TABLE 7

Primers used for PCR and sequencing of the coding region of the FOX 2 gene

Amplified regionPrimers (5′–3′)5′ position of each primerBuffer and DNA polymerase for PCR
1
 PCR
  1FCTCTCTCGCTCTCAGGGC−81I
  7RATCCCCGCGCTGTACTGCT+155
 Sequencing
  1FN2TCTCAGGGCCCCCCTCGCT−72
  7RN6GCGCTGTACTGCTCCGGGT+149
2
 PCR and sequencing
  7FGCAGAATTACTACCGGGCT+63I*
  1RTGCTTGTTCTCCCGGTAGA+341
3
 PCR and sequencing
  2FCCTACAGCTACATCGCGCT+221ET*
  2RCTCCTTGGACACGTCCTTC+528
4
 PCR
  3FCTACAACATGTTCGAGAACG+456A*
  3RTGATGTTCTCCACGCTGAA+826
 Sequencing
  3FNTGTTCGAGAACGGCAGCTT+464
  3RNTTCTCCACGCTGAAGCCAG+821
5
 PCR
  4FCAAGGTGGAGACGCTGAG+678I*
  9RTCCAGGCCCTGAGCGCAC+965
 Sequencing
  4FN2AGACGCTGAGCCCCGAGAG+686
  9RTCCAGGCCCTGAGCGCAC+965
6
 PCR
  9FNGCCGCTCCCCCTGCCCTA+897I
  4RN2CGCTCGGGTGGTCCGAGAG+1090
 Sequencing
  9FNGCCGCTGGCGCTGCCTA+897
  4RN3GGTGGTCCGAGAGGGCCT+1081
7
 PCR
  5FGATGAGCCTGTACACCGG+1004
  5RGAACATCTCCCGCACGTT+1362
 Sequencing
  5FGATGAGCCTGTACACCGG+1004I*
  5RNCACGTTGGGGAAAGTTTGC+1350
8
 PCR
  6FGTATCTCAACCACAGCGG+1272ET*
  8R2GGGTCTGAGAAAAGGTTGG+1636
 Sequencing
  6FNCAACCACAGCGGGGACCT+1278
  8RNGAAAAGGTTGGTGGACATG+1628
  • The 5′ positions are shown by defining the translation start site as +1 with the caution that the one base shorter numbers than those from the human draft sequence for the FOXC2 gene on chromosome 16 (GenBank accession no. NT_024788) are used beyond +1060 as correct reference numbers of this gene. The coding region was determined based on the comparison between the human draft sequence and the human FOXC2 cDNA sequence (no. NM_005251). Each of the eight fragments was amplified by touchdown PCR with primers indicated as PCR and sequenced with ones indicated as sequencing as described in research design and methods. The nested primers required for sequencing are indicated as N.

  • *

    * ExTaq DNA polymerase was used instead of Taq. To denote the buffer used, A and I are based on the name of the Invitrogen Optimized TM buffer. ET, ExTaq buffer (Takara). F, forward; R, reverse.