Table 2

The primer sequences used in this study

BocForward5′AGCAGCTGGTGAGTTGAGTC3′
Backward5′GGAGCTTGCCCAGCAGC3′
CdoForward5′GCAACCAGAAAGGGAAGGGT3′
Backward5′GAGCTCAGACTTGGCACCTT3′
Ptch1Forward5′GCCACAGCCCCTAACAAAA3′
Backward5′CCCACAATCAACTCCTCCTG3′
Gli1Forward5′TCGACCTGCAAACCGTAATCC3′
Backward5′TCCTAAAGAAGGGCTCATGGTA3′
Gas1Forward5′GGAACACTG ACCCACACTCT3′
Backward5′AAAGACCCCCACCGTTCAG3′
Ccl5Forward5′TGCCCACGTCAAGGAGTATTT3′
Backward5′TTCTCTGGGTTGGCACACACT3′
CebpαForward5′GAACAGCAACGAGTACCGGGT3′
Backward5′CCATGGCCTTGACCAAGGAG3′
Fas1Forward5′GCTGCGGAAACTTCAGGAAAT3′
Backward5′AGAGACGTGTCACTCCTGGACTT3′
PparαForward5′AGGGTTGAGCTCAGTCAGGA3′
Backward5′GGTCACCTACGAGTGGCATT3′
PparγForward5′TTCAGAAGTGCCTTGCTGTG3′
Backward5′GCTGGTCGATATCACTGGAGA3′
Scd1Forward5′CCGGGCCCCTTAGATCGA3′
Backward5′TAGCCTGTAAAAGATTTCTGCA3′
AccForward5′CGCGGAGGAGTTCCTAATTC3′
Backward5′TGTCCCAGACGTAAGCCTTC3′
aP2Forward5′AAGGTGAAGAGCATCATAACCCT3′
Backward5′TCACGCCTTTCATAACACATTCC3′
TNFαForward5′AGCCCCCAGTCTGTATCCTT3′
Backward5′CTCCCTTTGCAGAACTCAGG3′
β-ActinForward5′GTCCCTGACCCTCCCAAAAG3′
Backward5′GCTGCCTCAACACCTCAACCC3′
Ucp1Forward5′TGCCCACGTCAAGGAGTATTT3′
Backward5′TTCTCTGGGTTGGCACACT
Ucp2Forward5′ACTGTCGAAGCCTACAAGAC3′
Backward5′CACCAGCTCAGTACAGTTGA3′
Ucp3Forward5′GCCTGTGGAAAGGGACTTGG3′
Backward5′GGAGCGTTCATGTATCGGGT3′