Skip to main content
  • More from ADA
    • Diabetes Care
    • Clinical Diabetes
    • Diabetes Spectrum
    • ADA Standards of Medical Care in Diabetes
    • ADA Scientific Sessions Abstracts
    • BMJ Open Diabetes Research & Care
  • Subscribe
  • Log in
  • Log out
  • My Cart
  • Follow ada on Twitter
  • RSS
  • Visit ada on Facebook
Diabetes

Advanced Search

Main menu

  • Home
  • Current
    • Current Issue
    • Online Ahead of Print
    • ADA Scientific Sessions Abstracts
  • Browse
    • By Topic
    • Issue Archive
    • Saved Searches
    • ADA Scientific Sessions Abstracts
    • Diabetes COVID-19 Article Collection
    • Diabetes Symposium 2020
  • Info
    • About the Journal
    • About the Editors
    • ADA Journal Policies
    • Instructions for Authors
    • Guidance for Reviewers
  • Reprints/Reuse
  • Advertising
  • Subscriptions
    • Individual Subscriptions
    • Institutional Subscriptions and Site Licenses
    • Access Institutional Usage Reports
    • Purchase Single Issues
  • Alerts
    • E­mail Alerts
    • RSS Feeds
  • Podcasts
    • Diabetes Core Update
    • Special Podcast Series: Therapeutic Inertia
    • Special Podcast Series: Influenza Podcasts
    • Special Podcast Series: SGLT2 Inhibitors
    • Special Podcast Series: COVID-19
  • Submit
    • Submit a Manuscript
    • Submit Cover Art
    • ADA Journal Policies
    • Instructions for Authors
    • ADA Peer Review
  • More from ADA
    • Diabetes Care
    • Clinical Diabetes
    • Diabetes Spectrum
    • ADA Standards of Medical Care in Diabetes
    • ADA Scientific Sessions Abstracts
    • BMJ Open Diabetes Research & Care

User menu

  • Subscribe
  • Log in
  • Log out
  • My Cart

Search

  • Advanced search
Diabetes
  • Home
  • Current
    • Current Issue
    • Online Ahead of Print
    • ADA Scientific Sessions Abstracts
  • Browse
    • By Topic
    • Issue Archive
    • Saved Searches
    • ADA Scientific Sessions Abstracts
    • Diabetes COVID-19 Article Collection
    • Diabetes Symposium 2020
  • Info
    • About the Journal
    • About the Editors
    • ADA Journal Policies
    • Instructions for Authors
    • Guidance for Reviewers
  • Reprints/Reuse
  • Advertising
  • Subscriptions
    • Individual Subscriptions
    • Institutional Subscriptions and Site Licenses
    • Access Institutional Usage Reports
    • Purchase Single Issues
  • Alerts
    • E­mail Alerts
    • RSS Feeds
  • Podcasts
    • Diabetes Core Update
    • Special Podcast Series: Therapeutic Inertia
    • Special Podcast Series: Influenza Podcasts
    • Special Podcast Series: SGLT2 Inhibitors
    • Special Podcast Series: COVID-19
  • Submit
    • Submit a Manuscript
    • Submit Cover Art
    • ADA Journal Policies
    • Instructions for Authors
    • ADA Peer Review
Complications

Nephrin Is Critical for the Action of Insulin on Human Glomerular Podocytes

  1. Richard J.M. Coward1,
  2. Gavin I. Welsh2,
  3. Ania Koziell3,
  4. Sagair Hussain3,
  5. Rachel Lennon1,
  6. Lan Ni1,
  7. Jeremy M. Tavaré2,
  8. Peter W. Mathieson1 and
  9. Moin A. Saleem1
  1. 1Academic and Children's Renal Unit, University of Bristol, Bristol, U.K
  2. 2Department of Biochemistry, University of Bristol, Bristol, U.K
  3. 3Molecular Medicine Unit, Institute of Child Health, University College, London, U.K
  1. Address correspondence and reprint requests to Richard Coward, AcademicChildren's Renal Unit, University of Bristol, Bristol, U.K. E-mail: richard.coward{at}bristol.ac.uk
Diabetes 2007 Apr; 56(4): 1127-1135. https://doi.org/10.2337/db06-0693
PreviousNext
  • Article
  • Figures & Tables
  • Info & Metrics
  • PDF
Loading

Abstract

The leading causes of albuminuria and end-stage renal failure are secondary to abnormalities in the production or cellular action of insulin, including diabetes and hyperinsulinemic metabolic syndrome. The human glomerular podocyte is a critical cell for maintaining the filtration barrier of the kidney and preventing albuminuria. We have recently shown this cell to be insulin sensitive with respect to glucose uptake, with kinetics similar to muscle cells. We now show that the podocyte protein nephrin is essential for this process. Conditionally immortalized podocytes from two different patients with nephrin mutations (natural human nephrin mutant models) were unresponsive to insulin. Knocking nephrin down with siRNA in wild-type podocytes abrogated the insulin response, and stable nephrin transfection of nephrin-deficient podocytes rescued their insulin response. Mechanistically, we show that nephrin allows the GLUT1- and GLUT4-rich vesicles to fuse with the membrane of this cell. Furthermore, we show that the COOH of nephrin interacts with the vesicular SNARE protein VAMP2 in vitro and ex vivo (using yeast-2 hybrid and coimmunoprecipitation studies). This work demonstrates a previously unsuspected role of nephrin in vesicular docking and insulin responsiveness of podocytes.

  • 2-DOG, 2-deoxyglucose
  • ESRF, end-stage renal failure
  • GFB, glomerular filtration barrier
  • FM, Fin major
  • FMnt, FM nephrin transfected
  • GFP, green fluorescent protein
  • GST, glutathione S-transferase
  • IF, immunofluorescence
  • MDCK, Madin-Darby canine kidney
  • NM, nephrin missense
  • WT, wild type

The renal glomerulus is the region of the kidney forming the biological sieve that allows water and small solutes to freely pass from circulation into the urine but is relatively impermeable to macromolecules, such as albumin. Albumin loss into the urine (albuminuria) is prevented by the glomerular filtration barrier (GFB). The GFB consists of three layers:endothelial cells lining the capillary wall, the glomerular basement membrane, and, adjacent to the urinary space, podocytes. The importance of the podocyte in the development of albuminuria became obvious in the late 1990s through landmark discoveries of inherited human genetic conditions that resulted in congenital or early-onset nephrotic syndrome (1–3). These all coded for proteins (nephrin, podocin, and α-actinin–4) found exclusively in the podocyte in the kidney. Recently, two further inherited human proteinuric genetic conditions that exclusively affect the podocyte in the kidney have been described: mutations in Laminin-β2, which affect podocyte adhesion to the glomerular basement membrane (4), and TRPC6 mutations, which cause altered calcium flux into the podocyte (5,6).

