centrifugation in serum separator tubes. The circulatory system was perfused with 50 ml of cold saline, and retroperitoneal white adipose tissue and hypothalamus were excised. Tissues and serum were quick-frozen with liquid nitrogen and stored at −70°C.
RT-PCR.
Total RNA was extracted from hypothalamus, using a modification of the method of Chomczynski and Sacchi (15). Then, 1 μg total RNA was reverse-transcribed into cDNA using a Qiagen one-step RT-PCR kit (Hilden, Germany). The POMC sense primer sequence was CCCGAGAAACAGCAGCAGTG, and the antisense primer sequence was AGGGGGCCTTGGAGTGAGAA. The amplification was initiated at 50°C for 30 min, followed by 30 cycles consisting of denaturation at 94°C for 1 min, annealing at the appropriate primer-pair annealing temperature for 1 min, extension at 72°C for 1 min, and a final extension step of 10 min at 72°C. β-Actin (sense: TCTACAATGAGCTGCGTGTG, and antisense: GGTCAGGATCTTCATGAGGT) was used as an internal standard. The RT-PCR products were electrophoresed in 11.5% agarose gels and visualized by ethidium bromide staining.
Western blot analysis.
Protein (30 μg) in hypothalamic lysate was separated on 10% polyacylamide gels and then transferred onto nitrocellulose membranes. Phosphorylated AMPK (pAMPK), phosphorylated acetyl-CoA carboxylase (pACC), and pSTAT3 level were determined by blotting with their specific antibodies (Cell Signaling, Danvers, MA), and total levels of AMPK, ACC, and signal transducer and activator of transcription 3 (STAT3) were estimated in separate blots. In each case, anti-rabbit antibody linked to horseradish peroxidase was used as the secondary antibody. Blots were developed by enhanced chemiluminescence (Amersham Biosciences, Little Chalfont, Buckinghamshire, U.K.), and quantification was performed using Scion Image software.
Measurements of leptin, insulin, and corticotrophin releasing factor.
Serum leptin level was measured using a rat leptin radioimmunoassay kit (Linco Research, St. Charles, MO), CSF leptin using a leptin immunoassay kit (Quankine M; R&D Systems, Minneapolis, MN), serum insulin using a rat insulin enzyme immunosorbent assay kit (SPI-BIO, Massy, France), and serum corticotrophin releasing factor (CRF) level using a rat CRF enzyme immunosorbent assay kit (Phoenix Pharmaceuticals, Belmont, CA).
Statistical analysis.
Data are the means ± SE. Differences between the groups were analyzed by ANOVA, followed by a post hoc test for group comparisons. P < 0.05 was considered statically significant.
RESULTS
Characteristics of the high-fat–fed obese rats.
The high-fat diet increased body weight significantly compared with the standard chow rats (P < 0.05) from 4 weeks until the end of the experiment. The cumulative caloric intake in the high-fat–fed obese rats at 4 months was 134% of that of standard chow rats. The retroperitoneal white adipose tissue mass of high-fat–fed obese rats was increased by ∼2.5 times (P < 0.001) that of standard chow rats. Serum leptin and insulin concentrations were also significantly higher in high-fat–fed obese rats (P < 0.01) (Table 1).
The effect of metformin in the leptin-infused rats.
Metformin treatment alone decreased the caloric intake and body weights of standard chow and high-fat–fed obese rats, although these effects were more prominent in high-fat–fed obese rats (Fig. 1). The leptin treatment in standard chow rats significantly decreased daily caloric intake until day 7 compared with vehicle-administered rats. Moreover, tachyphylaxis developed in the metformin-untreated leptin-treated rats from day 5. In high-fat–fed obese rats, leptin also suppressed daily caloric intake, although this suppression of appetite was less than that seen in standard chow rats. Leptin treatment reduced body weight by 10% in standard chow rats and by 5% in high-fat–fed obese rats (Fig. 3).
Metformin treatment was observed to enhance leptin’s anorexic and body weight–losing effects in standard chow rats and to suppress the development of tachyphylaxis. Metformin treatment also enhanced the anorexic and body weight–losing effects of leptin in high-fat–fed obese rats. Caloric intake and body weight were also measured after intracerebroventricular leptin infusion in pair-fed rats, excluding the effect of food restriction on the leptin effect. Body weight decreased more slowly in pair-fed rats than in metformin-treated standard chow rats, but the suppression of appetite due to leptin treatment in pair-fed rats did not reach the level of that observed in metformin-treated rats.
Leptin treatment reduced retroperitoneal white adipose tissue mass in standard chow rats; however, it did not reduce this mass in high-fat–fed obese rats, which is a characteristic of leptin resistance. Metformin treatment reduced retroperitoneal white adipose tissue mass in high-fat–fed obese rats and in standard chow rats. Noticeably, retroperitoneal white adipose tissue mass was markedly reduced by leptin treatment in both standard chow and high-fat–fed obese rats treated with metformin compared with their untreated counterparts and pair-fed rats.
