Table 1

Primers for QPCR

TargetGenBank Accession No.Sequence (5′ to 3′)Amplicon (Base Pairs)
Mouse Deaf1-Var1 (TaqMan assay)FJ377318Forward: CCTTCCCTTGGCCCACTT Reverse: AAGCACACAGCCTCGACATCT Probe: FAM-TTCTACGAATCTAAAGCTC-MGB62
Human DEAF1-VAR1 (SYBR green assay)FJ985253Forward: TCGGCTCAGGATGGGATCTT Reverse: GTCACGGTGATAAGGTCATG85
Human CELA1 (SYBR green assay)NM_001971Forward: GGCTGGAGACCATAACCTGA Reverse: AACACCCAGCTGGACATAGC172