TABLE 1

List of primer information for RT-PCR

Forward primerReverse primerSize of PCR product (bp)GenBank accession no.Annealing temperature (°C)No. of cycles
Actincgt aaa gac ctc tat gcc aaagc cat gcc aaa tgt ctc at351V012175635
Albumingcc cta ccc aca aag cct cagpp gtg gct ttc tgt tgc tgt tca540NM_1723205535
TGF-αaca gct cgc tct gct agc gctgga tct tca gac cac tgt ctc469NM_0126715735
Gata-4cat gct tgc agt tgt gct agatt ctc tgc tac ggc cag ta174NM_1447305635
TTRctc tgc ctc gct gga ctg ataagt ggt gct gta gga gta cgg393AF4796605535
HNF-4aca tgg ctg act aca gtg ctgctg ctg tcc tcg tag ctt gac392NM_0221805835
P48att aac ttc ctc agc gag ctgtca aaa ggt ggt tcg ttc tct338NM_0539645835
Amylaseagc agg aag acc ag ctg taatg act ggg tct gtg aac at201J007035535
Elastaseggt cta ctc tct cca caa cattgg tac cat gat cct ccg ga180NM_0125525635
Carboxypeptidase A1gcatcc att cta ggg agt ggggaa aga gta ctt gat gcc ctg602NM_0169985535
HNF-1ttc taa gct gag cca gct gca gac ggct gag gtt ctc cgg ctc ttt cag a275X544235635
mPdx-1tac aag ctc gct ggg atc actgca gta cgg gtc ctc ttg tt309X_743425635
rPdx-1cgg cca cac agc tct aca agggag gtt acg gca caa tcc tgc667NM_0228525635
Ngn3ctg cgc ata gcg gac cac agc ttcctt cac aag aag tct gag aac acc ag324NM_0217005835
NeuroDctt ggc caa gaa cta cat ctg ggga gta ggg atg cac cgg gaa225NM_0192185735
Nkx2.2gtacacgcgctggctggccaggtacacgcgctggctggccag304NM_0109195835
Pax4cag cag cat gga cca gct tggctc ctg taa tgc ccg cag gac214XM_1330235535
Nkx6.1atg gga aga gaa aac aca cca gactaa tcg tcg tcg tcc tcc tcg ttc280AF3578835835
Pax6gag aca gat tac tct ccg aggacc aca cct gta tcc ttg ctt ag g465NM_0130015535
Isl1cgg gag gat ggg ctt ttc tgagc tgc ttt tgg ttg agc aca g191NM_0173395635
MafAgac atc tcc cca tac gaa gtgccg cta cta cgt ttc tta tct462NM_0088145535
Glut-2tcc agt aca ttg cgg act tccggt gta gtc cta cac tca tg304J031455835
GKaag gga aca aca tcg tag gacta tgg cgg tct tca tag ta126X535895635
Insulin Itac aat cat aga cca tca gcacag ttg gta gag gga gca gat355Gi:2049565635
Insulin IIagc cct aag tga cca gct acatgc caa ggt ctg aag gtc ac343V012435635
PPgtc gca tac tac tgc ctc tccaga cag aag gga ggc tac aaa tcc336NM_0126265735
Glucagongac cgt tta cat cgt ggc ggcgg ttc ctc ttg gtg ttc atc aac249NM_0127075835
Somatostatinatg ctg tcc tgc cgt ctc ctcg agt tgg cag acc tct g277NM_0126595635
GLP-1Rtct ctt ctg caa ccg aac ctctg gtg cag tgc aag tgt ct351S759525835
SUR-1Aag atc atg cac ttg tct actaga cag cag gaa cag cgg tgt593AF0395955635
SNAP-25Agt agt ggc cag cca gcc tgatc tgg cga ttc tgg gtg tca200NM_0309915735
HexokinaseTga acc acg aga aga acc agaAca atg tta gca tca tag tcc322NM_0127345835
Kir6.2Acc acg ctg gtg gac ctc aagGca cca cct gca tat gaa tgg481RNU448976035
IAPPGgc tgt agt tcc tga agc ttaag gtt gtt gct gga gcg aa260NM_0125865635
Chromogranin AAct aag gtg atg aag tgt gttct cta cag tgt cct tgg ag353NM_0216555635
PC-1Ttt gtc agt atg cgt gct aacCtg tga cga tgc tgt aat gat554AB0715965835
PC-2Agg tgg tga ggg att acc aaAga act gtg gac caa gga ga177NM_0127465835