TABLE 1

PCR primers sequences and PCR conditions

Sequences (5′–3′)Annealing temperature (°C)Cycles (n)Product size
MCP-1
 SenseCAAACTGAAGCTCGCACTC5929659 bp
 AntisenseCATTTCCACAATAATATTTTAG
β1-integrin
 SenseGCCTTACATTAGCACAACACC5735283 bp
 AntisenseATCTCCAGCAAAGTGAAACC
β2-integrin
 SenseAAAAACATCCAGCCCATCTTC5735271 bp
 AntisenseATCTGCACGCCATCACAGTC
IP-10
 SenseTGAAAAAGAAGGGTGAGAAGAG5933413 bp
 AntisenseGGAAGATGGGAAAGGTGAGG
PECAM-1
 SenseAGGAAAGAAGGACACAGAGAC5633264 bp
 AntisenseATGGATTTAAGAACCGGCAG
IL-1 β
 SenseCTCTCTCACCTCTCCTACTCAC5633187 bp
 AntisenseACACTGCTACTTCTTGCCCC
TNF-α
 SenseCCAAACGATGTTGTACCCGA5929251 bp
 AntisenseCAGTTGGAGGAGAGACGGTA