Table 1

List and sequences of primers used in RT-PCR experiments

Upstream primer (5′-3′)Downstream primer (5′-3′)Gene accession number
Mouse UCP1GGACGACCCCTAATCTAATGCATTAGATTAGGGGTCGTCCNM_009463.3
Mouse UCP2GGAGAGTCAAGGGCTAGTACTAGCCCTTGACTCTCCNM_011671.4
Mouse UCP3ATCAGGATTCTGGCAGGCGCCTGCCAGAATCCTGATNM_009464.3
Mouse PGC1αGATTGAAGTGGTGTAGCGACGTCGCTACACCACTTCAATCNM_008904.2
Mouse AgtGGAGTGACACCCAGAACATAGATGGCGAACAGGAAGNM_007428.3
Mouse EdnraCGGAGATCAACTTTCTGGTGGAGACGATTTCAATGGNM_010332.2
Mouse annexin A1CCCTTCCTTCAATGTATCCGCATAGCCAAAACAACCTCNM_010730.2
Mouse PsatTACAAGGAGGTGGGTCTGATTCTTCTGAGCACCAGCNM_001205339.1
Mouse Rb 1GGATGGAGAAGGACCTGATAGAGGCTGCTTGTGTCTCTGTNM_009029.2
Mouse p107GCAAGAGCATCATTCCTACTACGAAACTCTTGTGGTAGGTNM_011249.2
Mouse FoxC2ATCACTCTGAACGGCATCGGCACTTTCACGAAGCACNM_013519.2
Mouse RIP140CCTCGTCACTGCCTGAAGGCACTCAGAGCCAAGTTCAF053062.1
mtDNA gene CO1TGCTAGCCGCAGGCATTACGGGTGCCCAAAGAATCAGAACNC_013763.1
Single-copy nuclear gene Ndufv1CTTCCCCACTGGCCTCAAGCCAAAACCCAGTGATCCAGCNM_133666
Mouse β-actinATCTGGCACCACACCTTCAGCCAGGTCCAGACGCANM_007393