TABLE 1

RT-PCR primers, probes, and templates

Gene5′ sequence 3′Concentration (nmol/1)cDNA (ng/μl)
AGT FCTTCACTGAGAGCGCCTGC900
AGT RGAGACCCTCCACCTTGTCCA9002.5
AGT PCTGATCCAGCCTCACTATGCCTCTGACC225
REN FTTGGAGAGGTCACGGAGATGC50
REN RTGCCCACAACCCCATCAAAC9002.5
REN PCGCCTTACCCTTCATGCTGGCCG100
ACE FCACCCAGGCCAGGAAGTTT900
ACE RTGCCCGTTCTAGGTCCTGAA9001
ACE PCCAGTTGCAGAACACCACTATCAAGCGG175
AT1 FACCCAATGAAGTCCCGCCT300
AT1 RAGCAGCCAAATGATGATGCAG9001
AT1 PCGACGCACAATGCTTGTAGCCAAAGTCA175
AT2 FCCAAGTCCTGAAGATGGCAGC300
AT2 RGGAAGGTCAGAACATGGAAGGG9002.5
AT2 PTTGTTCTGGCCTTCATCATTTGCTGGC100
PPARγ FTCAAACACATCACCCCCCTG300
PPARγ RTGGCAGCCCTGAAAGATGC9001
PPARγ PAGGAGCAGAGCAAAGAGGTGGCCATC100
LEP FACCAGGATCAATGACATTTCACAC50
LEP RCCAGGAATGAAGTCCAAACCG3002.5
LEP PCGCAGTCAGTCTCCTCCAAACAGAAAGTCAT250
FAS FTGGCAAATTCGACCTTTCTCA50
FAS RGGACCCCGTGGAATGTCAC3002.5
FAS PACCACCCGCTCGGCATGGC250
  • The cDNA concentration refers to the final concentration of cDNA equal to reverse-transcribed RNA in each PCR. F, forward primer; R, reverse primer; P, probe (labeled 5′ FAM and 3′ TAMRA).