High Tissue Glucose Alters Intersomitic Blood Vessels in Zebrafish via Methylglyoxal Targeting the VEGF Receptor Signaling Cascade

Diabetes is characterized by chronic hyperglycemia, either through insulin deficiency or insulin resistance (1). More than 30% of diabetic patients suffer from micro- and macrovascular complications that represent the leading causes of death worldwide (2). Although chronic hyperglycemia is favored as the principle causal factor of complications, even good glycemic control cannot reduce the risk of cardiovascular mortality and microvascular complications in type 2 diabetic patients (3). Importantly, 36% of newly diagnosed type 2 diabetic patients already suffer from clinically discernible retinopathy (4), and some studies indicate the presence of “diabetes” complications in patients without detectable hyperglycemia (5). Likewise, intensive glycemic control can only account for a minor proportion of therapeutic effects following myocardial infarction (6–9).

Formation of glucose metabolites—reactive dicarbonyls—can arise from several sources, including auto-oxidation of glucose, which leads to glyoxal formation, decomposition of amadori products (3-deoxyglucosone) and fragmentation of glycerinaldehyde-3-phosphate and dihydroxyacetone phosphate during glycolysis (methylglyoxal [MG]) (1). The most reactive dicarbonyl is MG, which can interact in several proteins with amino acid side chains of arginine, lysine, and cysteine and thereby induce several posttranslational protein modifications and subsequently alter function of those proteins (10). MG is detectable in healthy subjects, but it is constantly degraded by the glyoxalase (glo) system, which is expressed in the cytosol of all mammalian cells (11). The glo system is comprised of two enzymes, glo1 and glo2, and its cofactor glutathione. It catalyzes the conversion of MG to d-lactate via the intermediate S-D-lactoylglutathione (11).

MG is elevated in diabetic patients. In plasma of healthy people, MG concentrations of ∼100 nmol/L have been detected, whereas in diabetic patients, MG levels increase up to 700 nmol/L (12). A direct link between elevated MG concentrations and diabetes complications has now been identified for the development of metabolic hyperalgesia (13). In this recent study, MG levels above 600 nmol/L were identified as the critical threshold for pain in diabetic patients, and this is based on an increased sensitivity caused by a direct MG-induced posttranslational modification of the voltage-gated sodium channel Na_v1.8. The pathological consequences of increased MG concentrations in endothelial cells and for the development of cardiovascular diseases in diabetic patients are less clear. In vitro studies in immortalized human microvascular endothelial cell line 1, human umbilical vein endothelial cells, and mouse kidney endothelial cells showed that elevated concentrations of glucose increased internal MG levels and that MG directly targets vascular basement membrane type IV collagen (14), Hsp27 (15), and transcription factor mSin3A (16). In addition to endothelial cells, MG acts on smooth muscle cells, thereby increasing arterial atherogenicity (17), blood pressure (18), and salt-sensitive hypertension (19) and delaying wound healing in aged mice (20). Together, these data provide experimental evidence that MG contributes to the development of vascular cell dysfunction in vitro and to cardiovascular complications in vivo.

Zebrafish have been proven as an excellent model organism to study processes of vascular development and function, and several mechanisms characterized in zebrafish share similar functions in mammals. Besides yeast (21), Caenorhabditis elegans (22), and drosophila (23), zebrafish have evolved as a model organism for investigations of metabolic disorders (24), and hyperglycemia-induced pathologies in zebrafish are related to diabetic patients (25–27).

Since MG elicits alterations on cultured endothelial cells but its effect on blood vessels in vivo is less clear, this study was aimed at identifying early MG-induced pathological mechanisms on blood vessels in zebrafish. High glucose increases MG in tg(fli:EGFP) zebrafish embryos and subsequently alters intersomitic blood vessels (ISVs), which is mediated by an increased activation of vascular endothelial growth factor (VEGF) receptor 2 and Akt/protein kinase B (PKB). This demonstrates a role of MG in development of hyperglycemia-induced vascular damages and provides a new in vivo mechanism of early vascular damages induced by MG.

