TABLE 1

Primers for SSCP analysis of resistin gene

ExonExon size (bp)Product size (bp)Forward primerReverse primerTa (°C)
1118420gtgtgccggatttggttag (222)gccagggatcagtgaggtct (41)56
278160agggaccgtttggtctcac (34)gcgcctggacaacagtct (11)56
3131256agagtccacgctcctgtgtt (11)tcatcatcatcatctccaggtt (72)56
  • Number of nucleotides between the end of each PCR primer and the corresponding exon-intron boundary in parentheses. Ta, annealing temperature.