Deletion of Protein Kinase C-β Isoform In Vivo Reduces Renal Hypertrophy but Not Albuminuria in the Streptozotocin-Induced Diabetic Mouse Model
- Matthias Meier,
- Joon-Keun Park,
- Daniel Overheu,
- Torsten Kirsch,
- Carsten Lindschau,
- Faikah Gueler,
- Michael Leitges,
- Jan Menne and
- Hermann Haller
- Address correspondence and reprint requests to Matthias Meier, MD, Hannover Medical School, Carl-Neuberg Str. 1, 30625 Hannover, Germany. E-mail: meier.matthias{at}mh-hannover.de
Abstract
The protein kinase C (PKC)-β isoform has been implicated to play a pivotal role in the development of diabetic kidney disease. We tested this hypothesis by inducing diabetic nephropathy in PKC-β–deficient (PKC-β−/−) mice. We studied nondiabetic and streptozotocin-induced diabetic PKC-β−/− mice compared with appropriate 129/SV wild-type mice. After 8 weeks of diabetes, the high-glucose–induced renal and glomerular hypertrophy, as well as the increased expression of extracellular matrix proteins such as collagen and fibronectin, was reduced in PKC-β−/− mice. Furthermore, the high-glucose–induced expression of the profibrotic cytokine transforming growth factor (TGF)-β1 and connective tissue growth factor were significantly diminished in the diabetic PKC-β−/− mice compared with diabetic wild-type mice, suggesting a role of the PKC-β isoform in the regulation of renal hypertrophy. Notably, increased urinary albumin-to-creatinine ratio persisted in the diabetic PKC-β−/− mice. The loss of the basement membrane proteoglycan perlecan and the podocyte protein nephrin in the diabetic state was not prevented in the PKC-β−/− mice as previously demonstrated in the nonalbuminuric diabetic PKC-α−/− mice. In summary, the differential effects of PKC-β deficiency on diabetes-induced renal hypertrophy and albuminuria suggest that PKC-β contributes to high-glucose–induced TGF-β1 expression and renal fibrosis, whereas perlecan, as well as nephrin, expression and albuminuria is regulated by other signaling pathways.
- CTGF, connective tissue growth factor
- PKC, protein kinase C
- STZ, streptozotocin
- TGF, transforming growth factor
- VEGF, vascular endothelial growth factor
- WT1, Wilms’ tumor suppressor
Although diabetic nephropathy is the most common cause of end-stage renal failure in the Western world, its molecular mechanisms are still incompletely understood (1). It involves various functional and structural renal changes including renal hyperperfusion/filtration, mesangial expansion, basement membrane thickening, and increased capillary permeability to diverse macromolecules leading to progressive chronic renal insufficiency (1). The earliest clinical sign of diabetic nephropathy represents microalbuminuria, which also heralds impending cardiovascular morbidity and mortality (2,3). Microalbuminuria subsequently leads to the onset of overt proteinuria, representing the critical hallmark for the progression of this chronic kidney disease by mediating tubulointerstitial inflammatory injury (1,3). It is postulated that diabetic nephropathy may result from a local interplay of metabolic and hemodynamic factors either through direct effects of high glucose or auto- and paracrine actions of various vasoactive substances in the kidney (4). Notably, it has been shown that protein kinase C (PKC), a key intracellular signaling pathway in the induction of diabetic microvascular complications, is activated in the diabetic kidney and enhances cell signaling responsiveness to vasoactive peptides in diabetes (5,6).
PKC is a family of at least 12 serine-threonine kinases (7). The function of individual PKC isoforms is conferred by their differentially regulated, cofactor-dependent (calcium, diacylglycerol, and phosphatidylserine) activity, as well as their subcellular localization and binding affinity to specific anchoring proteins after activation and translocation (7,8). However, the functional role of PKC isoform specificity in diabetes remains largely controversial due to contradictory results from various in vitro and in vivo studies (9). High-glucose–induced expression and activation of various PKC isoforms (α, βI, βII, δ, ε, and ζ) have been reported by several investigators, e.g., in mesangial cell culture (10–18). King and colleagues (6,19–21) postulated that this PKC-β isoform is primarily responsible for the glucose-induced effects in diabetic nephropathy, whereas most evidence for this hypothesis stems from studies with the specific PKC-β isoform inhibitor Ruboxistaurin (LY333531). Furthermore, Kelly et al. (22) also demonstrated that in streptozotocin (STZ)-induced diabetic and hypertensive (mRen-2)27 rats, a rodent model that is transgenic for the entire mouse renin gene (Ren-2), in vivo inhibition of the PKC-β isoform with Ruboxistaurin led to a reduction in renal transforming growth factor (TGF)-β1 expression and structural injury of the kidney, as well as albuminuria.