Inhibitors, antibodies, and reagents used included MG solution 40%, D-(+)-glucose, D-mannitol, Akt inhibitor XVIII SC66, p38MAP kinase inhibitor SB203580, PI3 kinase (PI3K) inhibitor LY294002, VEGF receptor 2 inhibitor PTK787/Vatalanib, and aminoguanidine (AMG), rabbit anti-VEGF receptor 2 (phospho Y1054 + Y1059) antibody, rabbit anti-VEGF receptor 2, goat antiactin (I-19), rabbit anti-Akt, mouse anti-pAkt (S473, 587F11), anti-glo1 (6F10), and horseradish peroxidase–conjugated antibodies rabbit anti-mouse, rabbit anti-rat, goat anti-rabbit, and rabbit anti-goat.

Embryos of AB wild-type, tg(fli:EGFP), and tg(nflk:EGFP) were raised and staged as described (28).

Approximately 80 fertilized eggs were incubated in a 10 cm petri dish with 20 mL solutions that were changed daily. Solutions contained egg water, glucose, or MG and 0.2% 1-phenyl-2-thiourea and inhibitors were diluted in DMSO.

Control morpholinos and glo1 were diluted to 3 µg/µL with 1.5 × p53 morpholino to attenuate possible off-target effects (29) in 0.1 mol/L KCl. hGlo1 or mOrange mRNA were diluted to 100 pg/nL in 0.1 mol/L KCl. One nanoliter of morpholino or mRNA was injected into the embryos at the one-cell stage. For intracardiac injection of MG, embryos were injected at 48 hpf with 1 nL control or MG solution into the heart and hyperbranches were analyzed at 96 hpf.

Morpholinos included SB-glo1-MO#1: 5′-CATGAAGTCCTACAGGAGACAAATT-3′ (targeting intron 1–exon 2 junction); SB-glo1-MO#2: 5′-GCCTACAAATAAAACATCCACACAT-3′ (targeting intron 2–exon 3 junction); SB-pdx1-Mo: 5′-GATAGTAATGCTCTTCCCGATTCAT-3′ (30); p53-MO: 5′-GCGCCATTGCTTTGCAAGAATTG-3′; control-MO: 5′-CCTCTTACCTCAGTTACAATTTATA-3′.

Synthesis of mRNA was performed using the T7 mMessage mMachine Kit following the protocol of the manufacturer using a plasmid coding human glo1 (kind gift of Dr. Michael Brownlee, Albert Einstein College of Medicine, Bronx, NY). Intracardiac injections at 48 hours post fertilization (hpf) were performed as recently described (31).

MG was determined by derivatization with 1,2-diamino-4,5-dimethoxybenzene followed by high-performance liquid chromatography of the quinoxaline adduct (32). Intracellular zebrafish glucose concentration was determined in deproteinated total extracts of whole zebrafish embryos using the Glucose (HK) Assay Kit according to the manufacturer’s instructions (33).

Zebrafish embryos were collected at 48 hpf, and Western blot was performed as described previously (31).

Whole RNA was isolated as recently described (31). Primers included glo1 forward (CCGCGTGTAAAGAGGGAAGCT) and glo1 reverse (GGCAGCATAGACATCCGGTACT). The following program was used to amplify PCR products: 95°C for 2 min (95°C for 30 s, 59°C for 45 s, 72°C for 30 s) × 35 and 72°C for 5 min.

For in vivo imaging, tg(fli:EGFP) or tg(nflk:EGFP) embryos were anesthetized with 0.003% tricaine and embedded in 1% low-melting-point agarose dissolved in egg water containing 0.003% tricaine and 0.2% 1-phenyl-2-thiourea. Confocal images were performed using a DMIRE2 confocal microscope with Leica TCS SP2 True Confocal Scanner and a DM6000 B confocal microscope with Leica TCS SP5 DS scanner. Images were taken with 400 Hz, 1,024 × 1,024 pixels, and z-stacks were recorded with 1 μm thickness.