The prevention of albuminuria is essential, because evidence suggests (7) if prolonged, it accelerates the progression to end-stage renal failure (ESRF). The largest proportion of patients with albuminuria and ESRF in the western world have abnormalities in the production of insulin (type 1 diabetes) or its cellular effects (type 2 diabetes) (8,9). Furthermore, even in nondiabetic normoglycemic subjects, microalbuminuria is associated with insulin resistance and is an independent cardiovascular risk factor (10). There is accumulating evidence that the podocyte is central in the development of diabetic nephropathy (11), although the mechanism is unclear. We have recently reported (12) the novel observation that wild-type (WT) podocytes are insulin-sensitive cells. Other cell types previously shown to respond in this way include adipocytes and muscle cells (13). In the GFB, insulin sensitivity is specific for podocytes, as conditionally immortalized human glomerular endothelial cells (14) are insulin unresponsive (12).

Nephrin (OMIM 602716) is a transmembrane protein of the immunoglobulin superfamily and consists of a large extracellular portion with eight C2-type IgG-like domains, a single fibronectin type-3–like motif, and a cytoplasmic domain with multiple tyrosine phosphorylation sites. Mutations in genes coding for this protein cause the most severe form of congenital nephrotic syndrome (Finnish-type congenital nephrotic syndrome), with children being born leaking massive amounts of protein into their urine. The most common genetic defect is coded for by the Fin major (FM) genotype, which results in complete truncation of the protein (1), although a large number of other mutations are also described (1,15). Children with this disorder used to succumb to the complications of prolonged severe nephrosis (infection and thrombosis) but now are surviving to adulthood through a program of therapy that includes therapeutic bilateral nephrectomy. The function of nephrin in preventing protein loss into the urine has been an area of intense research over the past 5 years and has been proposed to be due to its structural properties in maintaining the slit diaphragm between podocyte foot processes (1,16) and as a signaling molecule through tyrosine phosphorylation of its COOH (17–20). Moreover, very recently, nephrin has been shown to be able to regulate the actin cytoskeleton of the podocyte through Nck adaptor proteins (21,22).

We have developed conditionally immortalized podocytes from children with mutations in the nephrin gene (natural human nephrin mutant models) and children who have normal WT podocytes with no detected podocyte protein mutations (23). Using these unique cell lines, this article demonstrates that the protein nephrin is critical for the insulin response in human podocytes.

RESEARCH DESIGN AND METHODS

Cells.

Human podocytes were immortalized as previously described (23), and all contained the tsSV40 T gene and a gene encoding the catalytic domain of human telomerase (24). All expressed the podocyte markers Wilms' Tumor 1, synaptopodin, and podocin after 14 days of thermo-switching. The FM nephrin-deficient cell line characterization has previously been described (25). A cell line derived from a female child who had congenital nephrotic syndrome and her kidneys removed at 21 months of age was also examined. These podocytes had a homozygous missense mutation of the NPHS1 gene (NM) with a resulting guanine to adenine nucleotide change at position 1379, causing a substitution at amino acid 460 of the protein of glutamate for arginine. This is predicted to cause protein trapping of nephrin in the cytoplasm of the cell, which was supported by immunofluorescence (IF) and Western blotting of the immortalized differentiated NM podocyte (Fig. 1). Different clones were studied for each cell type, and passages numbers between 5 and 20 were used for each. All experiments were performed on podocytes thermo-switched to 37° C for at least 14 days to silence the SV40 gene.

2-Deoxyglucose uptake.

The same methods as previously described (12) were used with paired basal and insulin-stimulated podocytes being studied. An insulin dose of 100 nmol/l for 15 min was used to stimulate the cells.

Small inhibition of nephrin RNA.

The siRNA target sequence that was used to knock down nephrin was GUCGCUCAUCCUGAACGUA. A scrambled sequence of GUCGCUCUCACUGAACGUA (a 3-bp difference) was used as a control. The same methodology as previously described (12) was used. Podocytes were incubated for 48 h of siRNA before assessing protein levels and performing 2-deoxyglucose (2-DOG) uptake.

Stable transfection of nephrin into FM podocytes.

Full-length nephrin cDNA was incorporated into a Zeocin-resistant vector pcDNA3.1/Zeo+(Invitrogen, Paisley, U.K.). Transfection was achieved using the cationic lipid-based transfection reagent Lipofectamine 2000 CD (Invitrogen) with Optimem (Gibco) and selection with 1 mg/ml Zeocin. Transfection was achieved in the permissive 33°C podocytes, but after transfection the cells were allowed to differentiate after thermo-switching for 14 days. Passages 1–3 of the FM nephrin-transfected (FMnt) cells were studied.

Immunofluorescence.

Nephrin immunofluorescence (IF) was achieved using the monoclonal mouse antibodies 48E11 or 50A9, which were a kind gift from Prof. K. Trygvasson (Karolinska Institute, Stockholm, Sweden). GLUT4 was visualized using the monoclonal antibody 1F8 (R&D Systems). Secondary fluoroscein isothiocyanate anti-mouse antibodies (Jackson) were used in all IF. The same protocol as previously described was used (12)

Bis-glucose photolabeling.

WT, FM, and FMnt cells were studied for functional GLUT1 at the plasma membrane in their basal state and after 15 min of 100 nmol/l insulin as previously described (12).

Western blotting.

A standard Western blot protocol was followed (25). For nephrin, the monoclonal mouse antibody 50A9 or rabbit polyclonal K2737 was used (kind gifts from Prof. Trygvasson), and for GLUT1, a polyclonal rabbit antibody was used (a kind gift from Prof. G. Holman). Where necessary, densitometry was performed using a Bio-Rad gel doc 1000 mini transilluminator and processed using Quantity One software package (Bio-Rad, Hercules, CA).

Yeast 2 hybrid analysis: identification of an interaction between cytosolic nephrin and VAMP2 by kidney cDNA library screening

Formation of a pGBDU-nephrin (amino acids 1085–1160) construct.

A cDNA corresponding to cytosolic nephrin amino acids 1085–1160 was PCR amplified from Quickclone human kidney cDNA (Clontech) using Pfu Polymerase (Stratagene) and gene-specific primers: 5′ aaagaattcctctggcagcggagactcaggc, 3′ aaagtcgacttatcgggaataagacacctcctcc. This was subcloned into the Gal4 DNA–binding domain vector pGBDU-C3 (gift from Dr. P. James, University of Wisconsin) to generate an in-frame EcoR1/SalI fragment. Inserts were confirmed by EcoR1/SalI digest and directly sequenced using ABI 377 Automated Technology.

Yeast 2 hybrid screening.

A Gal4-based yeast 2 hybrid system was used. Competent yeast cells were prepared using a freshly genotyped pJ69–4A yeast strain (MATa, gal4Δ, gal80Δ, trp1-901, leu2-3, ura3-52, his3-200, GAL2-ADE2, LYS2::GAL1-HIS3, and met2::GAL7-LacZ). These were sequentially transformed using lithium acetate with 100 ng pGBDU-nephrin (amino acids 1085–1160) DNA followed by 250 μg pYES-Trp-human adult kidney cDNA library DNA. Transformed cells were recovered by shaking at 225 rpm at 30°C in selective media for ∼9 h, harvested, and then resuspended in minimal media. For serial dilutions and plating on -Trp plates, 100 μl was removed to determine library transformation efficiency. To test histidine reporter activation, 500 μl aliquots were plated onto -Ura -Trp -His + 2 mmol/l 3AT and incubated at 30°C for 4 days. Colonies rising from histidine reporter activation were streaked in duplicates onto -Ura, -Trp, -Ade plates to test adenine reporter activation. One set of duplicate colonies was also tested by β-Gal Filter Lift Assay to test LacZ reporter activation. Plasmids were recovered from pJ69 initially by culture in -Trp minimal media, followed by suspension of harvested cells in 200 μl plasmid rescue buffer (100 μl of Tris-saturated phenol [pH 8.0]) and 100 μl 24:1 chloroform:isoamyl alcohol) and vortex in conjunction with acid-washed glass beads (Sigma). Supernatants were collected and bound to Qiagen spin columns by further centrifugation. The bound plasmid DNA was washed with 750 μl phycoethrin (Qiagen) and eluted by incubation of the column with 50 μl EB (10 mmol/l Tris, [pH 8.0]) (Qiagen) for 1 min followed by centrifugation at 13,000 rpm for 1 min.