We have previously shown that, mainly, the PKC-α isoform is markedly increased in renal glomeruli, in the interstitial capillaries, and in the endothelial cells of larger arteries (23). Furthermore, we have recently demonstrated that STZ-induced diabetic PKC-α−/− mice are protected against the development of albuminuria due to a diminished loss of the negatively charged basement membrane heparan sulfate proteoglycans, whereas increased TGF-β1 and renal hypertrophy is not prevented (24).
We now tested the hypothesis if deletion of the PKC-β isoform, another classical PKC isoform that had been involved in diabetic microvascular complications (6,9,11), will contribute to the protection against albuminuria and/or renal hypertrophy and fibrosis in PKC-β−/− mice in the STZ-induced diabetic stress model.
RESEARCH DESIGN AND METHODS
Experiments were performed with male SV129 wild-type and SV129 PKC-β−/− mice as previously described (24). The animals received a standard diet with free access to tap water. All procedures were carried out according to guidelines from the American Physiological Society and were approved by local authorities. Weight-matched mice, aged 8–12 weeks old, intraperitoneally received either 125 mg/kg body wt STZ (Sigma-Aldrich) in 50 mmol/l sodium citrate (pH 4.5) or sodium citrate buffer on days 1 and 4. Glucose levels from tail blood were measured with the glucometer Elite (Bayer, Leverkusen, Germany) every other day. Animals with glucose levels >16mmol/l on two consecutive measurements were regarded as hyperglycemic, and glucose measurements were extended to once weekly. The mice received no insulin within the complete study period. Ketonuria did not occur (data not shown). After 8 weeks of hyperglycemia, the animals were killed according to the following protocol. After anesthesia with avertin (2.5%), a laparotomy was performed and urine collected by puncturing the bladder with a 23-gauge needle. The abdominal aorta was canulated with a 23-gauge needle, and the organs were perfused with lactated Ringer solution. After ligation of the left renal artery, the left kidney was removed, weighed, and snap frozen in isopentane (−40°C). The right kidney was perfused with 3% paraformaldehyde in 0.1 mol/l Soerensen’s phosphate buffer. The right kidney was fixed for an additional 20 h in 3% paraformaldehyde in Soerensen’s phosphate buffer and then paraffin embedded.
Histological and morphometric analysis was carried out on paraffin sections (2 μm thickness) cut on a rotation microtome (Leica) and stained with trichrome stain after Masson Goldner standard procedure. Glomerular tuft volume was estimated as previously described (24). Briefly, in each animal, 50 random cross-sectional profiles of superficial to midcortical glomeruli (first two rows of glomeruli beneath the kidney capsule) were recorded with a digital camera (Axiocam; Zeiss, Jena, Germany) connected to a light microscope (Axioplan-2; Zeiss). The glomerular tuft area (AT) was measured using an image analysis system (Axiovision 4.3; Zeiss). Average tuft area (T) was then used to calculate an average glomerular tuft volume (VT) for each animal by the formula VT = β/k × (T)3/2, where β = 1.38 (shape coefficient for spherical particles) and k = 1.1 (size distribution coefficient). Average VT was corrected for the effects of shrinkage (roughly 48%) during paraffin embedding.
