TABLE 3

Sequences of oligonucleotide primers used for variant screening in the FOXC2

Forward primerReverse primerPrimer annealing temperature
5′ region5′ GCCGACGGATTCCTGCGCTC 3′5′ CCGCTCCTCGCTGGCTCCA 3′65°C
5′ region + exon5′ CCGATTCGCTGGGGGCTTGGAG 3′5′ GCGGGCTGGTGGTGGTGGTAGG 3′65°C
Exon5′ CCTACCTGAGCGAGCAGAATTACTA 3′3′ GAAGCGGTCCATGATGAACTG 3′63°C
Exon5′ ACCTGGTGAAGCCGCCCTACAG 3′5′ ACGCCGCCTCGCTCTTGA 3′65°C
Exon5′ GACCCGGACTCCTACAACAT 3′5′ GGTGTACAGGCTCATCGCTC 3′63°C
Exon5′ GAGCGATGAGCCTGTACAC 3′5′ CGGGACACGTCAGTATTTC 3′62°C
Exon + 3′ region5′ CAACGTGCGGGAGATGTTCAAC 3′5′ CACAGCACAGCCGTCCTGGTAG 3′64°C