TABLE 1

Primers used for PCR amplification of deleted mtDNA and wild-type mtDNA

NameSequence 5′→3′Binding site on rat mtDNA
L588AGCCGTCCTACTACTTCTCTCACTG5881 to 5906
L768GCTTAGAGCGTTAACCTTTTAAG7687 to 7709
L782TTTCTTCCCAAACCTTTCCT7825 to 7844
L797GTTCCCATCAATTCTATTCC7978 to 7997
L1576GGTTCTTACTTCAGGGGCCATC15768 to 15789
H1296CAGCAGTTATGGATGTGGCG12981 to 12962
H1309AAGCCTGCTAGGATGCTTC13117 to 13099
H1511GGCCTCCGATTCATGTTAAGACTA15142 to 15118
H1626GTGGAATTTTCTGAGGGTAGGC16288 to 16267