To clarify the leptin-sensitizing effect of metformin, we measured the dose-responsiveness of leptin in standard chow rats. Accordingly, different dosages of leptin were infused into metformin-treated and untreated standard chow rats. In treated rats, leptin’s anorexic and body weight–losing effects were apparent from 0.6 μg leptin daily, and these effects were increased on increasing the dose. However, 0.6 μg leptin daily failed to reduce the daily caloric intake as well as body weight in untreated rats. Moreover, visceral fat mass was reduced dramatically by leptin treatment even at 0.6 μg daily in metformin-treated standard chow rats; however, this dose had no significant effect on untreated standard chow rats. Cumulative caloric intake and body weight decreased in metformin-treated standard chow rats in a leptin dose–dependent manner (Fig. 2).
Serum levels of leptin, insulin, and CRF and the CSF leptin concentration.
The serum levels of leptin and insulin were elevated in high-fat–fed obese rats, which did not respond to leptin treatment. Metformin treatment per se decreased serum concentrations of leptin and insulin in high-fat–fed obese rats, and these levels were further decreased by leptin treatment. Combined treatment with metformin and leptin dramatically decreased serum concentrations of leptin and insulin in standard chow rats. The serum CRF concentration was higher in high-fat–fed obese rats than in standard chow rats, and this was not changed by leptin treatment in high-fat–fed obese rats, but it was reduced by leptin in standard chow rats. Metformin did not change the CRF level in standard chow rats, but it reduced the CRF level in high-fat–fed obese rats. Leptin treatment reduced the serum leptin level in pair-fed high-fat–fed obese rats, but no significant change in CRF level was observed in these rats (Table 1). No significant difference was observed between the CSF leptin concentrations in standard chow and high-fat–fed obese rats, despite hyperleptinemia in high-fat–fed obese rats. Metformin treatment significantly increased the CSF leptin level in both standard chow and high-fat–fed obese rats (P < 0.05), and the CSF-to-serum leptin ratio was increased in treated rats (Fig. 4).
Proopiomelanocortin mRNA expressions and the levels of pAMPK and pACC in the hypothalamus.
Proopiomelanocortin (POMC) expression was significantly decreased in the hypothalamus of high-fat–fed obese rats compared with standard chow rats, and no significant elevation in POMC expression was observed when intracerebroventricular leptin was administered to high-fat–fed obese rats, whereas leptin increased hypothalamic POMC expression in standard chow rats. However, hypothalamic POMC expression was elevated by leptin treatment in the metformin-treated high-fat–fed obese rats, which provided further evidence of a correction of leptin resistance in the hypothalamus. Expressions of neuropeptide Y and agouti-related protein in the hypothalamus were not changed significantly among the experimental groups (data not shown). Hypothalamic pAMPK level was decreased by leptin treatment but not by metformin treatment in standard chow rats. However, a lower dose of leptin was required to decrease the hypothalamic pAMPK level in metformin-treated rats than in untreated rats. High-fat feeding did not affect pAMPK level in the hypothalamus (data not shown). Changes in hypothalamic pACC level, a downstream target of AMPK, revealed the same pattern as described for pAMPK (Fig. 5).
The effects of short-term metformin treatment on the anorexic effect of leptin and leptin signaling.
Metformin treatment for 2 days enhanced the anorexic effect of the intracerebroventricular leptin injection compared with untreated rats. Moreover, the anorexic effect of leptin was maintained until 24 h in metformin-treated rats, whereas its anorexic effect was blunted from 6 h after leptin injection in untreated rats. We measured the pSTAT3 level in the hypothalamus 1 h after intracerebroventricular leptin injection (0, 0.1, or 1 μg) to analyze leptin signaling. It was found that the pSTAT3 level after injection of 0 or 0.1 μg leptin increased more in treated rats than in untreated rats. However, the maximal pSTAT3 level (at 1 μg leptin) was no different in metformin-treated and untreated rats (Fig. 6).
The effects of metformin in OLETF and LETO rats.
Metformin administered for 3 weeks decreased the mean cumulative caloric intake, body weight, and visceral fat mass by 46.9, 19.4, and 41.4%, respectively, in OLETF rats. These represent augmented responses to metformin compared with similar responses observed in LETO rats, in which the mean cumulative caloric intake, body weight, and visceral fat mass were reduced by 24.5, 12.5, and 29.4%, respectively, versus untreated LETO rats. Metformin treatment decreased serum leptin concentrations in both OLETF and LETO rats compared with their untreated counterparts (18.1 ± 1.23 vs. 37 ± 4.91, P < 0.01; and 7.1 ± 0.84 vs. 17.6 ± 2.08 ng/ml, P < 0.01; respectively). Moreover, serum leptin levels in metformin-treated OLETF and LETO rats showed positive correlations with percentage reductions in food intake (Fig. 7).