Immunohistochemistry was performed using the following primary antibodies: perlecan (Research Diagnostics), nephrin (Alpha Diagnostics), vascular endothelial growth factor (VEGF) (Santa Cruz), fibronectin (Paesel+Lorei), type IV collagen (Southern Biotechnology), TGF-β1 (Santa Cruz), and connective tissue growth factor (CTGF) (Cell Sciences). For indirect immunofluorescence, nonspecific binding sites were blocked with 10% normal donkey serum (Jackson ImmunoResearch Lab, West Grove, PA) for 30 min. Then, cryosections were incubated with the primary antibody for 1 h. All incubations were performed in a humid chamber at room temperature. For fluorescent visualization of bound primary antibodies, sections were further incubated with Cy3-conjugated secondary antibodies (Jackson ImmunoResearch Lab) for 1 h. Specimens were analyzed using a Zeiss Axioplan-2 imaging microscope with the computer program AxioVision 4.3 (Zeiss). Semiquantitative analyses for the various target proteins, e.g., TGF-β1, were done mainly by counting the number of glomeruli with strong, moderate, and weak expression in a blind fashion according to staining intensity. A total of 50 glomeruli of each kidney (n = 6) were analyzed. The extracellular matrix molecules and CTGF expression were evaluated in a blind fashion in arbitrary units (0–5) based on the staining intensity and positivity of the cortical areas using the following criteria: 5, >90%; 4, >70%; 3, >50%; 2, >25%; and 1, >10% positive with immunoreactivity. Fifteen different cortical areas of each kidney (n = 6 for each group) were analyzed. The scoring was conducted by two independent observers who did not know the identity of the animal group.
For Western blotting, the frozen kidneys were pulverized in liquid nitrogen and resuspended in 2 ml lysis buffer (20 mmol/l Tris buffer, pH 7.5, containing 10 mmol/l glycerolphosphate, 2 mmol/l pyrophosphate, 1 mmol/l sodium fluoride, 1 mmol/l phenylmethylsulfonyl fluoride, 1 g/ml leupeptine, 1 mmol/l dithiothreitol, and 1 mmol/l EDTA). Homogenates were sonicated for three 20-s bursts on ice and centrifuged at 500g for 1 min to remove cell debris. Aliquots of the supernatants were stored at −80°C. The protein amount was measured using the Lowry assay. From each sample, 70 μg protein was suspended in loading buffer and run on a 10% polyacrylamide gel and electrophoretically transferred to nitrocellulose membrane. Membranes were blocked in 5% skim milk and 1% BSA for 1 h at room temperature. Primary antibody against factor PKC-α and -ε (Santa Cruz) were applied with gentle rocking overnight at 4°C. After three 10-min washing steps with Tris-buffered saline with Tween buffer (50 mmol/l Tris HCl, pH 7.5, 150 mmol/l NaCl, and 0.01% Tween 20), incubation with horseradish peroxidase–conjugated goat anti-rabbit secondary antibody (Dianova, Hamburg, Germany) was performed for 1 h at room temperature. After three further Tris-buffered saline with Tween washes, the membrane was incubated with Renaissance reagent (NEN; Life Science, Zaventem, Belgium), according to the manufacturer’s instructions, and exposed to X-ray film (Kodak). Quantification was done by measuring relative density (Scion Image).
Total RNA was obtained using RNeasy minicolumns with an on-column DNase digest according to the manufacturer’s protocol (Qiagen). For real-time quantitative PCR, 2 μg total RNA was subjected to reverse transcription using a mix of random hexamers and oligo(dT)12–15 oligonucleotides (Stratagen) and Maloney murine leukemia virus RNase H– point mutant reverse transcriptase (Promega). Quantitative PCR was performed on an SDS 7700 system (Applied Biosystems) with Rox dye as internal control (Invitrogen), FastStart taq Polymerase (Roche diagnostics), and gene-specific primers in combination with SYBR Green chemistry (Molecular Probes) or with dual-fluorescence dye-labeled (FAM-TAMRA) TaqMan probes (BioTez, Berlin, Germany). Data were analyzed using the Q-gene software (32). Primers were designed with Primer Express 2.0 software (Applied Biosystems). Sequences read as follows: HPRT-1: TGACACTGGCAAAACAATGCA, GGTCCTTTTCACCAGCAAGCT; TGF-β1: CCTGAGTGGCTGTCTTTTGAC, TGTATTCCGTCTCCTTGGTTC, Fam-TCACTGGAGTTGTACGGCAGTGGC-Tamra.
Data are shown as means ± SE. The data were compared by ANOVA and the Mann-Whitney U test, as appropriate. Significant differences were accepted when P values were <0.05. Data analysis was performed using SPSS 10.0 software.
RESULTS
We performed our investigation of PKC-β−/− knockout (KO) mice in a nondiabetic and diabetic state to analyze early changes of the renal phenotype compared with appropriate wild-type littermates. High glucose levels (>15 mmol/l) were induced in 8- to 12-week-old mice by intraperitoneal injection of 125 mg/kg body wt of STZ on days 1 and 4. Hyperglycemia persisted in both wild-type (27 ± 7 mmol/l) and KO (22 ± 3 mmol/l) animals 8 weeks after STZ injection compared with 10 ± 3 and 6 ± 1 mmol/l, respectively, in the appropriate sham-injected control mice (Table 1).