For quantification of altered blood vessels, the first 14 ISV pairs of each zebrafish embryo were analyzed for hyperbranching blood vessels at 96 hpf. A minimum of 100 embryos per sample was analyzed. Results are given as mean number of hyperbranches per embryo ± SE. For evaluation of endothelial cell quantity, the number of endothelial cells was counted for six ISV pairs in tg(nflk:EGFP) at 48 and 96 hpf. Results are given as mean number of endothelial cells per 6 ISVs ± SE. Diameter of vessels is given as the average of measurements at three different positions in the embryo. Statistical significance between different groups was analyzed using Student t test or Mann-Whitney U test as indicated (SPSS 17.0). P values < 0.05 were considered significant.

In order to identify early consequences of elevated MG on blood vessels in vivo, we analyzed blood vessels in tg(fli:EGFP) zebrafish embryos in the presence of increased glucose or MG concentrations. To this end, tg(fli:EGFP) zebrafish embryos were cultured for 96 h starting at 1 hpf in the presence of 15, 30, or 55 mmol/L glucose solution. Formation and maintenance of blood vessels in zebrafish embryos were analyzed at 24, 48, 72, and 96 hpf. Likewise, tg(fli:EGFP) zebrafish embryos were incubated in 200 or 500 μmol/L MG solution and subsequently analyzed at the indicated time points. Incubation of zebrafish embryos with glucose or MG did not affect formation and function of major blood vessels, including the dorsal aorta (DA), the posterior cardinal vein (PCV), ISVs, the dorsal longitudinal anastomotic vessel (DLAV), and parachordal lymphangioblasts (PL), in up to 96 h of observation time (Fig. 1A and not shown). Likewise, vessel diameter of DA, PCV, ISV, and DLAV and heart beat including blood flow were unaltered within the different experimental groups (Supplementary Fig. 1 and Supplementary Movies 1–3). However, altered blood vessels in the presence of high tissue glucose or high tissue MG were observed starting at 72 hpf, originating out of ISVs. In addition to apparently normal formed ISVs, several additional malformed and uncoordinated blood vessel structures were observed developing out of ISVs but not from larger vessels, including the DA and PCV (Fig. 1A and B). Hyperbranching endothelial cells appeared as small vessel structures that formed from the upper part of ISVs, grew horizontally toward neighboring ISVs, and partially connected to these. Quantification of hyperbranches per zebrafish embryo at 96 hpf showed a dose-dependent, significant increase of hyperbranching endothelial cells in high tissue glucose or high tissue MG zebrafish embryos (Fig. 1B). Similar to high tissue glucose, MG induced the same vascular phenotype in tg(fli:EGFP) zebrafish embryos, but numbers and length of malformed and uncoordinated endothelial cells were less pronounced in high tissue glucose embryos as compared with high tissue MG zebrafish embryos (Fig. 1A and B). Incubation of tg(fli:EGFP) zebrafish embryos with glucose and MG together further increased number of hyperbranching blood vessels (Fig. 1A and B). Because glucose increases osmotic pressure in aqueous solutions, additional experiments in the presence of mannitol were performed. Yet mannitol did not affect blood vessels in tg(fli:EGFP) zebrafish embryos (Fig. 1B), indicating that glucose- or MG-induced alterations of blood vessels in zebrafish are not due to an increased osmotic pressure.

