Table 3

Sequence alignment of PCR-products, Uppsala

Case2GTACCTTTGTGCGCCTGTTTTATTACCCCCTCCCCTAACTGTAACTTAGAAGTAATACACACCGATCAACAGTAAGTGTGGCACGCCAGCCATGCTCCGATCAAGCACTTCTGTTCCCCC
Case4——————————————————————————————————————————————————————————————————————————————————-
Case5——————————————————————————————————————————————————————————————————————————————————-
Case6——————————————————————————————————————————————————————————————————————————————————-
Case2GGACCGAGTATCAATAGACTGCCCACGCGGTTGAAGGAGAAAGTCCGTTATCCGGCCAACTACTTCGAGAAGCCCAGTAACACCATGGAAGTTGCAGAGTGTTTCGCTCAGCACAACC
Case4——————————————————————————————————————————————————————————————————————————————————-
Case5——————————————————————————————————————————————————————————————————————————————————-
Case6——————————————————————————————————————————————————————————————————————————————————-
Case2CCAGTGTAGATCAGGTCGATGAGTCACTGCATACCCCACGGGTGACCGTGGCAGTGGCTGCGTTGGCGGCCTGCCTATGGGGAAGCCCATAGGACGCTCTAATACAGACATGGTGTGAAG
Case4——————————————————————————————————————————————————————————————————————————————————-
Case5——————————————————————————————————————————————————————————————————————————————————-
Case6——————————————————————————————————————————————————————————————————————————————————-
Case2AGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGTGGAGCATACGCCCTCAAGCCAGGGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGA
Case4————————————————————–CCCTGAATGCGGCTAATCCTAACTGTGGAGCACATGCCCACAAACCAGTGGGTGGTGTGTCGTAACGGGTAANTNNNNNGNNGAACCGA
Case5——————————————————————————————————————————————————————————————————————————————————-
Case6————————————————————–CCCTGANTGCGGCTAATCCTAACTGCGGAGCANATACCCACAAACCAGTGGGCAGTCTGTCGTAATGGGTAACTCTGCAGCGGAACCGA
Case2CTAC———————————————————————————————————————————————————————————————————————————————–
Case4CTACTTTGGGTGTCCGTGTTTCTATTTATTCCTATACNGGC———————————————————————————————————————————————————————
Case5————————————————————————————————————————AANAGTAAAAGAAACACGGACACCCAAAGTAGTCGGTTCCGCTGCNNAGTTACCCATTACG
Case6CTACTTTGGGTGTCCGTGTTTCT-TTTACTCTTTTATTGTCACCATAAGC AGC C AATAAAAGAGTAAAAGAAACACGGACACCCAAAGTAGTCGGTTCCGCTGCAGAGTTACCCATTACG
Case2————————————————————————————————
Case4————————————————————————————————
Case5ACAGACTGCCCACTGGCTTGTGGGTNNCTGCTCCGCAGTTAGGATTA
Case6ACAGACTGCCCAC———————————————————————
  • Variable nucleotide sites between cases appear in boldface.