Since we have previously shown that PKC-α−/− mice are prevented from the development of albuminuria in the diabetic state (24), we first tested the RNA (Fig. 1A) and protein (Fig. 1B) expression levels of different PKC isoforms in the PKC-β−/− KO mice to rule out compensatory upregulation, mainly of the PKC-α isoform and other PKC isoforms when the PKC-β gene is deleted.
We then measured albuminuria in our PKC-β−/− mice. Notably, we did not find a significant effect of PKC-β isoform deficiency on albuminuria. After 2 weeks of hyperglycemia, no albuminuria was present in either wild-type or KO diabetic study groups (Fig. 2). After 8 weeks of diabetes, a significant increase of albuminuria was observed in the wild-type mice, whereas the PKC-β−/− rodents showed no prevention against the development of albuminuria in the STZ-induced diabetic mouse model. The albumin-to-creatinine ratio was significantly increased in the diabetic wild-type mice with a median 36.3 ± 15.1 g/mol compared with 11.3 ± 2.3 g/mol in the sham-injected control wild-type animals (P < 0.01). Notably, the albumin-to-creatinine ratio also remained increased with a median 41.0 ± 30.0 g/mol in hyperglycemic PKC-β−/− mice compared with appropriate nondiabetic KO control animals (10.7 ± 6.8 g/mol; P < 0.01). The individual data are displayed in Fig. 2.
We have previously suggested that the prevention of albuminuria in STZ-induced diabetic PKC-α−/− mice is possibly related to diabetes-induced expression changes of a major glomerular basement membrane heparan sulfate proteoglycan perlecan (24) and/or the slit membrane protein nephrin (25). Furthermore, we have shown that suppression of the VEGF system contributes to the prevention of albuminuria in diabetic PKC-α−/− mice (24). We subsequently studied expression levels of these target proteins in our albuminuric PKC-β−/− mice compared with appropriate wild-type controls under nondiabetic and diabetic conditions (Fig. 3). First, we performed staining of the basement membrane proteoglycan perlecan in our PKC-β−/− mice. As shown in the left panel of Fig. 3A, there is a strong expression of perlecan in both wild-type and KO nondiabetic animals. The expression of perlecan was greatly reduced in the glomeruli of diabetic wild-type animals, as already previously described (24). However, in contrast to diabetic PKC-α−/− mice, the diabetes-induced loss of glomerular perlecan expression was not prevented in the diabetic PKC-β−/− mice (Fig. 3). Second, we analyzed the expression pattern of the slit diaphragm protein nephrin in our PKC-β−/− mouse model. Figure 3B shows that the downregulation of nephrin does occur to a similar extent in the hyperglycemic PKC-β−/− mice compared with diabetic wild-type control animals. Third, we performed immunohistochemistry of the Wilms’ tumor suppressor (WT1), which has been previously shown to act as a direct transcription factor on the nephrin promoter. Figure 3C displays the decreased number of WT1-positive podocytes in both diabetic animals compared with both nondiabetic controls (wild-type and PKCβ−/− mice). In contrast to PKCα−/− mice, diabetic PKCβ−/− mice are not protected against the loss of the WT1-positive podocytes, which is demonstrated in the semiquantitative analysis displayed in Fig. 3C (right panel). Fourth, we analyzed the glomerular expression of VEGF by immunohistochemistry to elucidate the possible role of glomerular endothelial dysfunction in this mouse model (Fig. 3D). We observed only a weak expression level of VEGF, mainly located in podocytes, in both nondiabetic study groups. Under hyperglycemic conditions, a significant increase of VEGF was observed in the diabetic wild-type animals (P < 0.01). However, this increase was not significantly reduced in diabetic PKC-β−/− mice (Fig. 3D, left panel). The data are also displayed as semiquantitative analysis of immunohistochemistry (Fig. 3D, right panel).
