TABLE 1

Primer and probe sequences of PAF-AH and PAF-R

TargetSequence (5′-3′)Length*GenBank accession number
PAF-AH
 FWCCTGCAAGCTGGAATTCTCC123U34277
 RVCCCATTAGATGCCAAGCCAA
 TPTTCTCATGGTCTCGGAGCCTTCAGGAC
PAF-R
 FWCAACGAGGGCGACTGGATT97D50872
 RVGACACCCAAAAAGGCCACACT
 TPTCCTGTGCAACGTGGCTGGCTG
  • *

    * Amplicon length in base pairs.

  • Available at www.ncbi.nlm.nih.gov. FW, forward primer; RV, reverse primer; TP, TaqMan probe, dual-labeled with 5′FAM and 3′TAMRA.