Based on the hypothesis that hyperglycemia mediates vascular complications via MG formation, we addressed the question of whether hyperglycemia increases MG in zebrafish embryos. Zebrafish embryos were incubated in the presence of different glucose or MG concentrations, and levels of tissue glucose and tissue MG in zebrafish embryos were analyzed. Glucose incubation with 15, 30, or 55 mmol/L glucose solution dose dependently increased internal zebrafish tissue glucose to 21, 23, and 32 nmol/mg protein, respectively (Supplementary Fig. 2). Likewise, glucose dose dependently increased MG in zebrafish embryos, leading to a threefold increase of MG in zebrafish embryos that were cultured in 30 mmol/L glucose solution reaching an internal tissue MG concentration of ∼1.5 nmol/mg protein (Fig. 1C). Thus high tissue glucose increased tissue MG concentrations in zebrafish. In addition, external MG rapidly increased MG in zebrafish embryos up to 5 nmol/mg protein, confirming this experimental approach as a useful strategy to increase MG in living zebrafish embryos and to analyze early MG-driven effects on blood vessels independently of high glucose. To finally confirm the early pathological consequences of MG on altered blood vessels in zebrafish, MG was directly injected into the vasculature of living zebrafish at 48 hpf, facilitating an intracardiac injection (31), and formation of blood vessels was analyzed at 96 hpf. Similar to high tissue MG experiments (Fig. 1A), intracardiac injection of MG induced altered blood vessels originating out of the ISVs (Fig. 1D). This indicated a direct and glucose-independent effect of MG on the vasculature in living zebrafish embryos. Next we addressed the question of whether expression silencing of glo1, which detoxifies cellular MG to d-lactate, leads to an enhanced formation of MG and eventually to altered blood vessels in zebrafish as it has been observed under high tissue glucose or high tissue MG (Fig. 1). To reduce glo1 expression in zebrafish, an antisense approach was performed using two splice-blocking morpholinos targeting zebrafish glo1 (Fig. 2). Both morpholinos were injected into the one-cell stage, and functionality of the splice-blocking morpholinos was validated by RT-PCR, showing decreased expression of wild-type glo1 but expression of morphant glo1 (Fig. 2C). Subsequently, formation of the vascular system in tg(fli:EGFP) zebrafish embryos up to 96 hpf was analyzed. Similar to high tissue glucose and high tissue MG experiments (Fig. 1), reduced expression of glo1 did not alter formation and function of major blood vessels (DA, PCV, DLAV, ISV, and PL) in the zebrafish trunk at 96 hpf. However, both morpholinos induced malformed and uncoordinated blood vessel structures that again originated out of ISVs (Fig. 2A). Quantification of hyperbranching blood vessels at 96 hpf revealed approximately three to four altered blood vessels per zebrafish embryo (Fig. 2B), which reflects the same number of altered blood vessels as was observed with an internal tissue glucose of 23 nmol/mg protein (Fig. 1B). Remarkably, reduction of glo1 expression in zebrafish embryos increased internal MG concentration by approximately twofold (Fig. 2D), which is similar to MG concentrations in high tissue glucose zebrafish (Fig. 1C). These data demonstrate that high tissue glucose or genetic reduction of glo1 expression both lead to similar elevated MG concentrations and subsequently to altered blood vessels in tg(fli:EGFP) zebrafish embryos. A similar vascular phenotype was also identified by using a genetic approach to induce hyperglycemia by interfering with pancreas development in zebrafish. Expression silencing of the transcription factor pdx1 in zebrafish (30) increased glucose threefold (Fig. 2E) and induced the same vascular phenotype (Fig. 2A [bottom] and F) as seen for glo1 loss-of-function experiments (Fig. 2A and B) and for elevated MG and glucose concentrations (Fig. 1A and B).