We then studied renal hypertrophy and fibrosis in our PKC-β−/− mice. The kidney weight in the diabetic wild-type group was significantly augmented, indicating renal hypertrophy in the early phase of diabetic nephropathy (Table 1). Interestingly, the kidney weight did not increase in the diabetic KO group, suggesting a role of the PKC-β isoform in the regulation of renal hypertrophy. When calculating the kidney-to–body weight ratio, we found a significant increase in the diabetic wild-type animals, whereas deletion of the PKC-β isoform reduced, but did not completely abolish, renal hypertrophy during hyperglycemia (Table 1).
Furthermore, we investigated glomerular hypertrophy by measuring glomerular tuft volume in the four study groups. As shown in Table 1, a significant increase of the glomerular tuft volume in diabetic wild-type animals was observed. In contrast, PKC-β−/− mice are protected from such changes and had no significant increase of the glomerular tuft volume under diabetic conditions.
To study early structural changes in the kidney from (diabetic) PKC-β−/− mice, we next performed Masson-Goldner trichrome staining of 8-week-old animals (Fig. 4A). The structural analysis revealed glomerular and tubulointerstitial fibrosis in both diabetic groups, with less prominent pathological changes in the diabetic KO mice. The right panel displays more severe tubulointerstitial fibrotic changes as indicated by the arrow bars. Furthermore, both glomeruli display increased hypercellularity as a sign of mesangial expansion. These results demonstrate a regulatory role of the PKC-β isoform in renal fibrosis.
We next analyzed the expression of the extracellular matrix molecules, which are possibly involved in the observed downregulation of renal fibrosis in the diabetic PKC-β−/− mice. First, we started with the immunohistological evaluation of type IV collagen (Fig. 4B) and fibronectin (Fig. 4C). Both extracellular matrix molecules showed an increased expression level under diabetic conditions. However, diabetic PKC-β−/− mice showed a significantly reduced increase in these key molecules compared with the appropriate wild-type control animals, as displayed (P < 0.01).
To elucidate the possible mediators between the PKC-β isoform and extracellular matrix expression, we next analyzed the role of the profibrotic cytokine TGF-β1. The results for TGF-β1 are shown in Fig. 5A. Immunohistochemistry demonstrated a significant increase of the glomerular TGF-β1 expression in hyperglycemic wild-type animals, whereas diabetic PKC-β−/− mice showed a significantly diminished increase in TGF-β1 protein expression (Fig. 5A). This observation was further substantiated by semiquantitative analysis (P < 0.05) (Fig. 5A, middle panel). The reduction of the increased TGF-β1 expression in the diabetic PKC-β−/− mice was then confirmed by quantitative analysis using RT-PCR (Fig. 5A, right panel). We then performed immunohistochemical analysis of CTGF, another important profibrotic cytokine in diabetic kidney disease. As expected, the semiquantitative analysis demonstrated a significantly increased expression level of CTGF in the diabetic wild-type animals compared with control animals. Notably, in the diabetic PKC-β−/− mice, this increase was prevented (Fig. 5B; P < 0.01).
DISCUSSION
The main findings of the present study are that 1) diabetic PKC-β−/− mice demonstrated reduced renal hypertrophy and expression levels of the profibrotic cytokine TGF-β1 and that 2) in contrast to diabetic PKC-α−/− mice (24,25), hyperglycemia-induced albuminuria and structural alterations of the glomerular filtration barrier were not prevented by deletion of the PKC-β gene. Our data suggest that selective PKC isoform specificity plays an important role in vivo and that two physiologically important features of diabetic nephropathy, renal hypertrophy and albuminuria, are regulated through different PKC-signaling events.
The data from our study shed new light on the role of the PKC-β isoform in the development of diabetic nephropathy. King and colleagues (6,19–22) have demonstrated that the specific PKC-β isoform inhibitor Ruboxistaurin (LY333531) ameliorates hyperglycemia-induced changes in the kidney. Kelly et al. (22), however, used relatively high dosages of this compound in STZ-induced diabetic and hypertensive (mRen-2)27 rats. Notably, we have previously shown that diabetes-induced albuminuria in mice is prevented by the deletion of PKC-α (22).
Our current results confirm some of the data obtained by using Ruboxistaurin in the above mentioned studies. Diabetic PKC-β−/− mice demonstrate reduced renal hypertrophy, as well as diminished high-glucose–induced expression of extracellular matrix proteins and of the profibrotic cytokines TGF-β1 and CTGF (27), which have previously been demonstrated to be unaltered in diabetic PKC-α−/− mice (24). We therefore suggest that activation of the PKC-β isoform signaling pathway in the diabetic state directly contributes in the regulation of TGF-β1 in experimental diabetic nephropathy, whereas PKC-α isoform signaling is not involved.