Analysis of yeast clones.

Five microliters of DNA was used as template in a PCR using pYES-TRP vector-specific primers (5′ gatgttaacgataccagcc, 3′ gcgtgaatgtaagcgtgac). PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) and directly sequenced using ABI 377 automated technology. Sequenced clones were determined for frame and orientation, and putative interactors were identified through screening against computer databases using BLAST searches (http://www.ncbi.nlm.nih.gov/BLAST).

Immunoprecipitation of the nephrin-VAMP2 complex

Cellular transfections.

Madin-Darby canine kidney (MDCK) epithelial cells were transfected with 1 μg pcDNA3-glutathione S-transferase (GST)-nephrin (amino acids 1057–1241; pCDNA3-GST–tagged vector generated in house) and pGFP (green fluorescent protein)-VAMP2 (full-length) (a kind gift from Prof. G. Rutter, University of Bristol) using Lipofectamine 2000, according to the manufacturers' protocol. Cells were incubated at 37°C for 48 h before harvesting in ice-cold NETN lysis buffer (100 mmol/l NaCl, 1 mmol/l EDTA, 20 mmol/l Tris-HCl [pH 8.0] 0.5% NP40). GST-nephrin and GFP-VAMP2 protein expression was confirmed by SDS-PAGE and Western blot using specific nephrin and VAMP2 antibodies (Abcam). Protein concentration of extracts was confirmed by Bradford assay. These cells were used because they were easily transfectable with the two constructs, which was not the case for immortalized podocytes.

Glutathionine precipitation.

Glutathione-Sepharose beads (Amersham/Pharmacia) were preblocked in 1% BSA then washed in NETN and stored as 50% slurry; 400 μg cell lysate was added to 50 μl of beads per incubation, which was conducted at 4°C for 3 h. Glutathione precipitates were collected by pulse centrifugation, the supernatant was discarded, and the pellets were washed four times with NETN lysis buffer. The pellet was resuspended in 20 μl of 2 × Laemmeli and boiled and analyzed by SDS-PAGE and Western blot. Membranes were immunoblotted with GST (Clontech; BD Biosciences) and GFP (Vector Labs) antibodies.

Nephrin-VAMP2 immunoprecipitation from human glomerular extracts.

Glomeruli were studied from two patients. One patient had a kidney removed for a renal tumor, and the normal pole was sieved for glomeruli. The other patient was a deceased donor for a kidney transplant, but the kidney vasculature was unsuitable for transplantation. This kidney was offered for research. Both kidneys were obtained with full ethical consent. Glomeruli were sieved as previously described (23). The transplant kidney was received and immediately put in serum-free RPMI media for 2 h after sieving the glomeruli. One aliquot was then insulin stimulated with 100 nmol/l insulin, and this was compared with another aliquot of glomeruli under basal conditions.

VAMP2 was immunoprecipitated from glomeruli lysed in a Triton-based lysis buffer (1% Triton X, 50 mmol/l Tris [pH 7.5] containing 1 mmol/l EDTA, 120 mmol/l NaCl, 50 mmol/l NaF, 40 mmol/l β-glycerophosphate, 1 mmol/l benzamidine, 1% NP40, 1 μm microcystin, 5 mmol/l orthovanadate, and 1μg/ml each of pepstatin, leupeptin, and antipain) using Protein A/G beads (Santa Cruz) and 5 μg monoclonal antibody (SYSY systems). Western blot was then performed using polyclonal anti-nephrin antibody. A negative control of normal mouse immunoglobulin was used to immunoprecipitate an equimolar aliquot of glomeruli.

To identify if nephrin pull-down resulted in VAMP2 precipitation in human glomeruli, we used the Profound system (Pierce), which limits contamination with immunoglobulin light chains. The manufacturers' instructions were followed, and polyclonal nephrin (K2737) was used to immunoprecipitate the glomerular lysate. After washing and eluting polyclonal VAMP2 (Abcam) was used in the Western blot. An equal amount of glomerular lysate was immunoprecipitated against normal rabbit immunoglobulin (Sigma) (same concentration as nephrin antibody) as a negative control.

Statistical analysis.

For comparisons among multiple groups, ANOVA was used followed by a post hoc Bonferroni test. The Prism 2 program was used for this analysis. When paired samples were analyzed, a two-tailed Student's t test was used. P < 0.05 was taken to demonstrate statistical significance.

RESULTS

Nephrin is essential for insulin-induced glucose uptake in human podocytes.

We studied the insulin response on 2-DOG uptake in fully differentiated immortalized podocytes derived from subjects with no renal disease (WT), FM, or NM nephrin mutations. Both of the nephrin mutant cell lines were unresponsive to insulin; there was an approximate doubling of insulin-stimulated glucose uptake in WT cells (Fig. 2). All cell types had comparable basal uptake of 2-DOG per milligram protein, so the insulin effect was not due to basal saturation of cell-surface glucose transporters in nephrin mutant cells (data not shown). To ensure this was not a clonal effect, we tested a number of different clones for each cell type, all of which gave similar results (data not shown). We also knocked down nephrin in WT podocytes with nephrin-specific siRNA, achieving ∼60% protein knockdown after 48 h (Fig. 3A). Doing so abrogated the effect of insulin. This was not the case in cells treated with scrambled siRNA, which differed by 3 bp to the nephrin siRNA (Fig. 3B).

Reconstitution of nephrin in FM podocytes rescues their insulin responsiveness.

We generated a stable nephrin-expressing FM cell line (FMnt) to address if nephrin was the critical factor that resulted in a loss of insulin responsiveness (in respect to glucose transport). Nephrin protein was expressed in the transfected cells in abundant amounts and in the correct location (at the plasma membrane) as assessed by Western blotting and IF (Fig. 4A). When stimulated with insulin, we found that the insulin-responsive phenotype of the cells could be rescued (Fig. 4B).

Nephrin is required for the fusion of GLUT1 and GLUT4 with the plasma membrane of the podocyte.

