Table 1

Sequences of the primers used for the Q-PCR experiments

Forward primerReverse primer
Mouse β-actinAGGTCATCACTATTGGCAACGACACAGGATTCCATACCCAAGAAG
Mouse 26RFaGAAGGGGACCCACAGACATCGTCTTGCCTCCCTAGACGGAA
Mouse GPR103CACTGTTGTGACGGAAATCCTTCGGGTAGTGTACTGCC
Mouse INS-RATGGGCTTCGGGAGAGGATGGATGTCCATACCAGGGCAC
Mouse GLUT2CCCTGTTCCTAACCGGGATGGGCGAATTTATCCAGCAGCAC
Mouse GLUT4GTGACTGGAACACTGGTCCTACCAGCCACGTTGCATTGTAG
Mouse NPFF2ATCTGGAGTGGCAATGATACACATCCCACCATGCACAAGACAAA
Mouse GAPDHTCCGGACGCACCCTCATCGGTTGACCTCCAGGAAATC