To finally prove that high tissue glucose–induced altered blood vessels in zebrafish are primarily caused by MG, the MG-degrading enzyme glo1 was overexpressed in zebrafish embryos by glo1 mRNA injection (Fig. 3A and B). The ability of glo1 to degrade MG should lead to decreased MG concentrations and prevent vessel alterations in zebrafish embryos. Indeed, glo1 overexpression significantly reduced glucose- or MG-induced altered blood vessel formation in zebrafish (Fig. 3A). In addition to the genetic glo1 overexpression experiments, we have also used AMG that attenuates MG-induced modification of proteins (34). To this end, tg(fli:EGFP) zebrafish embryos with high tissue glucose were analyzed in the presence of 10 or 20 μmol/L AMG that showed a dose-dependent reduction of altered blood vessels (Fig. 3C). Likewise, the number of altered blood vessels in tg(fli:EGFP) zebrafish glo1 morphants was significantly reduced in the presence of AMG (Fig. 3D). AMG itself prevented high glucose–induced MG formation in zebrafish (Fig. 3E) that confirmed AMG’s ability to reduce MG levels in a living organism. Taken together, the data show that high tissue glucose causes increased MG concentrations in zebrafish embryos and MG induces early alterations of blood vessels.

MG is a highly reactive dicarbonyl molecule that can induce posttranslational protein modifications. This has recently been shown for sodium channel Na_v1.8, which is associated with enhanced sensory neuron excitability and hyperalgesia in diabetic mice (13). Because of the fact that MG induces aberrant blood vessels in tg(fli:EGFP) zebrafish embryos (Figs. 1–3), we proved the working hypothesis that MG directly targets the VEGF signaling cascade in zebrafish that acts as the prime angiogenic pathway promoting physiological and pathophysiological angiogenesis (35). VEGF binds to VEGF receptor 2 and activates its intrinsic tyrosine kinase domain, leading to a rapid and strong autophosphorylation of VEGF receptor 2, activation of its downstream signaling pathways, and eventually blood vessel formation (36). Therefore, increased and permanent activation of the VEGF receptor signaling cascade could be the primary cause for hyperbranching blood vessels in high tissue glucose or high tissue MG zebrafish embryos. In order to analyze VEGF receptor 2 activation in high tissue MG, tg(fli:EGFP) zebrafish embryos were analyzed for VEGF receptor 2 phosphorylation at 48 hpf. This time point was chosen because an MG-induced biochemical activation of an angiogenic marker molecule will take ∼2 days to translate into a vascular phenotype. In control zebrafish embryos, VEGF receptor 2 is weakly phosphorylated. Yet in high tissue MG zebrafish, activation of VEGF receptor 2 is significantly enhanced (Fig. 4A and B). Next we analyzed activation of protein kinase Akt/PKB that acts downstream of VEGF receptor 2 and regulates endothelial cell migration and angiogenesis (36). Similar to VEGF receptor 2, Akt/PKB was weakly activated in control zebrafish embryos at 48 hpf (Fig. 4C and D). In contrast, in high tissue MG zebrafish embryos, Akt/PKB phosphorylation was increased, but expression of Akt/PKB was unaltered (Fig. 4C and D). Lastly we have addressed the question of whether increased Akt/PKB phosphorylation in high tissue MG zebrafish is due to an enhanced VEGF receptor 2 phosphorylation or whether Akt/PKB could be targeted by MG itself. To this end, high tissue MG zebrafish embryos were incubated at 46 hpf in the presence of the VEGF receptor 2 antagonist PTK787/Vatalanib, and phosphorylation of Akt/PKB was assessed at 48 hpf (Fig. 4E and F). Interestingly, Akt/PKB phosphorylation was significantly, but not completely, reduced. This suggests that MG-driven Akt/PKB phosphorylation in high tissue MG zebrafish is only partially caused by an enhanced upstream VEGF receptor 2 activation and may operate by other yet unknown mechanisms. Thus the data show that MG induced hyperactivation of the VEGF receptor signaling cascade that may lead to nonphysiological angiogenesis in high tissue MG zebrafish embryos. Therefore, MG-induced increase of the VEGF signaling cascade could be the primary cause for early morphological vascular abnormalities leading to several additional malformed and uncoordinated blood vessel structures in tg(fli:EGFP) zebrafish embryos. Interestingly, altered blood vessels were not formed because of an increase in endothelial cell proliferation in zebrafish embryos, as neither high tissue glucose nor high tissue MG increased the number of endothelial cells in 48 and 96 hpf tg(nflk:EGFP) zebrafish embryos (Supplementary Fig. 3A and B).