Using bis-glucose photolabeling for GLUT1 and IF for GLUT4, we studied the effect of nephrin on the functional plasma membrane incorporation of these glucose transporters in response to insulin. We compared WT, NM, FM, and the FMnt podocytes. Using GLUT1 bis-glucose photolabeling, we found that FM was unable to functionally incorporate GLUT1 into the plasma membrane of the cell under basal conditions and was not upregulated by insulin as occurs in WT podocytes (12). Furthermore, using IF in the nephrin-mutant cells, GLUT4 vesicles were shown to move to the periphery of the cell in response to insulin but did not appear able to fuse with the membrane. The appearance of vesicle fusion was rescued after transfecting nephrin back into the cells, giving a response similar to wild-type podocytes (Fig. 5). The bis-glucose assay is not sensitive enough to detect GLUT4 in podocytes (12); however, we speculate from the GLUT4 IF observations that nephrin is required to incorporate GLUT4 (as well as GLUT1) into the plasma membrane of the podocyte in response to insulin.

The COOH-terminus of nephrin forms a protein-protein interaction with VAMP2.

Initially we performed a yeast- 2 hybrid screen using the COOH-terminus of nephrin (amino acids 1085–1160) as the bait. A transformation efficiency of 1.5 × 106 was observed for yeast 2 hybrid screening using pGBDU-Gal4-BD-cytosolic nephrin (amino acids 1057–1217) and the pYES-Trp-human adult kidney cDNA library (Invitrogen). Two overlapping nucleotide sequences in the correct orientation were identified through screening against computer databases using BLAST searches as VAMP2 (or vesicle-associated membrane protein, synpatobrevin). Translation of both sequences confirmed that both were in frame, and the identity was further verified by sequencing. The VAMP2 primers used were designed over intron-exon boundaries to distinguish PCR products generated by genomic contamination or from mRNA. We subsequently isolated VAMP2 mRNA from conditionally immortalized WT podocytes using reverse transcriptive PCR and VAMP2 protein using Western blotting (data not shown).

After this screening experiment, we went on to prove a protein-protein interaction in vitro using coimmunoprecipitation between GST-tagged nephrin COOH-terminus and GFP-tagged VAMP2 in MDCK cells (Fig. 6). This demonstrated a protein-protein interaction between VAMP2 and the COOH-terminus of nephrin. Finally, we examined human glomerular extract and found that nephrin and VAMP2 interact ex vivo (Fig. 7) and that insulin stimulation increased this interaction.

DISCUSSION

This paper demonstrates that nephrin is critical in vitro to enable insulin-stimulated glucose uptake into podocytes. Furthermore, after a yeast 2 hybrid screen we have discovered a novel protein interaction of nephrin with VAMP2 that we have confirmed in vitro in MDCK cells and that this interaction occurs ex vivo in humans by immunoprecipitation of glomerular extracts.

Nephrin is a critical molecule in maintaining the GFB of the kidney. Mutations in this protein in humans cause the most severe phenotype of the early-onset nephrotic syndromes (congenital nephrotic syndrome of the Finnish type) (1). There is also evidence that a reduction in nephrin quantity and/or location (from a plasma membrane to a cytoplasmic distribution) occurs in the more common acquired human nephrotic syndromes (25–27). In diabetic nephropathy, it has been shown that nephrin expression decreases as albuminuria progresses (28–30); this occurs independent of expression of other molecules located at the slit diaphragm of the podocyte such as podocin and CD2AP, suggesting that decreased nephrin expression is not a nonspecific marker of generalized podocyte dysfunction (31). At a cellular level, this effect is similar to knocking down nephrin in the podocyte, which, as we show in this article, induces podocyte insulin resistance in respect to glucose uptake in vitro. We hypothesize that one reason insulin responsiveness of the podocyte is important is to enable a physiological response allowing the cell to rapidly increase easily metabolized carbohydrate to facilitate structural remodelling required to withstand an increase in the glomerular blood flow that occurs after a meal. This adaptive response is lost in diabetic nephropathy, resulting in podocyte dysfunction and contributing to breakdown of the GFB and albuminuria. Recent intriguing evidence (32) strengthens the link between insulin sensitivity, nephrin, and proteinuria. The peroxisome proliferator–activated receptor γ agonist, pioglitazone, which increases the insulin sensitivity of cells, reduces proteinuria in a Heymann nephritis model and results in increased nephrin expression.

The expression of nephrin in the body is controversial. It is agreed that within the kidney, it is exclusively located in the podocyte; however, its extra-renal distribution is contentious. Some groups suggest that it is only expressed in the podocyte (33), while others have described it in the brain (34) and testes (35) and within the β-cells (34) and endothelium (36) of the pancreas. Intriguingly, in relation to the role of nephrin in insulin sensitivity of other tissues, a homolog of nephrin called Hibris has been found in muscle in Drosophila (37), which is important in myoblast fusion. If such a homolog is present in human muscle, then the action of nephrin could have implications for the insulin sensitivity of muscle, which is the main tissue responsible for insulin-stimulated glucose deposition after a meal (38) and the major tissue responsible for the development of type 2 diabetes.

We have observed the lack of insulin sensitivity (see above) in two different nephrin mutant podocyte cell lines, one with a complete truncation of nephrin (FM) and another with a missense mutation (NM), resulting in a failure of nephrin protein to traffic to the plasma membrane of the podocyte. This suggests not only the quantity but the location of nephrin (at the plasma membrane) is important for its effect on insulin's action. We have gone on to knock nephrin down in WT podocytes (which abrogates the effect of insulin) and, most powerfully of all, rescue the insulin-responsive phenotype by stably reconstituting nephrin back (in both quantity and location) into the nephrin-deficient FM cells. This demonstrates in vitro the importance of nephrin in insulin-stimulated glucose uptake in podocytes. This observation suggests in vivo that insulin-stimulated glucose uptake occurs predominantly in the foot process of the podocyte where nephrin is located (39). Podocytes are unique, highly specialized cells that depend on their foot processes to maintain the filtration barrier in the glomerulus, which is the main function of this cell. Being able to absorb glucose in response to insulin would intuitively seem beneficial, as soon after a meal it would facilitate glucose entry into this part of the cell. The absorbed glucose would be an easily metabolized energy source to remodel the actin cytoskeleton in preparation for the increased glomerular filtration load the meal would produce. A similar adaptive process for cellular remodelling occurs in cardiac and skeletal muscle where glucose is absorbed in response to contractility (40).

Using a yeast 2 hybrid screen, we identified VAMP2 as an interactor with nephrin and went on to show that this occurs at the protein level in vitro using MDCK cells and ex vivo in human glomerular specimens. Target SNAREproteins form complexes with proteins found on the vesicles (vesicular SNARES) (41). VAMP2 is an important vesicular SNARE that is involved in the targeting and docking of vesicles with cognate target SNARES in cells. It is predominantly involved in the docking of neurotransmitter secretary vesicles in neurones and insulin-responsive GLUT4-rich vesicles in muscle and adipocytes (42). We presume that nephrin is acting as a modifying protein in this SNARE complex in the podocyte. It is unlikely a target SNARE, as its predicted crystal structure is not helical, which is required for SNARE proteins (43). Podocytes have a number of similarities with neurones (44) that extensively use SNARE complexes for inside out signaling of neurotransmitters. This supposition is supported by the recent reports that podocytes contain neurone-like synaptic vesicles and express molecules such as Rab3a (45), synaptotagmin 1, synapsion 1, synaptophysin (46), and synaptic vesicle 2b (47). In neurones, there are similar nephrin-like immunoglobulin superfamily-like adhesion molecules (48) that are important in the targeting and docking of vesicles (49), supporting our findings.

