Systematic Search for Single Nucleotide Polymorphisms in the FOXC2 Gene
The Absence of Evidence for the Association of Three Frequent Single Nucleotide Polymorphisms and Four Common Haplotypes With Japanese Type 2 Diabetes
Article Figures & Tables
Tables
- TABLE 1
Clinical features of the control and type 2 diabetic subjects
Control subjects Type 2 diabetic subjects n (M/F) 200 (108/92) 195 (95/100) Age (years) 54.3 ± 8.1 60.0 ± 11.6 Age of onset (years) 48.4 ± 12.3 Duration of diabetes (years) 11.7 ± 9.1 Height (cm) 161.5 ± 8.1 157.9 ± 8.9 BW (kg) 60.3 ± 10.0 58.4 ± 12.0 Max BW (kg) 68.4 ± 14.7 δBW (kg) 9.9 ± 6.8 Age of max BW (years) 44.3 ± 14.5 BMI (kg/m2) 23.0 ± 2.8 23.4 ± 3.7 Max BMI (kg/m2) 27.3 ± 4.7 δBMI (kg/m2) 4.0 ± 2.7 HbA1c (%) 4.8 ± 0.3 7.7 ± 1.7 Treatment (diet/OHA/insulin) 46/104/45 Data are means ± SD. BW, body weight; Max BW, maximum body weight; δBW, Max BW − BW; δBMI, Max BMI − BMI; OHA, oral hypoglycemic agents.
- TABLE 2
Allele frequency of SNPs in the FOXC2 gene for control and type 2 diabetic subjects
SNP Control subjects Type 2 diabetic subjects P −512C>T 129/400 (32.3%) 118/390 (30.3%) 0.591 −350G>T 52/400 (13.0%) 53/390 (13.6%) 0.834 +898C>T (Pro300Ser) 0/400 (0%) 1/390 (0.3%) 0.494 +907C>A (Leu303Met) 1/400 (0.3%) 6/390 (1.5%) 0.066 1167_1169delCCA(389delHis) 2/400 (0.5%) 0/390 (0%) 0.499 +1251C>A (Ala417Ala) 0/400 (0%) 1/390 (0.3%) 0.494 +1548C>T 40/400 (10.0%) 41/390 (10.5%) 0.816 Fisher’s exact probability test was used for the statistical analysis. Allele frequencies represent minor alleles different from the reference sequence (GenBank accession no. NT_024788). The nucleotide number of each SNP is counted from A of the start codon as 1, with the caution that the one base shorter numbers than those from the human draft sequence for the FOXC2 gene are used beyond +1060 as correct reference numbers.
- TABLE 3
Genotype frequencies of each SNP with a >5% frequency in the FOXC2 gene for control and type 2 diabetic subjects
SNPs Control subjects Type 2 diabetic subjects χ2 P AA Aa aa AA Aa aa −512C>T 94 83 23 93 86 16 1.25 0.535 −350G>T 151 46 3 146 45 4 0.175 0.916 +1548C>T 161 38 1 156 37 2 0.362 0.834 χ2 Test was used for the statistical analysis. The nucleotide number of each SNP is counted from A of the start codon as I, with the caution that the one base shorter numbers than those from the human draft sequence for the FOXC2 gene are used beyond +1060 as correct reference numbers. A, major allele; a, minor allele different from the reference sequence gene (GenBank accession no. NT_024788).
- TABLE 4
Linkage disequilibrium between two of the three SNPs in the FOXC2 gene and haplotype frequencies in control subjects
Haplotype Estimated HF Expected HF D D′ χ2 P −512 +1548 21.2 <10−5 C - C 0.577 0.610 −0.033 −1 C - T 0.100 0.067 +0.033 +1 T - C 0.323 0.290 +0.033 +1 T - T 0.000 0.033 −0.033 −1 −512 −350 28.5 <10−7 C - G 0.547 0.589 −0.042 −1 C - T 0.130 0.088 +0.042 +1 T - G 0.323 0.281 +0.042 +1 T - T 0.000 0.042 −0.042 −1 −350 +1548 5.50 0.019 G - C 0.771 0.783 −0.012 −0.917 G - T 0.099 0.087 +0.012 +0.917 T - C 0.129 0.117 +0.012 +0.917 T - T 0.001 0.013 −0.012 −0.917 To examine a deviation from linkage equilibrium between 2 SNPs, a χ2 test was performed as described by Imanishi et al. (18). The nucleotide number of each SNP is counted from A of the start codon as 1, with the caution that the one base shorter numbers than those from the human draft sequence for the FOXC2 gene are used beyond +1060 as correct reference numbers. HF, haplotype frequency; D, linkage disequilibrium parameter; D′, relative linkage disequilibrium value.