In contrast to the above mentioned pharmacological studies, we have not found that hyperglycemia-induced albuminuria and structural alterations of the glomerular filtration barrier is prevented in diabetic PKC-β−/− mice in the present study. However, we have previously shown that diabetic PKC-α−/− mice are protected against the development of albuminuria, probably due to a diminished loss of the negatively charged basement membrane heparan sulfate proteoglycans and/or the slit diaphragm protein nephrin (24,25). Notably, in the present study, we have not observed prevention of perlecan loss in the nonprotected diabetic PKC-β−/− mice with persistent albuminuria. Our data therefore suggest that the PKC-β isoform does not play a key role in the synthesis or degradation of heparan sulfate proteoglycans, which has previously been shown for the PKC-α isoform.
The role of distinctive PKC isoform specificity in the disturbance of the glomerular filtration barrier is further underlined by the failure of PKC-β−/− mice to be prevented from nephrin loss in the diabetic state (28,29), which we have reported to occur in diabetic PKC-α−/− mice (25). Nephrin, a member of the immunoglobulin superfamily, is regulated on a transcriptional level through binding of the transcription factor WT1 to the nephrin promoter (28,30–31). We have recently demonstrated that the underlying mechanism of the hyperglycemia-induced nephrin loss in diabetic nephropathy is a PKC-α isoform–dependent downregulation of WT1 (25), which is not observed in the PKC-β−/− mice.
Furthermore, we have previously suggested that the PKC-α isoform is involved in the regulation of VEGF and its receptor as demonstrated in STZ-induced diabetic PKC-α−/− mice (24). VEGF represents a cytokine family that induces angiogenesis, endothelial permeability, and endothelium-dependent vasodilatation (32), whereas its expression level has been proven to play a pivotal function in the maintenance of the glomerular endothelium (33). The exact role of VEGF in diabetic nephropathy, however, is less defined. VEGF expression was shown to be increased in experimental and human nephropathy (34,35). Furthermore, blockade of VEGF with systemic antibody administration decreased albuminuria in rats with STZ-induced hyperglycemia or db/db mice with type 2 diabetes (36,37). Our current data from diabetic PKC-β−/− mice extend these findings to further in vivo evidence that the PKC-β isoform does not contribute to increased VEGF expression in the diabetic kidney, as suggested by other investigators (20–22). In summary, our novel results from PKC-β−/− mice suggest that the VEGF system in the diabetic kidney and the two other compartments of the glomerular filtration barrier, the glomerular basement membrane and the slit diaphragm, are not functionally regulated by the PKC-β isoform but the PKC-α isoform.
This conclusion appears to be in direct contrast to previous studies, mainly from King and colleagues (19–21), that Ruboxistaurin (LY333531) inhibited PKC activity in glomeruli and while ameliorating the increased albumin excretion rate in various diabetic rodent models in an oral dose-responsive manner. A human Ruboxistaurin trial on diabetic nephropathy over 1 year showed a tendency toward amelioration of albuminuria and maintenance of the estimated glomerular filtration rate in type 2 diabetic patients with incipient nephropathy, despite concomitant treatment with renin-angiotensin system inhibitors (38). However, as the placebo-treated control group also declined, Tuttle et al. (38) could not show a significant difference between placebo and active treatment. Lately, King and colleagues (39) presented a preliminary study from the Joslin Diabetes Center on renal pathophysiology in the STZ-induced diabetic mouse kidney, while also showing persistent albuminuria in the diabetic PKC-β−/− mice and confirming our results. It has been suggested that deletion of the PKC-β isoform leads to improved renal dysfunction and pathology, while preventing an increased expression of NADPH oxidase complexes (39). It is tempting to speculate that also nonselective, possibly dose-dependent, effects of Ruboxistaurin or cell-type specific events may occur in the diabetic kidney (5,8–10).