DISCUSSION
The current study demonstrates that the anorexic and fat-losing effects of intracerebroventricular leptin are more prominent and that a lower dose of leptin is required to induce these effects in metformin-treated rats than in untreated rats. The observed dramatic decrease in the serum levels of leptin and insulin after combination therapy with metformin and leptin support our findings. Moreover, metformin corrected leptin resistance in diet-induced obese rats.
It is well known that metformin has an anorexic effect (16); however, the mechanism underlying this effect is not clear. Several studies (8,9,17) have reported that the anorexic effect of metformin is attributable to an enhanced insulin effect. Although chronic intracerebroventricular infusion of insulin induces anorexia (18,19) and insulin is associated with anorexic signaling in the hypothalamus (20–22), our findings suggest that leptin is more responsible for the anorexic effect of metformin than insulin for the following reasons. First, a greater reduction in insulin concentration occurred after combined treatment with metformin and leptin than after leptin treatment alone, while appetite was suppressed more profoundly in the combined therapy group. Second, percentage reductions in food intake showed no significant correlation with serum insulin concentrations (data not shown) but were positively correlated with serum leptin levels in OLETF and LETO rats. Third, metformin treatment increased CSF leptin concentrations in both standard chow and high-fat–fed obese rats compared with the untreated rats. Because defective leptin transport through the blood-brain barrier is a possible mechanism of leptin resistance (23–25), which was also shown by the current study, the increase in CSF leptin level may mediate the anorexic effect of metformin.
Leptin signal transduction involves the phosphorylation of STAT3 in the hypothalamus (26,27), which is associated with elevated expression of POMC, an anorexigenic peptide. Moreover, impaired STAT signaling has been demonstrated in leptin-resistant aged obese rats and in db/db mice (28,29). To clarify the mechanism underlying the enhanced effect of leptin in metformin-treated rats, we measured the pSTAT3 level in the hypothalamus after short-term treatment with metformin and/or leptin injection. The hypothalamic pSTAT3 level was increased by metformin treatment alone and was increased more by leptin treatment. The phosphorylated STAT3 level was also increased by directly injecting metformin into the lateral ventricle. Consistent with this finding, the anorexic effect of intracerebroventricular leptin during 24 h was more profound in metformin-treated rats than in untreated rats. Although little information about the effect of metformin on the brain is available in the literature, we suggest that metformin’s anorexic effect is mediated by the STAT3 signaling pathway. Increased pSTAT3 in the hypothalamus by metformin may, at least in part, be attributable to the enhanced effect of leptin because we were unable to eliminate leptin from the CSF. Rouru et al.’s (17) report describes the anorexic effect of metformin in Zucker rats, which do not have an intact leptin receptor, which suggests that the anorexic effect of metformin bypasses the leptin receptor. However, we observed a more remarkable anorexic effect in OLETF rats after administering the same dose (300 mg/kg daily) of metformin than was reported by Rouru et al. (17). Taken together, we believe that metformin and leptin may share a common energy balance signaling pathway.
We also observed that a decrease in hypothalamic pAMPK level was induced by a lower dose of leptin in treated rats than in untreated rats, whereas metformin alone did not change the pAMPK level in the hypothalamus. Because pAMPK is related to the fuel-sensing mechanism in the hypothalamus, and because it is decreased by leptin in the hypothalamus (30,31), the reduced level of pAMPK in the hypothalamus observed in the current study might be associated with enhanced leptin sensitivity. Moreover, metformin increased hypothalamic POMC expression by leptin treatment in high-fat–fed obese rats, whereas this was not observed in untreated high-fat–fed obese rats. Because the effect of leptin is associated with the activation of POMC (32), failure to activate POMC expression by leptin is evidence of leptin resistance, as was shown by untreated high-fat–fed obese rats in the current study. Moreover, recovery of the POMC activating effect of leptin suggests the correction of leptin resistance.
In high-fat–fed obese rats, metformin treatment reduced body weight and food intake more prominently than in standard chow rats. Moreover, although metformin treatment alone did not normalize visceral fat or serum leptin concentration completely in high-fat–fed obese rats, a combination of metformin and intracerebroventricular leptin infusion did normalize these parameters. The elevated serum CRF level, a hypothalamic hormone involved in feeding regulation (33), was decreased by metformin alone in high-fat–fed obese rats, and this was further decreased by metformin and leptin combination therapy, suggesting that the metformin/leptin combination could be useful in the treatment of obesity.
