TABLE 6

Primers used for PCR and sequencing of 5′ flanking region of the FOXC2 gene promoter

Primers (5′–3′)5′ position of each primerBuffer and DNA polymerase for PCR
PCR
 pr1F CCAAACCCCACAAAACTGCTCGCAGCGACG−1248Advantage GC genomic polymerase mix
 pr1R GTAATTCTGCTCGCTCAGGTAGGGCACCAC+72
Sequencing
 pr1F CCAAACCCCACAAAACTGCTCGCAGCGACG−1248
 1RN1 TCAGGTAGGGCACCACTCC+58
 pr2F GGCCCCCATAATTAGGAAA−938
 pr2R ATCTCTCCCAAAGACCTTG−841
 pr3F TCTTAGAGCCGACGGATTC−645
 pr3R CCCGGAACTTTGAGCCAAT−560
 pr4F GTCCTGGAGCCAGCGAGGA−283
 pr4R TTTCAGCGGACCGGGCGGA−198
  • The 5′ positions are shown by defining the translation start site as +1. The 5′ sequences were determined based on the comparison between the human draft sequence for the FOXC2 gene on chromosome 16 (GenBank accession no. NT_024788) and the human FOXC2 cDNA sequence (no. NM_005251). One large fragment was amplified by PCR with primers indicated as PCR and each region was sequenced with ones indicated as sequencing as described in research design and methods. F, forward; R, reverse; N, nested.