Inhibitory Effects of Leptin on Pancreatic α-Cell Function
Article Figures & Tables
Figures
- FIG. 1.
Expression of leptin receptors in the pancreatic α-cell. A: PCR analysis of ObR transcripts shows that multiple isoforms are expressed in αTC1-9 cells. The expression in the mouse hypothalamus (Hyp) and islets is also illustrated. B: The presence of ObRb was demonstrated in αTC1-9 cells and in mouse islets by Western blot as well. An antibody that recognizes the extracellular domain of all the isoforms was also tested (ObR). Two examples are shown for the αTC1-9 cells. C and D: The spatial localization of ObRb in αTC1-9 cells and in α-cells within mouse and human islets (green) was assayed by immunofluorecence and confocal microscopy. Glucagon staining is shown in red. As in B, we also used an antibody that recognizes all the isoforms (ObR). These results are representative of at least three different experiments for each condition. Scale bar: 20 μm. (A high-quality representation of this figure is available in the online issue.)
- FIG. 2.
Leptin induces membrane hyperpolarization and inhibition of electrical activity. A: Recording of membrane potential in whole-cell configuration in αTC1-9 cells. With 0.5 mmol/l glucose, characteristic action potentials originated from a membrane potential of −39.9 ± 0.2 mV (n = 8). The application of leptin (6.25 nmol/l) induced hyperpolarization (21.1 ± 1.1 mV) and suppression of electrical activity. Removal of leptin allowed for a depolarization and recovery of electrical activity. Lept, leptin. B: Expanded records from A of different significant instants (indicated by numbers). C: With 0.5 mmol/l glucose, an intense electrical activity was recorded in mouse α-cells. Leptin (6.25 nmol/l) hyperpolarized these cells from −37.3 ± 0.6 mV to −60.6 ± 0.4 mV (n = 3) and decreased electrical activity. Lept, leptin. D: Expanded records from C of different significant instants (indicated by numbers).
- FIG. 3.
Leptin inhibits Ca2+ signals induced by low glucose concentrations in αTC1-9 cells and mouse α-cells. Leptin (6.25 nmol/l) blocks or reduces the frequency of Ca2+ signals induced with 0.5 mmol/l glucose in αTC1-9 cells (A) and α-cells (B) (n = 13 and 16, respectively). Images show a culture of αTC1-9 cells (A) and an intact mouse islet (B) loaded with the Ca2+-sensitive probe Fluo-4. Islet images were acquired by confocal microscopy from an optical section close to the equatorial plane. Several individual cells were easily identified at the periphery of the islet (white arrows). C: Average frequency of Ca2+ oscillations with 0.5 mmol/l glucose (control) and in the presence of leptin. D: Effect of 0.625 nmol/l leptin in islet α-cells (n = 20; n = 52 for αTC1-9 cells, not shown). E: Frequency (%) of Ca2+ signals after stimuli compared with control conditions. F: Leptin inhibits Ca2+ signaling in isolated islet α-cells (n = 11). The effect of adrenaline, which is characteristic of this islet cell type (32), is also shown. Data in C and E are shown as means ± SE. *Statistically significant (P < 0.05) compared with control. Adren, adrenaline; G, glucose; Lept, leptin. Scale bar: 20 μm. (A high-quality representation of this figure is available in the online issue.)
- FIG. 4.
Leptin decreases Ca2+ signaling in human α-cells. The application of 6.25 nmol/l leptin (A) or 0.625 nmol/l (B and C) blocks or reduces the frequency of Ca2+ signals induced with 0.5 mmol/l glucose in human α-cells. D: Average frequency of Ca2+ oscillations in 0.5 mmol/l glucose (control) and in the presence of leptin at 6.25 and 0.625 nmol/l (n = 12 and 45, respectively). Data are shown as means ± SE. Statistically significant: *P < 0.05; **P < 0.01 vs. controls. G, glucose; Lept, leptin.
- FIG. 5.
Leptin does not affect Ca2+ signals in the presence of wortmannin. A: In the presence of the PI3K inhibitor wortmannin (20 nmol/l), leptin was unable to affect the intracellular Ca2+ oscillations induced with 0.5 mmol/l glucose in αTC1-9 cells (n = 8). B: Average frequency of Ca2+ signals with 0.5 mmol/l glucose (control) and leptin, both in the presence of wortmannin. Data in B and C are shown as means ± SE. G, glucose; Lept, leptin; ns, nonsignificant.
- FIG. 6.
Effect of leptin on glucagon secretion. A: Glucagon secretion from mouse islets with 10 mmol/l glucose or with 0.5 mmol/l glucose plus 0.625 nmol/l or 6.25 nmol/l leptin was compared with the control (0.5 mmol/l glucose). The effect of wortmannin (50 nmol/l) on glucagon release with 0.5 mmol/l glucose in the absence and presence of 6.25 nmol/l leptin is also displayed. Data are shown as means ± SE (n = 8–13). B: Changes in FM1-43 fluorescence (ΔF; arbitrary units) versus time in αTC1-9 cells in control conditions (0.5 mmol/l glucose) and in the presence of leptin (6.25 nmol/l). Inset: images illustrating a group of cells in transmitted light (A) and loaded with FM1-43 at the beginning (B) and at the end of the record (C). Scale bar: 10 μm. C: The average rate of fluorescence changes as a function of time (ΔF/min) indicates that leptin reduces the exocytotic response. This effect was counteracted by wortmannin (20 nmol/l). Data are shown as means ± SE (n = 32–45 for each condition). *P < 0.05; ***P < 0.001 vs. control. G, glucose; Lept, leptin. (A high-quality representation of this figure is available in the online issue.)
Tables
- TABLE 1
PCR primers for ObR isoforms and 18S
Name Sense primer (5′-3′) Antisense primer (5′-3′) ObRa AGGGCTGTATGTCATTGTACCCAT AGTTTAGGTTTGTTTCCCTCCATC ObRb ACAGTTCTGGCTGTCAATTCCC AGGAGCTGCTAGAAAGACTG ObRc ACAGTTCTGGCTGTCAATTCCC GAAAGGATGAACAGGCTTGAGAAC ObRd AGGGCTGTATGTCATTGTACCCAT CTTCATGTAAAGATATATCCTTTTCC ObRe AGGGCTGTATGTCATTGTACCCAT CCATGAAAAGTACAGTACACATACC 18S GGGAGGTAGTGACGAAAAATAAC AATCATGGCCTCAGTTCCGAAA