Finally, we have shown that nephrin is important in the insulin-stimulated fusion of GLUT4 and GLUT1 to the plasma membrane of the cell. This may be through the interaction of the COOH-terminus of nephrin with VAMP2; however, this has not been shown to be the case for GLUT1 in adipocytes (50). Alternatively, nephrin may have its effect on the fusion of GLUT1 and/or GLUT4 through its involvement in signaling pathways; it is known to signal through Phosphoinositide 3-OH Kinase (17) and Mitogen-Activated Protein Kinase (18), both of which are involved in insulin signaling in other cells. Another possibility is that it is nephrin's interaction with the actin cytoskeleton (21,22) that is required to translocate glucose transporters to the plasma membrane of the cell.

In conclusion, we have shown a previously unsuspected role for nephrin in the insulin-sensitivity pathway in podocytes and its role in the docking of GLUT-rich vesicles with the plasma membrane of the cell. Understanding the molecular basis of the effect of insulin on the podocyte, we hope, will lead to the development of novel treatment strategies for the leading causes of albuminuria and ESRF in the world—diabetes and the hyperinsulinemic metabolic syndrome.

NOTE ADDED IN PROOF

Recently, phospholipase C-ε gene (PLCEI) mutations have been shown to cause early-onset nephrotic syndromes. PLCEI is predominantly expressed in the podocyte in the glomerulus.

FIG. 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIG. 1.

Nephrin expression in NM mutant podocytes. A: IF of WT and NM podocytes. Both were thermoswitched for 14 days with the same antibody concentrations and incubation time. WT shows peripheral staining (arrowed). In NM, nephrin is located within the cytoplasm. B: NM quantitatively shows nephrin expression as demonstrated by Western blot. Single band corresponds with positive control from human glomeruli. Western blot and IF were performed with mouse monoclonal antibody 50A9.

FIG. 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIG. 2.

Insulin-stimulated 2-DOG uptake in human nephrin mutant podocyte cell lines. 2-DOG uptake in WT and NM and FM immortalized podocytes. Basal wells (−) were compared with 15 min of stimulation with 100 nmol/l insulin (+). Seven to 14 independent experiments were performed for each condition (SEM shown). Significant difference between groups, P < 0.001 (ANOVA). Post hoc Bonferroni reveals a significant increase in WT insulin response (*) compared with either nephrin mutant cell lines (FM or NM); P < 0.01.

FIG. 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIG. 3.

Nephrin knockdown and glucose uptake in WT human podocytes. A: Densitometry of three independent experiments showing the nephrin/actin ratio between vehicle, nephrin, and scramble siRNA. Nephrin knockdown results in a 62% reduction in nephrin/actin signal (SEM shown, analyzed using ANOVA). Significant difference between groups, P < 0.05. Post hoc Bonferroni analysis; *P < 0.05 vs. vehicle. B: 2-DOG uptake in WT podocytes with nephrin-specific siRNA (nephrin siRNA), scrambled siRNA (scram siRNA), and vehicle-only treated podocytes (veh); five to seven independent experiments for each condition. SEM shown. ANOVA, P = 0.01 for all groups. Post hoc Bonferroni analysis with significant decrease in nephrin siRNA-treated cells (*). P < 0.05 in comparison to WT podocytes. No significant difference in scramble siRNA-treated cells. In this set of experiments, vehicle alone resulted in an insulin-stimulated increased glucose uptake of 59% compared with 105% seen in previous work (12).

FIG. 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIG. 4.

A: Stable nephrin transfection in FM podocytes. Nephrin IF using monoclonal antibody 48E11 (i). Peripheral nephrin staining (indicated by arrow) shown in FMnt. Mouse monoclonal isotype control and FM show minimal staining for this antibody. Western blot for nephrin (ii). Monoclonal 50A9 antibody used signal in human glomerular positive control and FMnt lanes. FM lane negative for nephrin. Equal amounts of protein were loaded for each (90 μg). B: 2-DOG uptake in nephrin-transfected FM podocytes. 2-DOG uptake after 15 min of 100 nmol/l insulin (+) stimulation or in basal state (−). Comparison of nephrin-transfected FMnt cells and nontransfected FM cells. Significant increase in glucose uptake in response to insulin in FMnt cells. **P < 0.001 using a paired two-tailed Student's t test; n ≥6 experiments for each condition studied.

FIG. 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIG. 5.

A: Nephrin enables GLUT1 and GLUT4 to translocate and fuse with the plasma membrane of the podocyte. GLUT1 bis-glucose demonstrated that in FMnt cells, GLUT1 was present at the plasma membrane of the podocyte and was also increased with a 15-min treatment of 100 nmol/l insulin. FM demonstrated no GLUT1 signal, despite more protein being precipitated with streptavadin in the FM preparation (288 μg) compared with FMnt cells (166.5 μg). B: Nephrin enables GLUT1 and GLUT4 to translocate and fuse with the plasma membrane of the podocyte. IF for GLUT4 using the 1F8 antibody in insulin-treated cells (100 nmol/l for 15 min) showed that in the nephrin mutant cells (NM and FM), vesicular GLUT4 vesicles were present in a subplasma membrane location (arrowed) after insulin stimulation, but in WT and FMnt cells, GLUT4 signal appeared to be fused with the plasma membrane (*).

FIG. 6.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIG. 6.

A: Glutathionine precipitation of the COOH of nephrin with VAMP2. Glutathione precipitation of pEGFP-VAMP2 by pcDNA-GST-COOH nephrin (NPHN) (lane 1) and pEGFP-VAMP2 by pcDNA-GST (lane 3) using glutathione-Sepharose beads (Amersham/Pharmacia). Precipitated samples were subjected to SDS-PAGE and then immunoblotted with GFP antibody (Vector Labs). No band was detected in lane 3, which indicates that no precipitation occurred between pcDNA-GST alone and pEGFP-VAMP2. Conversely, a band of 46 kDa is detected by the GFP antibody in lane 1. This verifies the presence and therefore successful precipitation of pEGFP-VAMP2 by nephrin. Lane 2 demonstrates 10% input. B: Glutathione precipitation of pEGFP-VAMP2 by pcDNA-GST-NPHN (1057–1241) (lane 1) and pEGFP-VAMP2 by pcDNA-GST (empty) (lane 3) subsequently immunoblotted with GST antibody (Clontech; BD Biosciences) to confirm presence of GST-tagged reagents. The detection of bands of 26 kDa, corresponding to the size of pcDNA-GST (empty) (lane 3), and of 42kDa, corresponding to the size of pcDNA-GST-NPHN (lane 1), verifies the presence of pcDNA-GST alone and pcDNA-GST-NPHN within the precipitation. Lane 2 shows 10% input.

FIG. 7.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIG. 7.

