TABLE 1

Sequences of the PCR primers

GeneGenBank accession no.Primers
Product size (bp)Annealing temperature (°C)Cycles (n)
SenseAntisense
Glut-2S77926TTAGCAACTGGGTCTGCAATGCAGCGATTTCCTCAAAAG1705625
BcL-2M16506AGCTGCACCTGACGCCCTTGTTCAGGTACTCAGTCATCCAC1926025
BcLXLAF088904AGGTTCCTAAGCTTCGCAATTCTGTTTAGCGATTCTCTTCCAGG2485720
BaxL22472R&D Systems Catalog # RDP-43-0254206020
BadL37296R&D Systems Catalog # RDP-41-0254455520