To finally prove the working hypothesis that MG alters activation of the VEGF signaling cascade leading to altered blood vessels in zebrafish, pharmacological inhibitors against VEGF receptor 2 and important downstream signaling molecules were used. At 48 hpf, when the major trunk vessel in zebrafish have already been formed (37) and where VEGF receptor 2 is strongly activated (Fig. 4A and B), a low dose (0.2 μmol/L) of VEGF receptor 2 antagonist PTK787/Vatalanib was added to tg(fli:EGFP) high tissue MG and high tissue glucose zebrafish embryos and, in this concentration, did not affect physiological blood vessel development in zebrafish (38). Subsequently, blood vessels in tg(fli:EGFP) zebrafish embryos were analyzed at 96 hpf. High tissue glucose or high tissue MG zebrafish embryos again showed hyperbranching blood vessels; yet the vascular phenotype was less pronounced, as seen in Figs. 1 and 3, which is very likely due to the cytotoxicity of the solvent DMSO (Figs. 5B and 6C and D). Similar experiments in the presence of PTK787 completely reverted altered blood vessel formation, and inhibitor-treated embryos were indistinguishable from control-treated animals (Fig. 5A and B). The same data were observed using 5 μmol/L LY294002 that blocks activation of PI3K acting as an essential downstream regulator of VEGF receptor 2 (36) (Fig. 6A and C). In addition, Akt/PKB that is strongly phosphorylated in zebrafish embryos in the presence of high tissue MG (Fig. 4C and D) and that is specifically blocked by 1 μmol/L SC66 prevented vascular alterations in high tissue MG as well as high tissue glucose tg(fli:EGFP) zebrafish embryos (Fig. 6B and D). Finally, pharmacological inhibition of p38MAP kinase, which is considered as a negative regulator of VEGF signaling (39,40), was performed in high tissue glucose or high tissue MG tg(fli:EGFP) zebrafish embryos. Incubation of zebrafish embryos with 50 μmol/L p38MAP kinase inhibitor SB203580 did not prevent vessel hyperbranching, but interestingly, SB203580 alone already induced additional, malformed, and uncoordinated blood vessel structures in control zebrafish embryos at 96 hpf (Supplementary Fig. 4).

In order to identify additional pathways that may transcriptionally regulate aberrant blood vessel formation, we have performed microarray analyses using 96-hpf-old zebrafish embryos that were kept in the presence of MG. Interestingly, we have not observed major transcriptional regulations of important angiogenic molecules (Supplementary Table 1). However, MG treatment interfered with metabolic pathways that are related to glucose metabolism (Supplementary Table 2).

Together the data show that high tissue glucose induced MG formation in tg(fli:EGFP) zebrafish embryos and that high tissue MG alone induced early vascular abnormalities in small blood vessels in the zebrafish trunk, which are caused by MG-driven activation of the VEGF receptor signaling cascade.

In this study, MG was identified as cause for early vascular alterations in zebrafish embryos based on the following observations: 1) MG accumulates in zebrafish under high tissue glucose as well as in glo1 loss-of-function experiments, 2) MG acts on endothelial cells in zebrafish and alters ISVs via increased phosphorylation of VEGF receptor 2 and Akt/PKB, and 3) MG-mediated pathological blood vessel formation in zebrafish is prevented by pharmacological inhibition of VEGF receptor 2 and Akt/PKB activation as well as by lowering internal MG concentrations (Fig. 7).