Nephrin–VAMP2 coimmunoprecipitation in human glomeruli. A: VAMP2 immunoprecipitation with monoclonal mouse anti-VAMP2 antibody and probing of Western blot with anti-nephrin rabbit antibody. A negative control of normal mouse antibody (Sigma) was used for pull-down in lane 1. Positive glomerular whole cell lysate in lane 4. Lane 2 is insulin-stimulated glomeruli, which gave increased signal compared with basal glomeruli (lane 3). Equal amounts of protein were immunoprecipitated in lanes 1–3 (750 μg) B: Nephrin pull-down of human glomeruli followed by VAMP2 Western blot. The Profound system was used for this (research design and methods). Whole glomerular lysate positive control (lane 2) and normal rabbit immunoglobulin negative control (lane 1) are shown. Equal amounts of antibody were used for immunoprecipitation (100 μg) and equal amounts of glomeruli were immunoprecipitated (700 μg). Pull-down of nephrin–VAMP2 complex is shown by probing the blot with anti-VAMP2 antibody (bottom panel). Then blot was stripped and reprobed for nephrin (top panel). Nephrin IP results in pull-down of VAMP2 (lane 3).

Acknowledgments

We would like to thank Professor Geoff Holman (Bath University) for his help in the bis-glucose experiments and Dr. Tony Clark (Bristol University) for prediction analysis of the three-dimensional structure of nephrin.

R.J.M.C. has been supported by Wellchild, the Royal College of Pediatrics and Child Health, the British Medical Association, and Novartis. He is now funded by the Medical Research Council. J.T. and G.I.W. are supported by the Medical Research Council. A.K. is supported by the Wellcome Trust.

Footnotes

  • P.W.M. and M.A.S. contributed equally to this work.