A single gene locus from the PKC-β isoform encodes for two related proteins, PKC-βI and -βII isoforms, which are generated by alternative splicing of the COOH-terminal exons (40). Recently, Redling et al. (41) demonstrated that mainly the PKC-α, -βI, and -ε isoforms were expressed in glomeruli in the mouse kidney, whereas the expression of the PKC-βII isoform was otherwise restricted to cortical and medullary interstitial cells in the mouse kidney (41). However, it is interesting that only PKC-βI, but not PKC-βII, isoform is expressed in glomerular cells (41,42). These previous studies indicate that a cell-type specific expression pattern of the various PKC isoforms is pivotal, mainly in such a complex cellular structure as the kidney. Together with the results presented within this study, we therefore suggest that the PKC-β isoform is more important in the upregulation of TGF-β1 and for the development of renal hypertrophy and fibrosis under diabetic conditions, whereas the PKC-α isoform seems to play a critical role in the development of albuminuria by perpetuating the glomerular filtration barrier. Notably, the breakdown of the glomerular filtration barrier with development of albuminuria in the diabetic PKC-β−/− mice did occur, although inhibition of TGF-β1 was obtained by the deletion of the PKC-β isoform in this study. This dissociation among the three major pathological events in diabetic nephropathy, namely albuminuria, renal hypertrophy, and fibrosis, is in agreement with Ziyadeh et al. (43) who showed that long-term inhibition of TGF-β1 with a specific antibody prevented the mesangial expansion and renal hypertrophy in db/db mice without affecting the development of albuminuria.
In conclusion, our current findings add to these previous observations that two important features of diabetic nephropathy, albuminuria and glomerular hypertrophy, are differentially regulated via PKC isoform–selective signaling events, as displayed in Fig. 6. Dual blockade of both classical PKC isoforms, PKC-α and PKC-β, should be considered in the treatment of diabetic nephropathy when modulating PKC activity using pharmacological approaches (44).
RNA (A) and protein (B) expression levels of different PKC isoforms in the PKC-β−/− mice compared with wild-type (WT) controls. No significant upregulation of other isoforms is observed when the PKC-β gene is deleted.
Albuminuria after 2 and 8 weeks. The median is shown as a solid bar. *P < 0.05 vs. control; **P < 0.01 vs. control; ***P < 0.01 vs. SV129 diabetic mice. WT, wild type.
Expression levels of the key molecules perlecan (A), nephrin (B), WT1 (C), and VEGF (D) of the glomerular filtration barrier. Data are displayed as immunhistochemistry with semiquantitative analysis for VEGF (D). VEGF expression was defined as strong, moderate, or weak. Under hyperglycemic conditions, perlecan and nephrin loss are not prevented in the PKC-β−/− mice, whereas a slight but nonsignifcant downregulation of VEGF is observed when the PKC-β isoform is deleted. WT, wild type.
Light microscopy after Masson-Goldner trichrom staining of the kidney from 8-weeks-old diabetic PKC-β−/− and wild-type (WT) animals (A). Glomerular mesangial expansion and tubulointerstitial fibrosis was pronounced in the diabetic wild-type control group with less prominent pathological changes in the diabetic PKC-β−/− mice. Furthermore, immunohistochemistry including semiquantitative analysis of collagen IV (B) and fibronectin (C) expression in wild-type and PKC-β−/− mice. The hyperglycemia-induced expression of collagen IV and fibronectin are significantly increased in diabetic wild-type mice but not in diabetic PKC-β−/− mice (P < 0.01).
Immunohistochemistry including semiquantitative analysis of TGF-β1 (A) and CTGF (B) expression in wild-type (WT) and PKC-β−/− mice. In wild-type mice, hyperglycemia resulted in a significant increase of TGF-β1 and CTGF expression, whereas diabetic PKC-β−/− mice were protected. Data for TGF-β1 were further sustained by quantitative RT-PCR (P < 0.05).
Postulated functional role of the classical PKC isoforms α and β in the development of diabetic nephropathy.
Baseline and final blood glucose levels and body weight, kidney weight, and glomerular tuft volume in wild-type and PKC-β−/− mice
Acknowledgments
This work was supported by a Grant-in-Aid from the European Foundation for the Study of Diabetes (EFSD)/SERVIER grant for vascular complications of type 2 diabetes to M.M. and the German Research Council (DFG) to H.H. (Ha 1388-7/1).
We thank Petra Berkefeld and Robert Laudeley for excellent technical assistance.
Footnotes
-
M.M. and J.-K.P. contributed equally to this work.
-
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
-
- Accepted November 6, 2006.
- Received June 30, 2006.
- DIABETES

















