TABLE 1

List of gene-specific primers

GenesForward primerReverse primerSize of product (bp)No. of cyclesGenBank accession no.
Insulin 1ccagctataatcagagaccagtgtagaagaagccacgct19735AK007345
Insulin 2tccgctacaatcaaaaaccatgctgggtagtggtgggtcta41135AK007612
Glucagonactcacagggcacattcaccccagttgatgaagtccctgg35340Z46845
Somatostatintcgctgctgcctgaggacctgccaagaagtacttggccagttc23230AK003014
PPactagctcagcacacaggatagacaagagaggctgcaagt36430M18208
p48tgcagtccatcaacgacgcggacagagttcttccagttc70835AK007922
Amylasecaggcaatcctgcaggaacaacacttgcggataactgtgcca48430X02579
Carboxypeptidase Agcatccattctagggagtgggaaagagtacttgatgccctg60130AK003088
pdx-1accatgaacagtgaggagcatcctcttgttttcctcgggt45140NM_008814
Pax4aaatggcgcaggcaagagaaatgaggaggaagccacagga28040XM_133023
Isl1agatatgggagacatgggcgatacacagcggaaacactcgatg32740NM_021459
ngn3tggcactcagcaaacagcgaacccagagccagacaggtct44430AF364300
Beta2cttggccaagaactacatctggggagtagggatgcaccgggaa22230AK018781
Pax6cagtcacagcggagtgaatccgcttcagctgaagtcgcat65830NM_013627
Nkx2.2aaccgtgccacgcgctcaaaagggcctaaggcctccagtct22030NM_010919
Nkx6.1tcttctggcccggggtgatgagccgcgtgcttcttcctcca28340NM_144955
Glut2cggtgggacttgtgctgctggctctgaagacgccaggaattccat41630AK005068
Glucokinasetggatgacagagccaggatggacttctgagccttctggggtg20830L38990
Kir6.2ggctcctagtgacctgcaccaccacagccacactgcgcttgcg31730U73626
PC2agagattccattgtgtgggacaaaatggacttggtgccca21530NM_008792
Oct-3/4accttccccatggcacttgatcttttgcccttctg85530M34381
Gapdhaccacagtccatgccatcactccaccaccctgttgctgta45225NM_008084