The data further advance the recently developed concept that hyperglycemia-induced formation of MG acts as an important cause for development of late-stage complications in diabetic patients (13). This study identified in zebrafish a new mechanistic link to how high tissue glucose–induced MG formation can initiate vascular complications in vertebrates. VEGF receptor 2 and protein kinase Akt/PKB were identified in vivo as MG targets that mediate altered and uncoordinated blood vessel function and nonphysiological angiogenesis in smaller but not in larger blood vessels. Importantly, MG induces vascular alterations in zebrafish independently of high tissue glucose, indicating that MG acts as a primary trigger for high glucose–induced vascular complications in this model. In contrast to diabetic rats, where VEGF receptor 2 protein is elevated (41), in this study, MG did not significantly regulate VEGF receptor 2 expression and expression of other angiogenic proteins (Fig. 4 and Supplementary Table 1), which further supports the concept that modifications of VEGF receptor 2 or Akt/PKB proteins by MG are the cause for altered blood vessels in the zebrafish embryos. One possible mechanism could be that MG directly modifies amino acids in the VEGF receptor 2 and Akt/PKB proteins. Such a direct, MG-induced posttranslational modification has recently been shown for Akt/PKB in smooth muscle cells, where MG directly modifies amino acid Cys77 of Akt/PKB, thereby leading to enhanced phosphorylation at Ser473 and Thr308 (42). Alternatively, enhanced activation of VEGF receptor 2 and Akt/PKB could be an indirect effect induced by altered function of pathways that regulate VEGF receptor 2 and Akt/PKB activation level.

In addition to the mechanistic data, the study also shows how MG acts on blood vessels in vivo. Several high glucose– and MG-driven effects on the vasculature were reported from cultured endothelial cells with controversial results (14,43,44). In this study, vascular alterations were only observed in a subset of blood vessels, namely, in ISVs, but not in larger blood vessels, including the DA and the PCV. This also shows in zebrafish a differential susceptibility and regulation of endothelial cell function and angiogenesis by high tissue MG. In this study, MG rapidly increases activation of VEGF receptor 2 and protein kinase Akt/PKB in zebrafish, leading to nonphysiological angiogenesis. In contrast to other rodent models that are usually used in experimental diabetic research and that need long periods of hyperglycemia to develop late-stage diabetes complications, zebrafish embryos already developed vascular complications within 4 days of high tissue glucose or high tissue MG. Thus the data highlight zebrafish as a model organism to analyze hyperglycemia and MG-induced pathological vascular alterations and its mechanisms.

In conclusion, the data identified a mechanism in zebrafish for how elevated MG concentrations alter small blood vessels via modifications of the VEGF receptor 2 signaling cascade. Because MG is increased under high tissue glucose but also induces vascular alterations alone, this study identified MG as an important contributor to high glucose–induced vascular alterations.

Acknowledgments. The authors thank Katrin Bennewitz (Centre for Biomedicine and Medical Technology Mannheim, Medical Faculty Mannheim, Heidelberg University and German Cancer Research Center [DKFZ-ZMBH Alliance]) and Maria Muciek (Medical Research Center, Medical Faculty Mannheim, Heidelberg University) for technical assistance.

Funding. This study was supported by Deutsche Forschungsgemeinschaft (SFB1118; projects A4, B1, C03, S01, SFB/TR23; project Z5, IRTG1874/1; projects SP6, SP9; IS67/5-1) and the Hopp Foundation. The authors acknowledge the support of the Core Facility Live Cell Imaging Mannheim at the Centre for Biomedicine and Medical Technology Mannheim (DFG INST 91027/10-1 FUGG).

Duality of Interest. No potential conflicts of interest relevant to this article were reported.

Author Contributions. K.J. and S.J.S. performed experiments, analyzed data, and wrote the manuscript. J.P., T.H.F., and C.S. performed experiments and analyzed data. P.P.N. and H.-P.H. gave conceptual and technological advice. J.K. conceived and designed the study and wrote the manuscript. J.K. is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Prior Presentation. Parts of this study were presented at Keystone Symposia on Molecular and Cellular Biology “Complications of Diabetes (X7),” Whistler Conference Centre, Whistler, British Columbia, Canada, 23–28 March 2014.