  • The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

    • Accepted December 21, 2006.
    • Received May 19, 2006.
  • DIABETES

REFERENCES

  1. ↵
    Kestila M, Lenkkeri U, Mannikko M, Lamerdin J, McCready P, Putaala H, Ruotsalainen V, Morita T, Nissinen M, Herva R, Kashtan CE, Peltonen L, Holmberg C, Olsen A, Tryggvasa K: Positionally cloned gene for a novel glomerular protein—nephrin—is mutated in congenital nephrotic syndrome. Mol Cell 1 : 575 –582,1998
    OpenUrlCrossRefPubMedWeb of Science
  2. Boute N, Gribouval O, Roselli S, Benessy F, Lee H, Fuchshuber A, Dahan K, Gubler MC, Niaudet P, Antignac C: NPHS2, encoding the glomerular protein podocin, is mutated in autosomal recessive steroid-resistant nephrotic syndrome. Nat Genet 24 : 349 –354,2000
    OpenUrlCrossRefPubMedWeb of Science
  3. ↵
    Kaplan JM, Kim SH, North KN, Rennke H, Correia LA, Tong HQ, Mathis BJ, Rodriguez-Perez JC, Allen PG, Beggs AH, Pollak MR: Mutations in ACTN4, encoding alpha-actinin-4, cause familial focal segmental glomerulosclerosis. Nat Genet 24 : 251 –256,2000
    OpenUrlCrossRefPubMedWeb of Science
  4. ↵
    Zenker M, Aigner T, Wendler O, Tralau T, Muntefering H, Fenski R, Pitz S, Schumacher V, Royer-Pokora B, Wuhl E, Cochat P, Bouvier R, Kraus C, Mark K, Madlon H, Dotsch J, Rascher W, Maruniak-Chudek I, Lennert T, Neumann LM, Reis A: Human laminin beta2 deficiency causes congenital nephrosis with mesangial sclerosis and distinct eye abnormalities. Hum Mol Genet 13 : 2625 –2632,2004
    OpenUrlAbstract/FREE Full Text
  5. ↵
    Winn MP, Conlon PJ, Lynn KL, Farrington MK, Creazzo T, Hawkins AF, Daskalakis N, Kwan SY, Ebersviller S, Burchette JL, Pericak-Vance MA, Howell DN, Vance JM, Rosenberg PB:.A mutation in the TRPC6 cation channel causes familial focal segmental glomerulosclerosis. Science 308 : 1801 –1804,2005
    OpenUrlAbstract/FREE Full Text
  6. ↵
    Reiser J, Polu KR, Moller CC, Kenlan P, Altintas MM, Wei C, Faul C, Herbert S, Villegas I, Avila-Casado C, et al: TRPC6 is a glomerular slit diaphragm-associated channel required for normal renal function. Nat Genet 37 : 739 –744,2005
    OpenUrlCrossRefPubMedWeb of Science
  7. ↵
    Ruggenenti P, Schieppati A, Remuzzi G: Progression, remission, regression of chronic renal diseases. Lancet 357 : 1601 –1608,2001
    OpenUrlCrossRefPubMedWeb of Science
  8. ↵
    Amos AF, McCarty DJ, Zimmet P: The rising global burden of diabetes and its complications: estimates and projections to the year 2010. Diabet Med 14 (Suppl. 5) : S1 –S85,1997
    OpenUrl
  9. ↵
    Ritz E, Rychlik I, Locatelli F, Halimi S: End-stage renal failure in type 2 diabetes: a medical catastrophe of worldwide dimensions. Am J Kidney Dis 34 : 795 –808,1999
    OpenUrlCrossRefPubMedWeb of Science
  10. ↵
    Kuusisto J, Mykkanen L, Pyorala K, Laakso M: Hyperinsulinemic microalbuminuria: a new risk indicator for coronary heart disease. Circulation 91 : 831 –837,1995
    OpenUrlAbstract/FREE Full Text
  11. ↵
    Wolf G, Chen S, Ziyadeh FN: From the periphery of the glomerular capillary wall toward the center of disease: podocyte injury comes of age in diabetic nephropathy. Diabetes 54 : 1626 –1634,2005
    OpenUrlAbstract/FREE Full Text
  12. ↵
    Coward RJ, Welsh GI, Yang J, Tasman C, Lennon R, Koziell A, Satchell S, Holman GD, Kerjaschki D, Tavaré JM, Mathieson PW, Saleem MA: The human glomerular podocyte is a novel target for insulin action. Diabetes 54 : 3095 –3102,2005
    OpenUrlAbstract/FREE Full Text
  13. ↵
    Shepherd PR, Kahn BB: Glucose transporters and insulin action: implications for insulin resistance and diabetes mellitus. N Engl J Med 341 : 248 –257,1999
    OpenUrlCrossRefPubMedWeb of Science
  14. ↵
    Satchell SC, Tasman CH, Singh A, Ni L, Geelen J, von Ruhland CJ, O'Hare MJ, Saleem MA, van den Heuvel LP, Mathieson PW: Conditionally immortalized human glomerular endothelial cells expressing fenestrations in response to VEGF. Kidney Int 69 : 1633 –1640,2006
    OpenUrlCrossRefPubMedWeb of Science
  15. ↵
    Koziell A, Grech V, Hussain S, Lee G, Lenkkeri U, Tryggvason K, Scambler P: Genotype/phenotype correlations of NPHS1 and NPHS2 mutations in nephrotic syndrome advocate a functional inter-relationship in glomerular filtration. Hum Mol Genet 11 : 379 –388,2002
    OpenUrlAbstract/FREE Full Text
  16. ↵
    Wartiovaara J, Ofverstedt LG, Khoshnoodi J, Zhang J, Makela E, Sandin S, Ruotsalainen V, Cheng RH, Jalanko H, Skoglund U, Tryggvason K: Nephrin strands contribute to a porous slit diaphragm scaffold as revealed by electron tomography. J Clin Invest 114 : 1475 –1483,2004
    OpenUrlCrossRefPubMedWeb of Science
  17. ↵
    Huber TB, Hartleben B, Kim J, Schmidts M, Schermer B, Keil A, Egger L, Lecha RL, Borner C, Pavenstadt H, Shaw AS, Walz G, Benzing T: Nephrin and CD2AP associate with phosphoinositide 3-OH kinase and stimulate AKT-dependent signaling. Mol Cell Biol 23 : 4917 –4928,2003
    OpenUrlAbstract/FREE Full Text
  18. ↵
    Huber TB, Kottgen M, Schilling B, Walz G, Benzing T: Interaction with podocin facilitates nephrin signaling. J Biol Chem 276 : 41543 –41546,2001
    OpenUrlAbstract/FREE Full Text
  19. Lahdenpera J, Kilpelainen P, Liu XL, Pikkarainen T, Reponen P, Ruotsalainen V, Tryggvason K: Clustering-induced tyrosine phosphorylation of nephrin by Src family kinases. Kidney Int 64 : 404 –413,2003
    OpenUrlCrossRefPubMedWeb of Science
  20. ↵
    Verma R, Wharram B, Kovari I, Kunkel R, Nihalani D, Wary KK, Wiggins RC, Killen P, Holzman LB: Fyn binds to and phosphorylates the kidney slit diaphragm component Nephrin. J Biol Chem 278 : 20716 –20723,2003
    OpenUrlAbstract/FREE Full Text
  21. ↵
    Jones N, Blasutig IM, Eremina V, Ruston JM, Bladt F, Li H, Huang H, Larose L, Li SS, Takano T, et al: Nck adaptor proteins link nephrin to the actin cytoskeleton of kidney podocytes. Nature 440 : 818 –823,2006
    OpenUrlCrossRefPubMed
  22. ↵
    Verma R, Kovari I, Soofi A, Nihalani D, Patrie K, Holzman LB: Nephrin ectodomain engagement results in Src kinase activation, nephrin phosphorylation, Nck recruitment, and actin polymerization. J Clin Invest Epub March 16,2006
  23. ↵
    Saleem MA, O'Hare MJ, Reiser J, Coward RJ, Inward CD, Farren T, Xing CY, Ni L, Mathieson PW, Mundel P: A conditionally immortalized human podocyte cell line demonstrating nephrin and podocin expression. J Am Soc Nephrol 13 : 630 –638,2002
    OpenUrlAbstract/FREE Full Text
  24. ↵
    O'Hare MJ, Bond J, Clarke C, Takeuchi Y, Atherton AJ, Berry C, Moody J, Silver AR, Davies DC, Alsop AE, Neville AM, Jat PS: Conditional immortalization of freshly isolated human mammary fibroblasts and endothelial cells. Proc Natl Acad Sci U S A 98 : 646 –651,2001
    OpenUrlAbstract/FREE Full Text
  25. ↵
    Coward RJ, Foster RR, Patton D, Ni L, Lennon R, Bates DO, Harper SJ, Mathieson PW, Saleem MA: Nephrotic plasma aters slit diaphragm-dependent signaling and translocates nephrin, podocin, and CD2 associated protein in cultured human podocytes. J Am Soc Nephrol 16 : 629 –637,2005
    OpenUrlAbstract/FREE Full Text
  26. Doublier S, Ruotsalainen V, Salvidio G, Lupia E, Biancone L, Conaldi PG, Reponen P, Tryggvason K, Camussi G: Nephrin redistribution on podocytes is a potential mechanism for proteinuria in patients with primary acquired nephrotic syndrome. Am J Pathol 158 : 1723 –1731,2001
    OpenUrlCrossRefPubMedWeb of Science
  27. ↵
    Koop K, Eikmans M, Baelde HJ, Kawachi H, De Heer E, Paul LC, Bruijn JA: Expression of podocyte-associated molecules in acquired human kidney diseases. J Am Soc Nephrol 14 : 2063 –2071,2003
    OpenUrlAbstract/FREE Full Text
  28. ↵
    Bonnet F, Cooper ME, Kawachi H, Allen TJ, Boner G, Cao Z: Irbesartan normalises the deficiency in glomerular nephrin expression in a model of diabetes and hypertension. Diabetologia 44 : 874 –877,2001
    OpenUrlCrossRefPubMedWeb of Science
  29. Doublier S, Salvidio G, Lupia E, Ruotsalainen V, Verzola D, Deferrari G, Camussi G: Nephrin expression is reduced in human diabetic nephropathy: evidence for a distinct role for glycated albumin and angiotensin II. Diabetes 52 : 1023 –1030,2003
    OpenUrlAbstract/FREE Full Text
  30. ↵
    Davis BJ, Cao Z, de Gasparo M, Kawachi H, Cooper ME, Allen TJ: Disparate effects of angiotensin II antagonists and calcium channel blockers on albuminuria in experimental diabetes and hypertension: potential role of nephrin. J Hypertens 21 : 209 –216,2003
    OpenUrlCrossRefPubMedWeb of Science
  31. ↵
    Benigni A, Gagliardini E, Tomasoni S, Abbate M, Ruggenenti P, Kalluri R, Remuzzi G: Selective impairment of gene expression and assembly of nephrin in human diabetic nephropathy. Kidney Int 65 : 2193 –2200,2004
    OpenUrlCrossRefPubMedWeb of Science
  32. ↵
    Benigni A, Zoja C, Tomasoni S, Campana M, Corna D, Zanchi C, Gagliardini E, Garofano E, Rottoli D, Ito T, Remuzzi G: Transcriptional regulation of nephrin gene by peroxisome proliferator-activated receptor-{gamma} agonist: molecular mechanism of the antiproteinuric effect of pioglitazone. J Am Soc Nephrol 17 : 1624 –1632,2006
    OpenUrlAbstract/FREE Full Text
  33. ↵
    Kuusniemi AM, Kestila M, Patrakka J, Lahdenkari AT, Ruotsalainen V, Holmberg C, Karikoski R, Salonen R, Tryggvason K, Jalanko H: Tissue expression of nephrin in human and pig. Pediatr Res 55 : 774 –781,2004
    OpenUrlCrossRefPubMedWeb of Science
  34. ↵
    Putaala H, Soininen R, Kilpelainen P, Wartiovaara J, Tryggvason K: The murine nephrin gene is specifically expressed in kidney, brain and pancreas: inactivation of the gene leads to massive proteinuria and neonatal death. Hum Mol Genet 10 : 1 –8,2001
    OpenUrlAbstract/FREE Full Text
  35. ↵
    Liu L, Aya K, Tanaka H, Shimizu J, Ito S, Seino Y: Nephrin is an important component of the barrier system in the testis. Acta Med Okayama 55 : 161 –165,2001
    OpenUrlPubMedWeb of Science
  36. ↵
    Zanone MM, Favaro E, Doublier S, Lozanoska-Ochser B, Deregibus MC, Greening J, Huang GC, Klein N, Cavallo Perin P, Peakman M, et al: Expression of nephrin by human pancreatic islet endothelial cells. Diabetologia 48 : 1789 –1797,2005
    OpenUrlCrossRefPubMedWeb of Science
  37. ↵
    Dworak HA, Charles MA, Pellerano LB, Sink H: Characterization of Drosophila hibris, a gene related to human nephrin. Development 128 : 4265 –4276,2001
    OpenUrlAbstract/FREE Full Text
  38. ↵
    DeFronzo RA, Jacot E, Jequier E, Maeder E, Wahren J, Felber JP: The effect of insulin on the disposal of intravenous glucose: results from indirect calorimetry and hepatic and femoral venous catheterization. Diabetes 30 : 1000 –1007,1981
    OpenUrlAbstract/FREE Full Text
  39. ↵
    Holthofer H, Ahola H, Solin ML, Wang S, Palmen T, Luimula P, Miettinen A, Kerjaschki D: Nephrin localizes at the podocyte filtration slit area and is characteristically spliced in the human kidney. Am J Pathol 155 : 1681 –1687,1999
    OpenUrlPubMedWeb of Science
  40. ↵
    Yang J, Holman GD: Insulin and contraction stimulate exocytosis, but increased AMP-activated protein kinase activity resulting from oxidative metabolism stress slows endocytosis of GLUT4 in cardiomyocytes. J Biol Chem 280 : 4070 –4078,2005
    OpenUrlAbstract/FREE Full Text
  41. ↵
    Chen YA, Scheller RH: SNARE-mediated membrane fusion. Nat Rev Mol Cell Biol 2 : 98 –106,2001
    OpenUrlCrossRefPubMedWeb of Science
  42. ↵
    Rossetto O, Gorza L, Schiavo G, Schiavo N, Scheller RH, Montecucco C: VAMP/synaptobrevin isoforms 1 and 2 are widely and differentially expressed in nonneuronal tissues. J Cell Biol 132 : 167 –179,1996
    OpenUrlAbstract/FREE Full Text
  43. ↵
    Sutton RB, Fasshauer D, Jahn R, Brunger AT: Crystal structure of a SNARE complex involved in synaptic exocytosis at 2.4: a resolution. Nature 395 : 347 –353,1998
    OpenUrlCrossRefPubMedWeb of Science
  44. ↵
    Pavenstadt H, Kriz W, Kretzler M: Cell biology of the glomerular podocyte. Physiol Rev 83 : 253 –307,2003
    OpenUrlAbstract/FREE Full Text
  45. ↵
    Rastaldi MP, Armelloni S, Berra S, Li M, Pesaresi M, Poczewski H, Langer B, Kerjaschki D, Henger A, Blattner SM, Kretzler M, Wanke R, D'Amico G: Glomerular podocytes possess the synaptic vesicle molecule Rab3A and its specific effector rabphilin-3a. Am J Pathol 163 : 889 –899,2003
    OpenUrlCrossRefPubMedWeb of Science
  46. ↵
    Rastaldi MP, Armelloni S, Berra S, Calvaresi N, Corbelli A, Giardino LA, Li M, Wang GQ, Fornasieri A, Villa A, et al: Glomerular podocytes contain neuron-like functional synaptic vesicles. Faseb J Epub Apr 3,2006
  47. ↵
    Miyauchi N, Saito A, Karasawa T, Harita Y, Suzuki K, Koike H, Han GD, Shimizu F, Kawachi H: Synaptic vesicle protein 2B is expressed in podocyte, and its expression is altered in proteinuric glomeruli. J Am Soc Nephrol 17 : 2748 –2759,2006
    OpenUrlAbstract/FREE Full Text
  48. ↵
    Yamagata M, Sanes JR, Weiner JA: Synaptic adhesion molecules. Curr Opin Cell Biol 15 : 621 –632,2003
    OpenUrlCrossRefPubMedWeb of Science
  49. ↵
    Benson DL, Colman DR, Huntley GW: Molecules, maps and synapse specificity. Nat Rev Neurosci 2 : 899 –909,2001
    OpenUrlCrossRefPubMedWeb of Science
  50. ↵
    Rea S, Martin LB, McIntosh S, Macaulay SL, Ramsdale T, Baldini G, James DE: Syndet, an adipocyte target SNARE involved in the insulin-induced translocation of GLUT4 to the cell surface. J Biol Chem 273 : 18784 –18792,1998
    OpenUrlAbstract/FREE Full Text
View Abstract
PreviousNext
Back to top

