TABLE 1

Primers used for 23 exons, flanking intronic regions, and promoter region of human IA-2

PrimersRegionForward primer (5′→3′)Reverse primer (3′→5′)
IExon 1 and 5′-proximalcatgtagtatgcaccagtccagcccaagtttcttcctgac
IIExon 2–3accttttcctctacagGCTGTCaatctctctcctccagtgcacc
IIIExon 4–7ctctttcctgatcagGATTGcctctgcactggacacttacC
IVExon 8–12ccacttgtgttgtgTAGACCctgatattccagttagcgca
VExon 13–18ccttgattctagccttgttccggccctgctgaccTCATATACG
VIExon 19gcccctgccgggcagGTGAAgcccatgcgg tccctccag
VIIExon 20–23gcccttctgtctctctcccagtacacagagatgctcacacagg
AAlu 1cacatctaatgatgaggccaggactggtgcatacgaacat
BAlu 2ggcggtggttgttcttaattgcctaagtgctgttatgacacc
CAlu 3acaacacttggctgggataacaggtgtaatgacctctaacagtgactaatac
D5′-distalacaacacttggctgggataacaggggactggtgcatacgaacat
  • Primers were designed from genomic sequences deposited in GenBank (accession no. AF042285 and Q16849). Primers located in introns are lower-cased; primers located in exons are capitalized.