Intravitreal Triamcinolone Acetonide Inhibits Breakdown of the Blood-Retinal Barrier Through Differential Regulation of VEGF-A and Its Receptors in Early Diabetic Rat Retinas
Article Figures & Tables
Figures
- FIG. 1.
mRNA expression ratios for Vegf-a, Flk-1 and Flt-1. A: Sham-treated diabetic retina/sham-treated nondiabetic retina. B: IVTA-treated diabetic retina/sham-treated diabetic retina. C: IVTA-treated nondiabetic retina/sham-treated nondiabetic retina.
- FIG. 2.
Quantification analysis of VEGF-A, FLK-1, and FLT-1 distribution in the retina from different treatment groups. Number of positive cells for VEGF-A (A), FLK-1 (B), and FLT-1 (C) per millimeter (means ± SEM, n = 8). ***P < 0.001.
- FIG. 3.
Retinal thickness was measured on H&E-stained sections at the similar location. The micrograph shows representative samples from IVTA-treated nondiabetic retina (A), sham-treated nondiabetic retina (B), IVTA-treated diabetic retina (C), and sham-treated diabetic retina (D). The yellow bar in A demonstrates one measurement of retinal thickness. E: Table showing mean (± SEM) retinal thickness (*** P < 0.001). Original magnifications ×200. GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; RPE, retinal pigment epithelium layer; OS, inner and outer photoreceptor segment; CH, choroidal layer. To view a high-quality digital representation of this image, go to http://dx.doi.org/db07-0982.
- FIG. 4.
Immunohistochemical analysis of retinal albumin distribution. Albumin was detected (in red) within the vessels in sham-treated nondiabetic retinas (A). A similar pattern of albumin distribution was observed in IVTA-treated diabetic retina, but with slightly higher expression in extra vascular space (B). Diffuse extravascular albumin was observed in the inner nuclear, outer plexiform, and outer nuclear layers in sham-treated diabetic retina (C). Extravasated albumin (arrows in C) was marked green in panel A1, B1, and C1 (corresponding to panels A, B, and C) by IPP4.5. Intravascular albumin was excluded by the analysis (arrow heads in C1). D: Quantification of albumin distribution/leakage in the four treatment groups. Values were presented as IAU. Data are means ± SEM, n = 8; *** P < 0.001. Original magnifications ×400. To view a high-quality digital representation of this image, go to http://dx.doi.org/db07-0982.
Tables
- TABLE 1
Primers and product size for real-time RT-PCR
Target genes GenBank accession no. Forward primer Reverse primer Product size (bp) Gapdh NM_017008.3 5′- GAGCTGAATGGGAAGCTCAC-3′ 5′-AAAGGTGGAGGAGTGGGAGT-3′ 216 β-actin NM_031144.2 5′-AGCCATGTACGTAGCCATCC-3′ 5′- CTCTCAGCTGTGGTGGTGAA−3′ 228 Vegf-a NM_031836.1 5′-AGAAACCCAATGAAGTGGTG-3′ 5′- ACTCCAGGGCTTCATCATTG-3′ 177 Flt-1 NM_019306.1 5′- TCCCTCAGCCTACCATCAAG-3′ 5′- GAGAGTCAGCCACCACCAAT-3′ 207 Flk-1 NM_013062.1 5′-ACAGCATCACCAGCAGTCAG-3′ 5′- CCAAGAACTCCATGCCCTTA-3′ 168 The pairs of primers were designed according to rat gene sequences published in GenBank.
- TABLE 2
Results from BestKeeper descriptive statistical analysis showing variation in the capability potential (CP) values
Factor n GM (CP) AM (CP) Min (CP) Max (CP) SD (±CP) CV (%CP) Gapdh 32 19.75 19.88 16.06 16.50 1.66 8.35 β-actin 32 14.01 14.03 13.00 15.80 0.59 4.17 Housekeeping gene expressions were assessed on total RNA templates isolated from retinas. GM (CP), the geometric mean of CP; AM (CP), the arithmetic mean of CP; Min (CP) and Max (CP), the extreme values of CP; SD (±CP), the SD of the CP; CV (%CP), the coefficient of variance expressed as a percentage of the CP level.
- TABLE 3
Results from BestKeeper correlation analysis
BestKeeper vs. GAPDH β-actin r 0.909 0.815 P 0.001 0.003 Measures of correlation between the two candidate gene expressions and the Bestkeeper in an index computed from the best candidate genes.
In this Issue