In this Issue

April 2007, 56(4)
  • Table of Contents
  • Index by Author
Sign up to receive current issue alerts
View Selected Citations (0)
Print
Download PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for your interest in spreading the word about Diabetes.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Nephrin Is Critical for the Action of Insulin on Human Glomerular Podocytes
(Your Name) has forwarded a page to you from Diabetes
(Your Name) thought you would like to see this page from the Diabetes web site.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Citation Tools
Nephrin Is Critical for the Action of Insulin on Human Glomerular Podocytes
Richard J.M. Coward, Gavin I. Welsh, Ania Koziell, Sagair Hussain, Rachel Lennon, Lan Ni, Jeremy M. Tavaré, Peter W. Mathieson, Moin A. Saleem
Diabetes Apr 2007, 56 (4) 1127-1135; DOI: 10.2337/db06-0693

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Add to Selected Citations
Share

Nephrin Is Critical for the Action of Insulin on Human Glomerular Podocytes
Richard J.M. Coward, Gavin I. Welsh, Ania Koziell, Sagair Hussain, Rachel Lennon, Lan Ni, Jeremy M. Tavaré, Peter W. Mathieson, Moin A. Saleem
Diabetes Apr 2007, 56 (4) 1127-1135; DOI: 10.2337/db06-0693
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • RESEARCH DESIGN AND METHODS
    • RESULTS
    • DISCUSSION
    • NOTE ADDED IN PROOF
    • Acknowledgments
    • Footnotes
    • REFERENCES
  • Figures & Tables
  • Info & Metrics
  • PDF

Related Articles

Cited By...

More in this TOC Section

  • circRNA_010383 Acts as a Sponge for miR-135a, and Its Downregulated Expression Contributes to Renal Fibrosis in Diabetic Nephropathy
  • CaM Kinase II-δ Is Required for Diabetic Hyperglycemia and Retinopathy but Not Nephropathy
  • Connectivity Mapping Identifies BI-2536 as a Potential Drug to Treat Diabetic Kidney Disease
Show more Complications

Similar Articles

Navigate

  • Current Issue
  • Online Ahead of Print
  • Scientific Sessions Abstracts
  • Collections
  • Archives
  • Submit
  • Subscribe
  • Email Alerts
  • RSS Feeds

More Information

  • About the Journal
  • Instructions for Authors
  • Journal Policies
  • Reprints and Permissions
  • Advertising
  • Privacy Policy: ADA Journals
  • Copyright Notice/Public Access Policy
  • Contact Us

Other ADA Resources

  • Diabetes Care
  • Clinical Diabetes
  • Diabetes Spectrum
  • Scientific Sessions Abstracts
  • Standards of Medical Care in Diabetes
  • BMJ Open - Diabetes Research & Care
  • Professional Books
  • Diabetes Forecast

 

  • DiabetesJournals.org
  • Diabetes Core Update
  • ADA's DiabetesPro
  • ADA Member Directory
  • Diabetes.org

© 2021 by the American Diabetes Association. Diabetes Print ISSN: 0012-1797, Online ISSN: 1939-327X.