We added the pair-fed group to this study to eliminate food restriction effects induced by metformin treatment. The anorexic and visceral fat–shedding effects of leptin were slightly enhanced in pair-fed high-fat–fed obese rats, which is consistent with other reports (34,35). However, this degree of enhancement did not reach that of metformin-treated high-fat–fed obese rats. Moreover, a dramatic decrease in biochemical parameters was observed in metformin-treated high-fat–fed obese rats but not in pair-fed rats.
In summary, the anorexic effect of metformin appears to be related to the action of leptin. Moreover, metformin was found to enhance the anorexic and fat-losing effects of leptin in standard chow rats and to restore leptin sensitivity in high-fat–fed obese rats with leptin resistance. Our findings indicate that metformin and leptin combination therapy could be useful for the treatment of obesity.
Body weight (A) and daily calorie intake (B) in the standard chow and high-fat–fed obese rats. Metformin treatment (300 mg/kg daily) was started 14 weeks after high-fat or standard chow dieting. Data are the means ± SE of eight rats per group. □, untreated standard chow; ▪, treated standard chow; ○, untreated high-fat fed; •, treated high-fat fed.
Effects of different dosages of leptin (L) on body weight (A), cumulative caloric intake (B), and retroperitoneal white adipose tissue (RT-WAT) weights (C) in metformin-treated or untreated standard chow rats. Different dosages of leptin (0, 0.6, 3, or 15 μg daily) were infused for 7 days. Data are the means ± SE of eight rats per group. □, untreated/0 μg leptin; ▪, untreated/0.6 μg leptin; ♦, untreated/15 μg leptin; ○, treated/0 μg leptin; •, treated/0.6 μg leptin; ▵, treated/ 3 μg leptin; ▴, treated/15 μg leptin. *P < 0.05; **P < 0.01; ***P < 0.001. BW, body weight; Lep, leptin; Veh, vehicle.
Comparisons of the effects of metformin (followed by intracerebroventricular leptin infusion) in standard chow (SC) and high-fat–fed obese (HFO) rats on body weight (A and D), cumulative caloric intake (B and E), and retroperitoneal white adipose tissue (RT-WAT) weights (C and F). Leptin (15 μg daily) or vehicle (artificial CSF) was infused for 7 days. Data are the means ± SE of eight rats per group. □, untreated vehicle; ▪, untreated leptin; ○, treated vehicle; •, treated leptin; ▵, pair-fed vehicle; ▴, pair-fed leptin.*P < 0.05; **P < 0.01; ***P < 0.001. Lep, leptin; Veh, vehicle.
Concentrations of leptin in CSF (A), serum (B), and their ratios (C) in standard chow (SC) and high-fat–fed obese (HFO) rats. Data are the means ± SE of eight rats per group. *P < 0.05 and **P < 0.01 vs. untreated standard chow rats; †P < 0.05 and ††P < 0.01 vs. untreated high-fat–fed obese rats. □, untreated; ▪, treated.
Expression of proopiomelanocortin (POMC) (A) and levels of pAMPK (B) and phosphorylated acetyl CoA carboxylase (pACC) (C) in the hypothalamus after leptin or vehicle infusion in metformin-treated or untreated standard chow (SC) and high-fat–fed obese (HFO) rats. Representative blots are shown in each panel. Data are the means ± SE of eight rats per group. *P < 0.05 vs. their vehicle groups. Lep, leptin; Veh, vehicle.
Cumulative food intake during 24 h after intracerebroventricular (i.c.v) injection of leptin (5 μg) in unrestrained rats (A) and pSTAT3 level in the hypothalamus 1 h after leptin injection (B). Data are the means ± SE of five rats per group. *P < 0.05 and **P < 0.01 vs. their untreated vehicle; ††P < 0.01 vs. treated vehicle. Met, metformin; SC and s.c., subcutaneous.
Effects of metformin treatment (300 mg/kg daily) for 3 weeks on body weight (BW) (A), daily food intake (B), and retroperitoneal white adipose tissue weights (C) in OLETF and LETO rats. A significant correlation was found between serum leptin concentrations and percentage reductions in food intake (D). Data are the means ± SE of 7–8 rats per group. *P < 0.05 and **P < 0.01 vs. their untreated rats.
The serum concentrations of leptin, insulin, and CRF in the experimental groups
Acknowledgments
This work was supported by the Korean Research Foundation Grant funded by the Korean Government (R05-2003-000-10471-0) and the Korea Science and Engineering Foundation (KOSEF; R13-2005-005-01003-0).
Footnotes
-
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
-
- Accepted November 29, 2005.
- Received July 19, 2005.
- DIABETES


