- TABLE 5
Estimated haplotype frequencies defined by the three frequent SNPs in the FOXC2 gene
SNPs −512 −350 +1548 Control subjects (n = 200) Type 2 diabetic subjects (n = 195) C G - C 0.447 0.456 T G - C 0.323 0.303 C T - C 0.130 0.136 C G - T 0.100 0.105 Total frequency 1.000 1.000 Haplotype frequencies between three SNPs were estimated based on the Arlequin program (16). The frequencies of four major haplotypes are shown. The frequencies of the other four minor haplotypes were <10−5. When the linkage disequilibrium was analyzed using the likelihood ratio test in EH program (15), linkage disequilibrium was apparent in each group (χ2 = 46.0, P = 2.43 × 10−9 in control subjects and χ2 = 45.6, P = 2.94 × 10−9 in type 2 diabetic subjects). The nucleotide number of each SNP is counted from A of the start codon as 1, with the caution that the one base shorter numbers than those from the human draft sequence for the FOXC2 gene are used beyond +1060 as correct reference numbers.
- TABLE 6
Primers used for PCR and sequencing of 5′ flanking region of the FOXC2 gene promoter
Primers (5′–3′) 5′ position of each primer Buffer and DNA polymerase for PCR PCR pr1F CCAAACCCCACAAAACTGCTCGCAGCGACG −1248 Advantage GC genomic polymerase mix pr1R GTAATTCTGCTCGCTCAGGTAGGGCACCAC +72 Sequencing pr1F CCAAACCCCACAAAACTGCTCGCAGCGACG −1248 1RN1 TCAGGTAGGGCACCACTCC +58 pr2F GGCCCCCATAATTAGGAAA −938 pr2R ATCTCTCCCAAAGACCTTG −841 pr3F TCTTAGAGCCGACGGATTC −645 pr3R CCCGGAACTTTGAGCCAAT −560 pr4F GTCCTGGAGCCAGCGAGGA −283 pr4R TTTCAGCGGACCGGGCGGA −198 The 5′ positions are shown by defining the translation start site as +1. The 5′ sequences were determined based on the comparison between the human draft sequence for the FOXC2 gene on chromosome 16 (GenBank accession no. NT_024788) and the human FOXC2 cDNA sequence (no. NM_005251). One large fragment was amplified by PCR with primers indicated as PCR and each region was sequenced with ones indicated as sequencing as described in research design and methods. F, forward; R, reverse; N, nested.
- TABLE 7
Primers used for PCR and sequencing of the coding region of the FOX 2 gene
Amplified region Primers (5′–3′) 5′ position of each primer Buffer and DNA polymerase for PCR 1 PCR 1F CTCTCTCGCTCTCAGGGC −81 I 7R ATCCCCGCGCTGTACTGCT +155 Sequencing 1FN2 TCTCAGGGCCCCCCTCGCT −72 7RN6 GCGCTGTACTGCTCCGGGT +149 2 PCR and sequencing 7F GCAGAATTACTACCGGGCT +63 I* 1R TGCTTGTTCTCCCGGTAGA +341 3 PCR and sequencing 2F CCTACAGCTACATCGCGCT +221 ET* 2R CTCCTTGGACACGTCCTTC +528 4 PCR 3F CTACAACATGTTCGAGAACG +456 A* 3R TGATGTTCTCCACGCTGAA +826 Sequencing 3FN TGTTCGAGAACGGCAGCTT +464 3RN TTCTCCACGCTGAAGCCAG +821 5 PCR 4F CAAGGTGGAGACGCTGAG +678 I* 9R TCCAGGCCCTGAGCGCAC +965 Sequencing 4FN2 AGACGCTGAGCCCCGAGAG +686 9R TCCAGGCCCTGAGCGCAC +965 6 PCR 9FN GCCGCTCCCCCTGCCCTA +897 I 4RN2 CGCTCGGGTGGTCCGAGAG +1090 Sequencing 9FN GCCGCTGGCGCTGCCTA +897 4RN3 GGTGGTCCGAGAGGGCCT +1081 7 PCR 5F GATGAGCCTGTACACCGG +1004 5R GAACATCTCCCGCACGTT +1362 Sequencing 5F GATGAGCCTGTACACCGG +1004 I* 5RN CACGTTGGGGAAAGTTTGC +1350 8 PCR 6F GTATCTCAACCACAGCGG +1272 ET* 8R2 GGGTCTGAGAAAAGGTTGG +1636 Sequencing 6FN CAACCACAGCGGGGACCT +1278 8RN GAAAAGGTTGGTGGACATG +1628 The 5′ positions are shown by defining the translation start site as +1 with the caution that the one base shorter numbers than those from the human draft sequence for the FOXC2 gene on chromosome 16 (GenBank accession no. NT_024788) are used beyond +1060 as correct reference numbers of this gene. The coding region was determined based on the comparison between the human draft sequence and the human FOXC2 cDNA sequence (no. NM_005251). Each of the eight fragments was amplified by touchdown PCR with primers indicated as PCR and sequenced with ones indicated as sequencing as described in research design and methods. The nested primers required for sequencing are indicated as N.
- *
* ExTaq DNA polymerase was used instead of Taq. To denote the buffer used, A and I are based on the name of the Invitrogen Optimized TM buffer. ET, ExTaq buffer (Takara). F, forward; R, reverse.
In this Issue
